Journal of Experimental Botany, Vol. 50, No. 337, pp. 1373–1379, August 1999
Partial synchronization of cell division in cultured maize (Zea mays L.) cells: differential cyclin, cdc2, histone, and retinoblastoma transcript accumulation during the cell cycle Adrian Peres1, Ferhan Ayaydin1, Krisztina Nikovics1, Crisanto Gutie´rrez2, Ga´bor V. Horva´th1, De´nes Dudits1 and Attila Fehe´r1,3 1 Institute of Plant Biology, Biological Research Center, POB 521, H-6701 Szeged, Hungary 2 Centro de Biologia Molecular ‘Severo Ochoa’ (CSIC-UAM), Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid, Spain Received 19 January 1999; Accepted 21 April 1999
Abstract Optimization of culture and treatment conditions for reproducible synchronization of the cell cycle in maize cells with hydroxyurea is described. Flow cytometric measurements of relative DNA contents revealed that, following the hydroxyurea block, around 55% of the cells were in the G1 phase (2C), 30% in the S phase (2C4C) and 15% in the G2 phase (4C) of the cell cycle. The highest frequencies of cells in the S phase could be observed 2 h after removal of hydroxyurea (35–40%). The cells reached increased G2 phase frequencies (60–70%) between 8–14 h, while the maximum number of mitotic cells (12–14%) were found between 14–17 h. Northern analysis of total RNA from the synchronized cells indicated an increased level of transcripts from two histone (H3Zm, H4Zm) genes during the S-phase. The changes in the mRNA levels of the maize cyclin variants CycB1;zm;1, CycB1;zm;2 and CycA1;zm;1 support the classification of these cyclins as mitotic cyclins with transcript accumulation during the G /M cell cycle phases. Using the maize 2 retinoblastoma (ZmRb-1) cDNA as hybridization probe, two transcripts were detected with different hybridization intensity: the smaller, more abundant transcript was recognized during the whole cell cycle with an increase after the release of the cells from the hydroxyurea block, while the larger mRNA could only be detected for 8 h after removal of hydroxyurea. The ZmRb-1 gene might respond to the increase of the
frequency of cells in the S phase or to the re-addition of conditioned medium to the cells after hydroxyurea removal. Key words: Cell cycle, cell synchronization, gene expression, Zea mays L.
Introduction The basic mechanisms of cell cycle control are conserved in all eukaryotes (for review see Doonan and Fobert, 1997; Dudits et al., 1998). There are two main checkpoints in the eukaryotic cell cycle: at late G , before DNA 1 replication, and at the G /M cell cycle phase boundary, 2 before mitosis. Cell cycle progression is dependent on the activity of different heteromeric protein kinase complexes with cyclin-dependent kinases (CDKs) as catalytic, and cyclins as regulatory subunits. The fine control of timing and co-ordination of cell cycle events is based on the tight regulation of the activity of these CDK complexes. This regulation is rather complex and involves different levels including transcription, protein–protein interaction and phosphorylation/dephosphorylation (Nigg, 1995). Although these control mechanisms exist in all type of eukaryotes, there are differences: for example, in plants, unlike in yeast or animal cells, not only the various cyclin genes but the genes of specific CDK variants also exhibit strongly cell cycle phase-dependent expression (Dudits et al., 1998; Magyar et al., 1997).
