Phosphatidylinositol 3,5-bisphosphate is involved in

JBC Papers in Press. Published on July 25, 2017 as Manuscript M117.791590 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M117.791590

Phosphatidylinositol 3,5-bisphosphate is involved in methylglyoxal-induced activation of the Mpk1 mitogen-activated protein kinase cascade in Saccharomyces cerevisiae Wataru Nomura1, Kazuhiro Maeta2, and Yoshiharu Inoue* Laboratory of Molecular Microbiology, Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011, Japan 1

Present address: Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011, Japan 2

Present address: Department of Neurotherapeutics, Osaka University Graduate School of Medicine, Osaka, Japan Running title: Role of PtdIns(3,5)P2 in MG-induced Mpk1 phosphorylation

Keywords: signal transduction, phosphoinositide, mitogen-activated protein kinase (MAPK), vacuole, Saccharomyces cerevisiae ABSTRACT Methylglyoxal (MG) is a natural metabolite derived from glycolysis, and this 2-oxoaldehyde has been implicated in some diseases including diabetes. However, the physiological significance of MG for cellular functions is yet to be fully elucidated. We previously reported that MG activates the Mpk1 (MAPK) cascade in the yeast Saccharomyces cerevisiae. To gain further insights into the cellular functions and responses to MG, we herein screened yeast-deletion mutant collections for susceptibility to MG. We found that mutants defective in the synthesis of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) are more susceptible to MG. PtdIns(3,5)P2 levels increased following MG treatment, and vacuolar morphology concomitantly changed to a single swollen shape. MG activated the Pkc1–Mpk1 MAPK cascade in which a small GTPase Rho1 plays a crucial role, and the MG-induced phosphorylation of Mpk1 was impaired in mutants defective in the PtdIns(3,5)P2 biosynthetic pathway. Of note, heat shock-induced stress also provoked Mpk1 phosphorylation in a Rho1-depepdent manner; however, PtdIns(3,5)P2 was dispensable for the heat shock-stimulated activation of this signaling pathway. Our results suggest that PtdIns(3,5)P2 is specifically involved in the MG-induced

activation of the Mpk1 MAPK cascade and in the cellular adaptation to MG-induced stress. INTRODUCTION Catabolic processes are necessary in all heterotrophs for life functions. Although numerous intermediates and their derivatives are produced during the metabolism of organic compounds to produce energy, some metabolic intermediates affect cellular functions (1-3). Methylglyoxal (MG) is one of the metabolites derived from glycolysis, and is mainly formed from the reaction of triosephosphate isomerase (4,5). Since MG is a highly reactive carbonyl compound, it produces advanced glycation end products (AGEs) with more than 20000-fold greater efficiency than glucose (4,5). Therefore, MG is involved in some diseases such as diabetes and its complications, cancers, Alzheimer’s disease, and autism (6-14), suggesting that MG plays a role as a functional metabolic intermediate under pathological conditions. However, the molecular mechanisms by which MG causes such diseases currently remain unclear. We have been attempting to reveal the physiological significance of MG using Saccharomyces cerevisiae and Schizosaccharomyces pombe as model organisms (4). We previously reported that MG causes acute 1

Copyright 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Downloaded from http://www.jbc.org/ by guest on September 14, 2017

* To whom correspondence should be addressed: Yoshiharu Inoue, Ph.D, Laboratory of Molecular Microbiology, Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011, Japan, Telephone: +81 774 38-3773; Fax: +81 774-38-3789; E-mail: [email protected]

cellular responses in yeast. For example, the exogenous addition of MG activated yeast AP-1-like transcription factors (15,16) and the signaling of the protein kinase C (Pkc1)-Mpk1 mitogen-activated protein (MAP) kinase (MAPK) cascade (17). MG was also found to inhibit glucose uptake through the attenuation of hexose transporter activities as well as the enhancement of their endocytosis (18). In the present study, we found that mutants defective in the synthesis of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) showed greater susceptibility to MG. The phosphorylated phosphatidylinositol (PtdIns) derivatives are crucial for various cellular processes including signal transduction, membrane traffic, and cytoskeleton organization (19,20). Four species of phosphoinositides have been identified in the budding yeast S. cerevisiae and (PtdIns3P, PtdIns4P, PtdIns(3,5)P2, PtdIns(4,5)P2) (20). PtdIns(3,5)P2 is synthesized from PtdIns3P by PtdIns3P 5-kinase (Fab1) in S. cerevisiae (19,20). In yeast, PtdIns(3,5)P2 is probably involved in the regulation of vacuolar morphology, i.e. the deletion of FAB1 was found to enhance vacuolar fusion and increase vacuolar size (21,22). PtdIns(3,5)P2 is also necessary for the stability of vacuolar H+ ATPase (V-ATPase) (23) and vacuolar acidification (21-24). In contrast, hyperosmotic stress, which transiently increases PtdIns(3,5)P2 levels, induces the fragmentation of vacuoles (25). Therefore, PtdIns(3,5)P2 plays a role in vacuolar functions and morphology. In the present study, we show that MG causes alterations in vacuolar morphology and levels in a increases PtdIns(3,5)P2 Fab1-dependent manner. Mutants defective in the biosynthetic pathway of PtdIns(3,5)P2 (vps34∆, fab1∆, and vac7∆vac14∆) showed sensitivity to MG. The Fig4 protein mostly functions as a phosphatidylinositol phosphatase; however, it is also involved in the Fab1 complex (Fab1-Vac7-Vac14) through an interaction with Vac14 (25,26). The steady state level of PtdIns(3,5)P2 in fig4∆ cells was similar to that in wild type cells; however, MG-induced increases in PtdIns(3,5)P2 levels did not occur in this mutant. We found that the MG-induced activation of the Pkc1-Mpk1 MAPK cascade was impaired in mutants defective in the synthetic pathway of PtdIns(3,5)P2 (vps34∆, fab1∆, and vac7∆vac14∆). In contrast, the heat shock-induced activation of this cascade occurred in these mutants. Notably,

