We identified a previously undocumented mutation in the dihydropteroate synthase (folP) gene associated with. Neisseria meningitidis sulfonamide resistance.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 2003, p. 3336–3338 0066-4804/03/$08.00⫹0 DOI: 10.1128/AAC.47.10.3336–3338.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Vol. 47, No. 10
PCR and Restriction Endonuclease Assay for Detection of a Novel Mutation Associated with Sulfonamide Resistance in Neisseria meningitidis De´sire´e E. Bennett1 and Mary T. Cafferkey1,2* Epidemiology and Molecular Biology Unit, The Children’s University Hospital,1 and Department of Clinical Microbiology, Royal College of Surgeons in Ireland,2 Dublin, Ireland Received 29 January 2003/Returned for modification 16 April 2003/Accepted 16 July 2003
We identified a previously undocumented mutation in the dihydropteroate synthase (folP) gene associated with Neisseria meningitidis sulfonamide resistance. A PCR-based assay to detect this mutation, which is 100% predictive of sulfonamide resistance, was developed. Neisseria meningitidis is a major pathogen worldwide. Because of their selective effect on the bacterial enzyme dihydropteroate synthase (DHPS), sulfonamides have been used in the treatment and prophylaxis of meningococcal disease since the late 1930s. However, widespread resistance limits their use. Despite this, the study of sulfonamide resistance in meningococci is still warranted for investigation of the general mechanisms of resistance or its reversibility, and resistance has been reported to be a useful epidemiological marker. Also there appear to be associations between pathogenicity and resistance (1, 12) and between rate of mortality and resistance (4, 7, 15, 16). Epidemics of meningococcal disease have been caused by resistant strains (13). Sulfonamide susceptibility status has been associated with endotoxin release (5, 17) and susceptibility to antineisserial activity expressed by other meningococcal isolates (3). In meningococci, altered forms of the chromosomal folP gene (encoding DHPS) mediate resistance, the folP genes in resistant strains having significant sequence differences from those in susceptible strains. Two types of DHPS have been identified with different folP mutations (16). One contains three nucleotide alterations associated with amino acid changes (Phe31-Leu, Pro84-Ser, and Gly194-Cys), and the second contains an additional 6-bp nucleotide sequence (two amino acid residues) (9, 15). During the late 1990s and 2000 (pre-Men C vaccination introduction, October 2000), meningococcal disease was hyperendemic in the Republic of Ireland, with infection rates reaching 12.38/100,000 population in 1999 (M. Cafferkey, K. Murphy, M. Fitzgerald, and D. O’Flanagan, Eur. Monitoring Group Meningococci, 6th Meet., abstr. P67-68, 2001). Throughout this period, isolates were tested (Meningococcal Reference Unit, Manchester, United Kingdom) for sulfadiazine susceptibility by the doubling dilution method. The proportion of isolates that were sulfadiazine resistant (MIC of ⱖ10 g/ml) ranged from 23.7% in 1997 to 28.9% in 1999 and decreased to 13.8% in 2000. It is unclear whether this is a true
reduction or an artifact due to the decline in the proportion of culture-proven cases of disease. In 2002, 61.1% of cases were diagnosed by specific meningococcal PCR only, and with fewer isolates available for testing, valuable information relating to sulfonamide susceptibility is being lost. In this study, we examined the diversity of folP genes in N. meningitidis to assess the potential for development of a PCRbased protocol to detect resistance. Following alignment of the DNA sequences of folP genes from nine unrelated N. meningitidis strains (four sensitive and five resistant) of serogroups A, B, and C (9, 15), four single-base-pair differences (in addition to those already documented) were identified. At nucleotide position 261, A is present in sensitive determinants, whereas G is present in resistant determinants (G261). The other three differences included changes from G to A at position 451 (A451), C to A at position 682 (A682), and either C or G to T at position 751 (T751). In order to verify whether these changes were also seen in Irish clinical isolates, we sequenced two independently derived PCR products of the entire coding region of the folP genes from nine clinical isolates and the resistant serogroup B reference strain, H44/76. Five of the nine isolates were resistant (sulfadiazine MICs of 10, 20, 50, 100, and 200 g/ml), and four were sensitive (sulfadiazine MICS of 0.4, 0.8, 3.2, and 6.4 g/ml). The sequence of the folP gene from the H44/76 reference strain was identical to that of MO035 (GenBank accession no. X68062) (15). Three of the five sulfadiazine-resistant clinical isolates contained a sequence coding for leucine at position 31, and the other two contained an additional 6-bp insertion sequence—mechanisms previously documented to confer resistance. Only two isolates contained the G261 alteration, three contained the A451 alteration, none harbored the T751 alteration, and all five contained the A682 alteration. None of the four sensitive determinants contained any of these alterations or any of the mutations previously documented to confer resistance. Alignment of the 19 sequences demonstrated that only the A682 alteration was common to the sequences of the resistant determinants irrespective of the sulfadiazine MICs for them. Consequently, we developed an assay to detect this alteration by PCR amplification followed by restriction endonuclease digestion. We designed primers for PCR analysis to create or delete