3 To whom correspondence should be addressed. Fax: +36 62 433 434. E-mail:
[email protected] © Oxford University Press 1999
1374 Peres et al. The expression pattern of cell cycle-regulated genes has been well studied in a broad range of organisms from yeast to humans including higher plants (for a review, Ito, 1998). In maize, several cell cycle-related cDNA clones coding for histones, cdc2 homologues, cyclins, and the retinoblastoma protein have been isolated and characterized (Colasanti et al., 1991; Philipps et al., 1986; Renaudin et al., 1994; Xie et al., 1996). Although the expression pattern of some of them could be correlated with cell division activity in different tissues (e.g. all of the five cyclins are expressed in the apical meristem, young ears and 30-d-old embryos but not in fully differentiated leaves), limited information is known about the transcriptional control of these maize genes during different phases of the cell cycle. In order to assess transcriptional regulation of cell cycle genes, direct and indirect methods are available. The indirect method is based on double-target in situ hybridization using a combination of two probes, one of which is a marker gene specifically expressed in a certain period of the cell cycle and the other is the gene of interest (Fobert et al., 1994). The direct method is the synchronization of cells in cell division and the analysis of the fluctuations of mRNA levels during cell cycle progression. For this later purpose, several plant cell lines were established with rapid growth rate and uniform colony size including the most widely used tobacco BY-2 or alfalfa A2 cell cultures ( Kapros et al., 1992; Nagata et al., 1992). Different methods are used to synchronize plant cells, but the most effective is the treatment of the cells with reversible cell cycle blockers like hydroxyurea (HU ) ( Kapros et al., 1992), aphidicolin (Sala et al., 1980) or propyzamide (Akaski et al., 1988). Due to the difficulties in plant cell synchronization, the cell cycle-dependent transcription of putative cell cycle genes were characterized only in few plant species like alfalfa, tobacco and Catharanthus roseus (Ito, 1998; Kapros et al., 1992; Magyar et al., 1997; Nagata et al., 1992). Recently, cell cycle genes of a monocot, rice, were transcriptionally characterized in cells synchronized at a low degree by hydroxyurea or colchicine (Sauter, 1997). In this paper, the improved conditions to reach a reproducible and sufficiently high cell division synchrony in maize are described, which allowed the determination of fluctuations in relative mRNA levels of selected cell cyclerelated genes in relation to the different cell cycle phases.
Materials and methods Plant material and maintenance of the cultures The He/89 ( Ke2/2) maize cell culture was maintained in N6M liquid medium exactly as described previously (Mo´rocz et al., 1990), but at a doubled 2,4-D concentration (1 mg l−1). In order to obtain a finer suspension, only the cells passing
through a 200 mm mesh were cultured further. The suspensions were subcultured weekly at 8% cell density (w/v). Cell synchronization and analysis Hydroxyurea (HU, 5–20 mM final concentration) was added to 200 ml of 3-d-old culture. The stock solution of HU (500 mM ) was prepared by freshly dissolving the drug in the medium taken from the cell suspension that was to be treated, followed by filter sterilization (0.2 mm). The cell suspension was subjected to HU treatment for 36 h under normal culture conditions. 2–3 h before the end of the HU treatment, conditioned medium was collected by filtering from parallel cultures maintained exactly the same way as the treated ones but without adding HU. In order to remove HU from the cultures completely, the cells were filtered through a 50 mm mesh, resuspended in HU-free medium and extensively washed with approximately 5–10 vols of 30%-conditioned medium for 2 h with sedimentation and decanting. After the last wash, cells were subcultured in the same conditioned medium used for washing. Synchrony was monitored by mitotic index and nuclear DNA content analysis in samples taken before and after the washing procedure and every 3 h subsequently. Cells were fixed in 8%-formaldehyde-containing PBS for 2 h and stained by 5 mg ml−1 4∞,6-diamidino-2-phenylindole (DAPI ) for mitotic index determination using fluorescence microscopy. Nuclei were released from a small aliquot of cells into Galbraith’s buffer (Galbraith et al., 1983) with increased Triton-X-100 content (0.6%) by vigorously pipetting the cell suspension following 1 h treatment with cell wall degrading enzymes (cellulase Onozuka RS 2%, pectolyase Y-23 0.2%, in a solution containing 3.64 g mannitol, 1.17 g CaCl and 0.2 g MES in 100 ml, at pH 6). 2 Nuclei were stained with EtBr (5 mg ml−1) and used for flow cytometric determination of the DNA content in 10–20 000 nuclei with a FACSCalibur flow cytometer from Becton Dickinson. Northern hybridization At the same time points indicated above for mitotic index and DNA content determinations, approximately 500 mg of cells were quickly frozen in liquid N for total RNA isolation using 2 the acidic phenol/guanidinium method (Chomczynski and Sacchi, 1987). 25–50 mg total RNA was loaded on 1.2% formaldehyde-containing gels and analysed by Northern hybridization using radiolabelled probes of different cell cycle genes. Radiolabelled probes were generated by random-primed 32Plabelling from the cDNA fragments containing the whole coding region of CycB1;zm;2, H3Zm, H4Zm (Colasanti et al., 1991; Philipps et al., 1986; Renaudin et al., 1994). Shorter specific probes were prepared by PCR amplification for cdc2zm, CycB1;zm;1, and CycA1;zm;1 using the primers shown in Table 1. The PCR fragments were sequenced by the dideoxy chain termination method using an automatic DNA sequencer (model No.373; Applied Biosystem, Foster City, CA). In order to detect ZmRb-1 transcripts, a 3.7 kb partial cDNA clone was used ( Xie et al., 1996). Hybridization was carried out overnight using standard procedures (Sambrook et al., 1989) and filters were washed at high stringency (65 °C, 3×20 min) with a phosphate-based washing solution (Chomczynski and Sacchi, 1987).