the deletion of FIG4 did not affect the MG-induced phosphorylation of Mpk1 or tolerance to MG, indicating that an increase in PtdIns(3,5)P2 levels is not necessarily required for the MG-induced activation of the Mpk1 MAPK cascade.

2


RESULTS Screening of MG-sensitive mutants. To explore the physiological significance of MG in the biological system, we screened non-essential gene knockout collections of S. cerevisiae BY4741 for sensitivity to MG. Each mutant was cultured in YPD liquid medium in 96-well microtiter plates for 2 days and then replica plated onto YPD agar plates containing various concentrations of MG. Among approximately 4800 mutants, 204 mutants showed poor or no growth on YPD agar plates containing 30 mM MG. The cells of the candidates (204 mutants) (Table S1) from master plates (0 mM MG) were picked up and then streaked on YPD agar plates containing 30 mM MG to verify their sensitivity to MG, and the mutants that clearly showed sensitivity to MG were selected (62 mutants) (Table S1). The resultant candidates were cultured in YPD medium until the log phase of growth, serially diluted, and spotted on YPD agar plates containing various concentrations of MG. Thirty-one mutants showed severe sensitivity to MG (Table 1). GLO1 and GLO2 code for glyoxalase I and glyoxalase II, respectively, which catalyze the detoxification of MG to lactic acid (4), and mutants defective in these genes were involved in this screening, indicating that our screening system worked appropriately. The activities of glyoxalases I and II in these mutants, except for glo1∆ and glo2∆, were not significantly different from those in wild type cells (data not shown). The responsible genes of these 31 mutants obtained by our screening method were classified into 7 categories (Table 1), among which several mutants defective in lipid metabolism were involved. Notably, VPS34 and VPS15, which encode PtdIns 3-kinase and its regulatory protein (Ser/Thr kinase), respectively, were involved. The phosphatidylinositol species in S. cerevisiae identified to date were PtdIns3P, PtdIns4P, PtdIns(3,5)P2, and PtdIns(4,5)P2 (Fig. 1A). Since vps34∆ and vps15∆ mutants showed greater susceptibility to MG, we investigated whether a

10 mM MG for 60 min. To evaluate this phenomenon quantitatively, we measured the number of vacuoles per cell and the size (diameter) of vacuoles. As shown in Fig. 2A, the number of vacuoles per cell decreased, while vacuolar size inversely increased following the treatment with MG. In addition, vacuolar morphology reverted to the fragmented form when MG was removed from the medium (Fig. 2B). The HOPS (homotypic vacuole fusion and vacuole protein sorting) complex and SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) were previously shown to be needed for homotypic vacuolar fusion (38). Previous studies reported that the deletion mutant of Vps41 (one of the subunits of HOPS) or Vam3 (a vacuolar t-SNARE) has highly fragmented vacuoles (36,39). As shown in Fig. 2C, MG-induced vacuolar defragmentation did not occur in these mutants, suggesting that MG induces the fusion of vacuoles. MG increases PtdIns(3,5)P2 levels. PtdIns(3,5)P2 cellular levels increased under hyperosmotic stressed conditions, in which cell vacuoles shrank and fragmented; therefore, an increase in PtdIns(3,5)P2 levels is considered to be related to the fragmentation of vacuoles (25,40). Since we found that the defragmentation of vacuoles occurred in the presence of MG, we expected PtdIns(3,5)P2 levels to decrease under these conditions. However, contrary to our expectations, PtdIns(3,5)P2 cellular levels increased by approximately 3-fold after the treatment with MG for 60 min (Table 2). PtdIns3P and PtdIns4P levels remained unchanged, while PtdIns(4,5)P2) levels slightly (~ 15%) decreased following the treatment with MG (Table 2). We then examined the time course of changes in vacuolar morphology and PtdIns(3,5)P2 levels in the presence of MG. As shown in Fig. 3A, the number of vacuoles per cell decreased, and vacuolar size increased with increasing levels of PtdIns(3,5)P2 following the treatment with MG. Previous studies reported that Atg18 binds to PtdIns(3,5)P2, and Atg18-GFP is detected in the limited area of the vacuolar membrane as well as punctate structures (41-43). PtdIns(3,5)P2 is necessary for recruiting Atg18 to the vacuolar membrane (41-43). As shown in Fig. 3B, MG enhanced the recruitment of Atg18 to the vacuolar membrane in wild type cells. The punctate structures of Atg18-GFP in wild type