* Corresponding author. Mailing address: Epidemiology and Molecular Biology Unit, The Children’s University Hospital, Temple St., Dublin 1, Ireland. Phone: 353-1-878-4858. Fax: 353-1-878-4856. Email: M.Cafferkey@ tsch.ie. 3336
VOL. 47, 2003
NOTES
3337
TABLE 1. Sequences of the primers and PCR cycling conditions used to amplify the entire coding region of the N. meningitidis folP gene and to detect the A682 polymorphism within the gene Primer
Nmdhps3 Nmdhps4 Nmdhps7 Nmdhps8 a b c
Nucleotide alteration
Codon affected
C-A682
Arg228-Ser
N/Ac
N/A
Nucleotide positiona
Sequence (5⬘33⬘)b
588–611 683–707 ⫺3–22 841–865
CAAAACCTTGCAACACAATATCGAGCT TCGCCGGTCAGTTCGCCTATCAAGC CAGATGGCACGACACGTTTGGCAGG TGCGAACCGCTGTTTACAGATTGAT
PCR cycling conditions Denaturation
Annealing
Extension
94°C, 15 s
63°C, 30 s
72°C, 15 s
95°C, 60 s
55°C, 60 s
72°C, 60 s
All nucleotides are numbered according to the folP determinant of N. meningitidis strain 3976 (GenBank accession no. X87405) (10) relative to the ATG. Mismatches (from accession no. X87405) that were engineered into the primers are denoted in boldface. N/A, not applicable.
restriction sites so that this polymorphism, which is not described by a natural unique restriction site, could be detected. In resistant determinants with the A at position 682, a single base change at position 691 generates an AluI site, and therefore the A-to-C transition in sensitive determinants removes the AluI site. To detect this transition, two primers were designed that were specific for the regions flanking position 682 to yield a 120-bp amplicon (Table 1). The downstream primer contained a mismatch to generate an AluI site in resistant determinants and a mismatch to delete an existing AluI site. The upstream primer contained two substitutions (at positions 610 and 611) to generate an artificial AluI site in all amplicons regardless of the nature of the determinant. Thus, the presence or absence of the 120-bp band (undigested amplicon) serves as an indicator of whether digestion of PCR products with AluI is complete or not. After complete digestion, the sensitive determinant is 95 bp and the resistant determinant is 71 bp. We applied this assay to strain H44/76 and the nine clinical isolates. A 71-bp product was observed after digestion with the five resistant isolates and in strain H44/76, correctly identifying A682 in each of these, while a 95-bp product was observed with each of the four sensitive isolates, indicating that these did not contain A682. To confirm that A682 was consistent among all resistant determinants, we assayed a further 10 clinical isolates for which sulfadiazine MICs were ⱖ10 g/ml. Each yielded a 71-bp product, indicating the presence of A682 in their folP genes, correctly identifying them as resistant. These results indicated that the A682 transition, predicting the codon alteration Arg228-Ser, is present in the folP genes of all sulfadiazine-resistant isolates examined. The exact influence of this nucleotide substitution is unknown, especially given the findings of previous studies (8, 9, 14). It is possible that as a consequence of the C-to-A transition resulting in Arg228-Ser, resistance could be acquired in N. meningitidis as has been reported in Streptococcus pyogenes (11). A change of residue in the corresponding position, 213, in the DHPS determinant of S. pyogenes from arginine (susceptible strain) to glycine (resistant strain) had a major effect on sulfonamide susceptibility (11). Site-directed mutagenesis and enzyme kinetic studies demonstrated that resistance was almost reversible by changing only that position (11). Jonsson et al. concluded that this single Arg213-Gly change resulting from a point mutation led to significant sulfonamide resistance in S. pyogenes (11). In addition, by inference from structure-based DHPS sequence alignments from Escherichia coli (2), Staphylococcus aureus (10), and Mycobacterium tuberculosis (6), Arg-228 lies in