Results and discussion The HE/89 embryogenic maize line (Mo´rocz et al., 1990) was used as a starting material in order to select a fine,
Maize cell cycle synchronization fast-growing cell suspension with a cell doubling time of approximately 1 d. The auxin concentration was doubled in the medium (1 mg l−1) and the cells were subcultured weekly for several months under these conditions at a relatively high cell density (8%). Only the finest cell clusters selected with filtering through a 200 mm nylon mesh were subcultured. This culture method resulted in a very fine cell line which was further used for the optimization of cell cycle synchronization parameters. It was found that the hydroxyurea concentration and the washing conditions were the most critical factors in this procedure. The lowest concentration of HU suitable for the cell synchronization (no mitotic cells after 36 h of application) was found to be 5 mM at the 8% cell density used. Concentrations higher than 5 mM inhibited the subsequent progression of the cells through the cell cycle as indicated by a shift in the peak of the mitotic index from 15–24 h after the removal of the drug (data not shown). This could be the result of a toxic effect through inefficient removal of the higher amount of the inhibitor. To release the cells from the division block, washing was carried out during a 2 h period with several volumes of conditioned medium. Conditioning was achieved by mixing fresh medium with the cell-free medium of a parallel, untreated culture at 251 ratio. Washing and culturing the cells in the conditioned medium reproducibly increased the mitotic index by 4–5%. Based on the optimized cell culture (uniform, fine cell colonies; 3-d-old cell culture initiated at 8% cell density; 1 mg l−1 2.4-D) and treatment parameters (5 mM HU for 36 h; extensive washes with 30%-conditioned medium) it was possible reproducibly to reach around 35% synchrony in the S-phase and 10–15% in mitosis (counting only meta-, ana-, and telophase cells) with the S-phase peak 2 h and the mitosis peak 15 h after completing the washing process. In order to reveal cell cycle-related changes in the transcript levels of several maize cell cycle genes, three independent synchronization experiments were carried out using the above-described optimized protocol. Flow cytometry and mitotic index determinations revealed that following the hydroxyurea block, around 55% of the cells were in G phase (2C ), 30% in S phase (2C4C ) 1 and 15% in G phase (4C ) of the cell cycle and between 2 8 h and 14 h after removing the HU the majority of cells were in G phase, while between 14–20 h the highest 2 number of mitotic cells (12–14%) were found ( Figs 1, 2).