the loop 7⬘ region of the DHPS molecule; this region is highly conserved and is involved in substrate binding. The preceding residue, lysine 227, is absolutely conserved and is involved in binding the substrate 6-hydroxymethyl-7,8-dihydropterin pyrophosphate; arginine 228 is very highly conserved and believed to be involved in binding the substrate para-aminobenzoic acid, although the exact mechanism of binding remains to be elucidated (6). Therefore, it is not surprising that a change in residue 228 affects susceptibility. The systems described here—in particular the A682 PCRrestriction fragment length polymorphism assay—can be used to identify folP genotypes to distinguish between susceptible and resistant strains with 100% predictability. The methodology of PCR followed by restriction analysis can be used to develop similar tests for any other novel base pair transitions identified. Although the restriction digestion step is the limiting step, we have included an additional restriction site as an internal control to ensure against misinterpretations due to incomplete digestion. This is the first description detailing an association between this alteration and meningococcal sulfonamide insensitivity and the first description of a PCR-based detection assay that can rapidly, reliably, and accurately predict sulfonamide resistance in meningococci. We gratefully acknowledge Richard Walsh and Charles O’Neill for their suggestions and help in preparing the manuscript. We thank Steve Gray (Manchester Public Health Laboratory Services, Withington Hospital, Manchester, United Kingdom) for providing reference strain H44/76 and for performing the sensitivity testing. This work was supported by a grant from the Irish Health Research Board (EQ09/2000) and by funds from The Children’s University Hospital. REFERENCES 1. Aakre, R., A. Jenkins, B.-E. Kristiansen, and L. O. Frøholm. 1998. Clonal distribution of invasive Neisseria meningitidis isolates from the Norwegian county of Telemark, 1987 to 1995. J. Clin. Microbiol. 36:2623–2628. 2. Achari, A., D. Somers, J. Champness, P. Bryant, J. Rosemond, and D. Stammers. 1997. Crystal structure of the anti-bacterial sulfonamide drug target dihydropteroate synthase. Nat. Struct. Biol. 4:490–497. 3. Allunans, J., and K. Bøvre. 2001. Unusual antineisserial activity expressed by a systemic isolate of Neisseria meningitidis. Antimeningococcal effect and properties. Scand. J. Infect. Dis. 33:516–522. 4. Andersen, B. 1978. Mortality in meningococcal infections. Scand. J. Infect. Dis. 10:277–282. 5. Andersen, B., O. Solberg, and E. Holten. 1987. Endotoxin release from invasive meningococci related to sulfonamide resistance, serogroup and serotype. Scand. J. Infect. Dis. 19:43–49. 6. Baca, A., R. Sirawaraporn, S. Turley, W. Sirawaraporn, and W. Hol. 2000. Crystal structure of Mycobacterium tuberculosis 6-hydroxymethyl-7, 8-dihydropteroate synthase in complex with pterin monophosphate: new insight into the enzymatic mechanism and sulfa-drug action. J. Mol. Biol. 302:1193– 1212.
3338
NOTES
7. Bøvre, J., and T. Gedde-Dahl. 1980. Epidemiology patterns of meningococcal disease in Norway 1975–1979. Natl. Inst. Public Health Ann. 3:9–23. 8. Ferme´r, C., and G. Swedberg. 1997. Adaptation to sulfonamide resistance in Neisseria meningitidis may have required compensatory changes to retain enzyme function: kinetic analysis of dihydropteroate synthases from N. meningitidis expressed in a knockout mutant of Escherichia coli. J. Bacteriol. 179:831–837. 9. Ferme´r, C. B. E. Kristiansen, O. Sko ¨ld, and G. Swedberg. 1995. Sulfonamide resistance in Neisseria meningitidis as defined by site-directed mutagenesis could have its origin in other species. J. Bacteriol. 177:4669–4675. 10. Hampele, I., A. D’Arcy, G. Dale, D. Kostrewa, J. Nielsen, C. Oefner, M. Page, H.-J. Schonfeld, D. Stuber, and R. Then. 1997. Structure and function of the dihydropteroate synthase from Staphylococcus aureus. J. Mol. Biol. 268:21– 30. 11. Jonsson, M., K. Strom, and G. Swedberg. 2003. Mutations and horizontal transmission have contributed to sulfonamide resistance in Streptococcus pyogenes. Microb. Drug Resist. 9:147–153. 12. Kristiansen, B.-E., C. Ferme´r, A. Jenkins, E. Ask, G. Swedberg, and O. Sko ¨ld. 1995. PCR amplicon restriction endonuclease analysis of the chro-
ANTIMICROB. AGENTS CHEMOTHER.
13. 14.
15.
16. 17.
mosomal dhps gene of Neisseria meningitidis: a method for studying spread of the disease-causing strain in contacts of patients with meningococcal disease. J. Clin. Microbiol. 33:1174–1179. Peltola, H. 1983. Meningococcal disease: still with us. Rev. Infect. Dis. 5:71–91. Qvarnstro ¨m, Y., and G. Swedberg. 2000. Additive effects of a two-amino-acid insertion and a single-amino-acid substitution in dihydropteroate synthase for the development of sulfonamide-resistant Neisseria meningitidis. Microbiology 146:1151–1156. Ra ˚dstro ¨m, P., C. Ferme´r, B.-E. Kristiansen, A. Jenkins, O. Sko ¨ld, and G. Swedberg. 1992. Transformational exchanges in the dihydropteroate synthase gene of Neisseria meningitidis: a novel mechanism for acquisition of sulfonamide resistance. J. Bacteriol. 174:6386–6393. Sko ¨ld, O. 2000. Sulfonamide resistance: mechanisms and trends. Drug Res. Updates 3:155–160. Solberg, O., and B. Andersen. 1983. Sulfonamide resistance in Neisseria meningitidis strains liberating various amounts of free endotoxin. Scand. J. Infect. Dis. 15:149–151.