1375
Results from flow cytometric analysis of a representative experiment are shown in Fig. 1. As shown by Figs 2 and 3, mRNA levels of histone H3 and H4 genes were already increased 2 h after washing out the inhibitor, with a clear peak at 5 h. This is the time period when the frequency of S-phase cells is elevated in the culture, although the highest histone transcript levels does not coincide with the highest frequencies of cells in S phase (Figs 1, 2, 3). This can be the result of the presence of HU, the washing procedure during the first 2 h, the 1 h delay obtaining samples for flow cytometry as compared to sampling for RNA isolation due to the protoplastation step required for the release of nuclei (see Materials and methods) and/or to the weakness of the flow cytometric analysis to distinguish early S phase nuclei from G nuclei and late S phase nuclei from G 1 2 nuclei. A second peak in histone mRNA level was detected after 20 h. This reflects the fact that the cells entering the next cycle still retain a considerable level of synchrony (around 25% S phase at 23 h). The detection of low levels of histone transcripts throughout the cell cycle might result from partial synchrony or from cross-hybridization with constitutively expressed histone variants. During germination of maize seeds, histone H3 and H4 mRNAs also accumulate in parallel with the onset of DNA synthesis (Chaubet and Gigot, 1998). These results are also consistent with the results obtained in alfalfa, rice and tobacco where there is a strict temporal correlation between histone gene expression and the S-phase of the cell cycle (Chaubet and Gigot, 1998). Maize histone gene expression also coincides with the expression of a chimeric wheat histone H4 promoter-GUS reporter gene fusion in partially synchronized transgenic maize cells (Bilgin et al., 1999). The promoter elements and some of the transcription factors responsible for the replicationdependent expression of plant histone genes have already been identified in the above species (Chaubet et al., 1996; Iwabuchi et al., 1998). The sequence analysis of a high number of known plant mitotic cyclins show that they belong to two classes, namely CycA and CycB, and within these classes they are clustered in three CycA groups and two CycB groups (Renaudin et al., 1996). Members of the two main classes have different putative functions and they might have differential expression patterns during the cell cycle: A-type cyclins in general are expressed earlier, already being present during S-phase, while B-type cyclins exhibit
Table 1. Primer sequences used in PCR amplification for generation of DNA probes No
Name of the gene
Forward primer
Reverse primer
1 2 3
cdc2zm CycB1;zm;1 CycA1;zm;1
5∞GGCAGTATTCCACACCAGTT3∞ 5∞ATGACAGCACCTACAGCAAA3∞ 5∞AAACGAAGATAACTTGCTGC3∞
5∞GAGTACAGGCGTTCATAAAAAG3∞ 5∞ACCACACCAATGACCTAACA3∞ 5∞TCCATCACATGAAACACAAC3∞
1376 Peres et al.
Fig. 2. Experiment 1. Cyclin and histone transcript levels compared to mitotic indices in partially synchronized maize cells. At the indicated time points after HU removal (0–26 h), RNA samples were isolated from partially synchronized maize cells as described in the text. Mitotic indices were determined in parallel counting approximately 1000 DAPIstained nuclei using a fluorescence microscope. Northern analysis was carried out using the full-length cDNA probes for CycB1;zm;1, histone H4 and, as a RNA loading control, the clone m136 coding for a glycine-rich protein. The two hybridization signals obtained with the mitotic cyclin probe possibly represent the transcripts of the two homologous maize cyclins CycB1;zm;1 (1497 bp) and CycB1;zm;2 (1679 bp). (Asterisk indicates the time point when HU removal is completed.)
Fig. 1. Cell cycle phase progression of partially synchronized maize cells followed by flow cytometry in a representative experiment. (A) DNA fluorescence histograms obtained with flow cytometry of ethidium bromide-stained nuclei released from partially synchronized maize cells. The fluorescence peaks (DNA content, arbitrary units) related to the cell cycle phases (G , S, G ) are indicated. Nuclei were isolated from 1 2 cells sampled at the indicated time points after protoplasting for 1 h. The sample labelled as 0 h represents the cells in the presence of 5 mM HU after 36 h, before the washing procedure started. The sample labelled 2 h represents cells imediately after completion of a 2 h washing procedure to remove the drug. The cells were further cultured in HU-free medium and further samples were regularly taken every 3 h. Only six characteristic histograms (representing 10 000 measured nuclei each) are shown. (B) Cell cycle progression after HU removal as shown by fluctuations in the frequencies of nuclei with different DNA contents as determined by flow cytometric analysis, and in the frequencies of mitotic cells counted under a fluorescence microscope following DAPI staining. See Fig. 3 for related changes in mRNA levels of different cell cycle genes in the same synchronization experiment (Experiment 2).
a more strict G /M-phase specific expression (Renaudin 2 et al., 1996). Promoter elements of tobacco mitotic cyclin genes directing M-phase specific transcription have recently been identified (Ito et al., 1998). Based on the sequence data, the four maize cyclins represent the A1, B1 and B2 groups ( Renaudin et al., 1996), but the transcriptional regulation of these genes during cell cycle progression has not been studied so far. In partially synchronized maize cells, transcripts from CycB1;zm;1,
CycB1;zm;2 and CycA1;zm;1 genes could be detected ( Figs 2, 3), but no traces of CycB2;zm mRNA were present in these total RNA blots. This might be due to lower level of expression of certain cyclin genes and the insufficient sensitivity of the Northern analysis for their detection. CycB1;zm;1 and CycB1;zm;2 have been classified as mitotic cyclins (Renaudin et al., 1996). Indeed the present Northern analyses support this classification because transcripts from both maize B-type cyclins overlap with the mitotic index peak at 14–20 h after removal of HU ( Fig. 2). The cyclin CycA1;zm;1 was encountered as an A-type cyclin according to its sequence homology to the other known cyclins (Renaudin et al., 1996). In the present experiments with partially synchronized maize cell suspension, this cyclin gene also exhibits G /M phase 2 specific expression, but its mRNA level already peaks at 14 h in contrast to the B-type cyclins where the expression is clearly stronger at 17 h (Fig. 3). The mRNA of this gene can be already detected 5 h after starting HU removal, which may reflect its stronger and earlier expression as compared to the studied B-type maize cyclins. Up to now, two CDK cDNAs have been cloned from maize (Colasanti et al., 1991). These two CDK genes are the homologues of the yeast cdc2 gene and show close homology (98% similarity in protein sequence and 96% in DNA sequence), which indicates that they originate probably from gene duplication and have similar function (Sunderesan and Colasanti, 1998). The tissue-specific expression level of these genes was also analysed (Colasanti et al., 1991) and the cdc2zm transcripts were
Maize cell cycle synchronization
1377
Fig. 4. Experiment 3. ZmRb-1 transcript levels in partially synchronized maize cells. Samples were isolated and flow cytometry was carried out as described in Fig. 3 and in the text. The duration of the cell cycle phases was estimated on the basis of flow cytometric measurements of relative DNA contents in 10 000 nuclei and counting mitotic frequencies in 1000 cells, as shown in the autoradiograms. Probes used for the Northern analysis were: full-length cDNA clones of the maize retinoblastoma homologue ZmRb-1; histone H4 and the clone m136 coding for a glycine-rich protein as loading control. The two transcripts (the more abundant at 2.7 kb and another at 3.7 kb) recognized by the ZmRb-1 probe are signed by arrowheads. (Asterisk indicates the time point when HU removal is completed.) Fig. 3. Experiment 2. Histone, cyclin and cdc2 transcript levels in partially synchronized maize cells. At the time points indicated after HU removal (0–26 h) RNA samples were isolated from partially synchronized maize cells as described in the text. The duration of the cell cycle phases was estimated on the basis of flow cytometric measurements of relative DNA contents in 10 000 nuclei and counting mitotic frequencies in 1000 cells, as shown in the autoradiograms. Characteristic flow cytometric histograms of the experiment are as shown in Fig. 1. Probes used for the Northern analysis were: full-length histone H4 and histone H3 and 3∞ PCR fragments of CycB1;zm;1, CycA1;zm;1, cdc2zm, and the clone m136 coding for a glycine-rich protein. (Asterisk indicates the time point when HU removal is completed.)
proved to be present in higher amounts in tissues containing dividing cells in comparison to mature or differentiated tissues. In plants, the expression of the cdc2 homologues is considered to be linked not only with the progression of the cell cycle, but also with competence for cell division: cells with high competence to divide, as those from the basal part of maize leaves, retain cdc2 expression (Colasanti et al., 1991; Hemerly et al., 1993). That is why it is not surprising, that these cognate plant cdc2 genes are expressed more or less constitutively during the cell cycle; however, other plant specific members of the CDK protein family were shown to have cell cycle phase specific transcription (Magyar et al., 1997). It can be confirmed that cdc2zm mRNA levels in partially synchronized maize suspension culture cells reflects only slight changes in the more or less constitutive expression pattern (Fig. 3). The expression pattern of the maize retinoblastoma gene in the synchronized maize cell suspension was also analysed ( Fig. 4). In cultured maize cells, two sizes of retinoblastoma transcripts could be detected by using a
3.7 kb-long partial cDNA clone ( Xie et al., 1996) as a hybridization probe. These may derive from different retinoblastoma genes or represent different transcript forms of the same gene. The lower molecular weight (approximately 2.7 kb) transcript of the retinoblastoma gene was detected at much higher levels than the high molecular weight (approximately 3.7 kb) band, which could be seen only faintly. This might result from differences in the sequence and, consequently, in the hybridization efficiency or simply might mean a lower expression level. These two transcripts correspond to the size of transcripts already detected in maize roots and leaves ( Xie et al., 1996), and they may represent two alternatively polyadenylated gene expression products (Ach et al., 1997). It should be noted that there is an apparent contradiction between the data obtained at the mRNA and at the protein levels. The anti-C-terminal ZmRb-1 antibody produced by Huntley and co-workers (Huntley et al., 1998) only detected one Rb protein of 110 kDa in maize leaves and cell cultures, which is larger than the translated functional polypeptides (approximately 70 kDa) of the cDNAs detected in Northern experiments (Grafi et al., 1996; Huntley et al., 1998; Xie et al., 1996; and this work). To resolve this apparent contradiction further experiments are needed. In the experiments reported here, the 2.7 kb transcript was detected during the whole cell cycle; however, at the time of the HU block and during the release from the block, where the cells are at the G /S border, this size of transcript was 1 present in higher quantities and this increased level was maintained during the entire S-phase ( Fig. 4; 0–8 h). Increase in the frequency of S-phase cells during this
1378 Peres et al. period was confirmed by elevated histone gene transcription (Fig. 4). Upon entering into M-phase, between 14 and 20 h after HU removal, both Rb bands decreased in intensity; the larger (3.7 kb) transript was hardly detectable during this period. The abundance of ZmRb-1 transcripts did not increase during the S phase of the second cycle, marked by elevated histone transcription between 17–26 h, which might reflect that the ZmRb-1 gene rather responds to re-addition of the conditioned medium after HU arrest and not to the increased frequency of the cells in S phase. Further experiments are needed to answer this question. In mammalian cells, retinoblastoma protein is a negative regulator of the cell cycle with major roles in differentiation and apoptosis (Herwig and Strauss, 1997). The activity of this important tumour suppressor is controlled mainly at the post-translational level; however, it was also shown that its mRNA level drastically increases in the course of differentiation or modulated in response to cytokines (Herwig and Strauss, 1997). Elevated maize protein levels have also been found in differentiated maize leaf tips as compared to the mitotically active basal part (Huntley et al., 1998). The maize homologue of the retinoblastoma protein displays conserved interactions with G /S regulators of mammalian and plant cells also 1 suggesting functional conservation (Ach et al., 1997; Grafi et al., 1996; Huntley et al., 1998). Recently, it has been reported that mRNA level and promoter activity of the mammalian Rb gene depend on cell cycle progression in serum-stimulated cells, with elevated activity at middle to late G (Matsumoto et al., 1998). In these experiments 1 an increased Rb transcript level can be seen coinciding with an elevated histone H4 mRNA amount characteristic for S-phase, but since it was possible only partially to synchronize the cell population it can not be excluded that these samples contain a mixture of late G as well 1 as S-phase and even non-cycling cells. Further experiments, providing better resolution of cell cycle phases and monitoring the Rb protein level, are needed to verify cell cycle-dependent Rb function in plants. By the cell synchronization protocol described above, the synchronization of dividing suspension culture cells could reproducibly be achieved and the transcriptional regulation of maize cell cycle genes could be studied. It can be concluded from the data presented that replicationdependent histones and mitotic cyclins are transcriptionally regulated during the cell cycle, and these results support the use of the expression of these genes as cell cycle phase markers in maize. Affiliation of different cloned maize cyclins either to the A or B groups of mitotic cyclins is also strengthened by this study. The cognate cdc2 gene of maize is more or less constitutively expressed during the entire cell cycle similarly to other plants (Magyar et al., 1997), while increased retinoblastoma transcript levels in cells after HU removal
might reflect an additional level of regulation of S phase progression in plants.
Acknowledgements The maize histone H4 cDNA clone and the maize cyclin cDNA clones were kindly provided by C Gigot and J-P Renaudin, respectively. This work was partially supported by grants from the Hungarian Academy of Sciences (AKP 96/2–657 3,1/49) to AF, and grants PB960919 (DGES) and 06G/046/96 (CAM ) to CG as well as from Fundacion Ramon Areces to the Centro de Biologia Molecular. Ferhan Ayaydin had a NATO fellowship. We thank Bela Dusha for photography and for the preparation of the figures, and Metin Bilgin for valuable discussions.
References Ach RA, Durfee T, Miller AB, Taranto P, Hanley-Bowdoin L, Zambryski PC, Gruissem W. 1997. RRb1 and RRb2 encode maize retinoblastoma-related proteins that interact with a plant D-type cyclin and geminivirus replication protein. Molecular and Cellular Biology 17, 5077–5086. Akaski T, Isumi K, Nagano E, Enomoto M, Mizumo K, Shibaoka K. 1988. Effects of propyzamide on tobacco cell microtubules in vivo and in vitro. Plant Cell Physiology 29, 1053–1062. Bilgin M, Dedeoglu D, Peres A, Engler G, Inze´ D, Dudits D, Fehe´r A. 1999. Meristem, cell division and S-phase-dependent activity of wheat histone H4 promoter in transgenic maize plants. Plant Science 143, 35–44. Chaubet N, Gigot C. 1998. Histone gene expression. In: Francis D, Dudits D, Inze´ D, eds. Plant cell division. London: Portland Press, 269–284. Chaubet N, Flenet M, Clement B, Brignon P, Gigot C. 1996. Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene. The Plant Journal 10, 425–435. Chomczynski P, Sacchi N. 1987. Single step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Analytical Biochemistry 162, 156–159. Colasanti J, Tyers M, Sundaresan V. 1991. Isolation and characterization of cDNA clones encoding a functional p34cdc2 homologue from Zea mays. Proceedings of the National Academy of Sciences, USA 88, 3377–3381. Doonan J, Fobert P. 1997. Conserved and novel regulators of the plant cell cycle. Current Opinion in Cell Biology 9, 824–830. Dudits D, Magyar Z, Dea´k M, Me´szaros T, Miskolczi P, Fehe´r A, Brown S, Kondorosi E, Athanasiadis A, Pongor S, Bako´ L, Koncz C, Gyo¨rgyey J. 1998. Cyclin- and calcium-dependent kinase families: response of cell division to hormones and stress signals. In: Francis D, Dudits D, Inze´ D, eds. Plant cell division. London: Portland Press, 21–46. Fobert PR, Coens ES, Murphy GJ, Doonan JH. 1994. Patterns of cell division revealed by transcriptional regulation of genes during the cell cycle in plants. The EMBO Journal 13, 616–624. Galbraith DW, Harkins KR, Maddox JM, Ayres NM, Sharma DP, Firoozabady E. 1983. Rapid flow cytometric analysis of the cell cycle in intact plant tissues. Science 220, 1049–1051. Grafi G, Burnett RJ, Helentjaris T, Larkins BA, DeCaprio JA, Sellers WR, Kaelin Jr WG. 1996. A maize cDNA encoding a member of the retinoblastoma protein family: involvement in endoreduplication. Proceedings of the National Academy of Sciences, USA 93, 8962–8967. Hemerly AS, Ferreira P, de Almeida Engler J, Van Montagu M, Engler G, Inze´ D. 1993. cdc2a expression in Arabidopsis is
Maize cell cycle synchronization linked with the competence for cell division. The Plant Cell 5, 1711–1723. Herwig S, Strauss M. 1997. The retinoblastoma protein: a master regulator of cell cycle, differentiation and apoptosis. European Journal of Biochemistry 246, 581–601. Huntley R, Healy S, Freeman D, Lavender P, de Jager S, Greenwood J, Makker J, Walker E, Jackman M, Xie Q, Bannister AJ, Kouzarides T, Gutierrez C, Doonan JH, Murray JA. 1998. The maize retinoblastoma protein homologue ZmRb-1 is regulated during leaf development and displays conserved interactions with G /S regulators and plant 1 cyclin D (CycD) proteins. Plant Molecular Biology 37, 155–169. Ito M. 1998. Cell cycle dependent gene expression. In: Francis D, Dudits D, Inze´ D, eds. Plant cell division. London: Portland Press, 165–187. Ito M, Iwase M, Kodama H, Lavisse P, Komamine A, Nishihama R, Machida Y, Watanabe A. 1998. A novel cis-acting element in promoters of plant B-type cyclin genes activates M phasespecific transcription. The Plant Cell 10, 331–341. Iwabuchi M, Nakayama T, Meshi T. 1998. Transcriptional control of histone genes. In: Francis D, Dudits D, Inze´ D, eds. Plant cell division. London: Portland Press, 285–300. Kapros T, Bo¨gre L, Ne´meth K, Bako´ L, Gyo¨rgyey J, Wu SC, Dudits D. 1992. Differential expression of histone H3 gene variants during the cell cycle and somatic embryogenesis in alfalfa. Plant Physiology 98, 621–625. Magyar Z, Me´szaros T, Miskolczi P, Dea´k M, Fehe´r A, Brown S, Kondorosi E, Athanasiadis A, Pongor S, Bilgin M, Bako´ L, Koncz C, Dudits D. 1997. Cell cycle phase specificity of putative cyclin-dependent kinase variants in synchronised alfalfa cells. The Plant Cell 9, 223–235. Matsumoto T, Ohtani-Fujita N, Sowa Y, Bai F, Nikaido T, Tamaki T, Sakai T. 1998. Cell cycle-dependent modulation of promoter activities of Rb and WAF1/Cip1 genes. Japanese Journal of Cancer Research 89, 626–633. Mo´rocz S, Donn G, Ne´meth J, Dudits D. 1990. An improved system to obtain fertile regenerants via maize protoplasts isolated from a highly embryogenic suspension culture. Theoretical and Applied Genetics 80, 721–726.
1379
Nagata T, Nemoto Y, Hasezawa S. 1992. Tobacco BY-2 cell line as the ‘HeLa’ cell in the cell biology of higher plants. International Review of Cytology 132, 1–30. Nigg EA. 1995. Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. BioAssays 17, 471–480. Philipps G, Chaubet N, Chaboute ME, Ehling M, Gigot C. 1986. Genomic organization and nucleotides sequences of two corn H4 genes. Gene 42, 225–229. Renaudin JP, Colasanti J, Rime H, Yuan Z, Sundaresan V. 1994. Cloning of four cyclins from maize indicates that higher plants have three structurally distinct groups of mitotic cyclins. Proceedings of the National Academy of Sciences, USA 91, 7375–7379. Renaudin JP, Doonaan JH, Freeman D, Hashimoto J, Hirt H, Inze´ D, Jacobs T, Kouchi H, Rouze P, Sauter M, Savoure A, Sorrell DA, Sundaresan V, Murray JA. 1996. Plant cyclins a unified nomenclature for A-,B- and D-type cyclins based on sequence organization. Plant Molecular Biology 32, 1003–1018. Sala F, Parasi B, Burroni S, Amileni AR, Padralinoy G, Spadari S. 1980. Specific and reversible inhibition by aphidicolin of the a-like DNA polimerase of plant cells. FEBS Letters 117, 93–98. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Sauter M. 1997. Differential expression of CAK (cdc2-activating kinase)-like protein kinase, cyclins and cdc2 genes from rice during the cell cycle and in response to gibberellin. The Plant Journal 11, 181–190. Sunderesan V, Colasanti J. 1998. Cyclin-dependent kinases in higher plants: spatial and temporal control of cell division. In: Francis D, Dudits D, Inze´ D, eds. Plant cell division. London: Portland Press, 47–66. Xie Q, Sanz-Burgos AP, Hannon GJ, Gutie´rrez C. 1996. Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins. The EMBO Journal 15, 4900–4908.