MG changes vacuolar morphology. PtdIns(3,5)P2 is enriched in the vacuolar membrane and is involved in the control of vacuolar morphology and functions (22,30-34). Previous studies reported that mutants defective in the production of PtdIns(3,5)P2, i.e. vps34∆, vps15∆, fab1∆, vac7∆, and vac14∆, have a single grossly enlarged vacuole (21,22,35,36). Vacuolar morphology dynamically changes in response to alterations in environmental conditions around the cell, e.g. vacuoles are fragmented and shrunken under hyperosmotic conditions, but swollen under hypo-osmotic conditions (37). We previously reported that MG enhances the internalization of hexose transporters (Hxts) from the plasma membrane as well as the degradation of Hxts in vacuoles through the endocytotic pathway (18). In the process of observing the endocytosis of Hxts to vacuoles, we noted that MG changed vacuolar morphology. Therefore, we examined the effects of MG on vacuolar morphology. Wild type cells at the logarithmic growth phase predominantly have two to four fragmented vacuoles. As shown in Fig. 2A, vacuolar morphology changed from a fragmented form to a single swollen shape following the treatment with

3


mutant defective in FAB1, encoding PtdIns3P 5-kinase that synthesizes PtdIns(3,5)P2, also exhibits MG sensitivity on YPD agar plates. A fab1∆ mutant with the BY4741 background did not show strong susceptibility to 20 mM MG on YPD agar plates (Fig. 1B); however, fab1∆ cells showed severe growth defects on SD agar plates containing 8 mM MG (Fig. 1C). Since the catalytic activity of Fab1 is regulated by the activator proteins Vac7 and Vac14 (22,27-29), we assessed the effects of a deficiency in these genes on growth in SD medium containing MG. FAB1, VAC7, and VAC14 were disrupted in YPH250, and the susceptibilities of resultant mutants to MG were evaluated. As shown in Fig. 1D, a fab1∆ mutant (YPH250) showed severe susceptibility to MG (no growth on SD agar plates containing 4 mM MG), and a vac7∆vac14∆ mutant was unable to grow on SD agar plates containing 6 mM MG, in which medium wild type cells showed poor growth. These results suggest that PtdIns(3,5)P2 is involved in tolerance or adaptation to MG-induced stress. In the present study, we focused on the physiological role of PtdIns(3,5)P2 with respect to MG-induced stress responses.

cells were rarely observed in our system, and the number of punctate structures did not increase in the presence of MG. Vac7 and Vac14 form a complex with Fab1 (22,27-29), and this complex is crucial for the synthesis of PtdIns(3,5)P2; therefore, PtdIns(3,5)P2 rarely exists or is hardly detectable in these mutants (22,27,28). We were unable to detect PtdIns(3,5)P2 in these mutants in the presence or absence of MG by our analytical system (data not shown); therefore, the recruitment of Atg18-GFP to the vacuolar membrane did not appear to occur in vac14∆ cells. These results suggest that MG increases PtdIns(3,5)P2 levels in the vacuolar membrane. MG does not affect vacuolar acidification. A correlation between PtdIns(3,5)P2 levels and the regulation of vacuolar acidification has been reported (21-24). The pH of vacuoles is kept low (~6.0) by the actions of V-ATPases, whereas the acidification of vacuoles is not achieved in mutants defective in the synthesis of PtdIns(3,5)P2, such as fab1∆, vac7∆, and vac14∆ (21-24). Therefore, PtdIns(3,5)P2 appears to play a crucial role in the acidification of vacuoles. A recent study reported that the loss of vacuolar acidity by the pharmacological inhibition of V-ATPase activity induces vacuolar fusion (44). These findings imply that MG-induced vacuolar defragmentation is caused by an impairment in vacuolar acidification, and an increase in PtdIns(3,5)P2 levels is one of the adaptation mechanisms that enhance V-ATPase activity. To investigate this possibility, we assessed vacuolar acidity using quinacrine, a fluorescent weak base to assess vacuolar acidification (28,45). Consistent with previous findings (21-24), vacuoles in fab1∆, vac7∆, and vac14∆ cells were not acidified (Fig. 4). The fluorescence intensity of vacuoles derived from quinacrine in wild type cells was not decreased by the MG treatment (Fig. 4), indicating that MG does not affect vacuolar acidification.

Increases in PtdIns(3,5)P2 levels are not necessarily required for the MG-induced phosphorylation of Mpk1. Intercellular levels of PtdIns(3,5)P2 are regulated by PtdIns kinases as well as PtdIns phosphatases. The Fig4 protein mostly functions as a PtdIns(3,5)P2 5-phosphatase; however, it is also a member of the Fab1 complex via binding to Vac14 (25,48). Therefore, Fig4 is necessary for the biosynthetic process of PtdIns(3,5)P2 under hyperosmotic stressed conditions (48). As shown in Fig. 6A, steady state levels of PtdIns(3,5)P2 in wild type and fig4∆ cells were almost similar; however, the MG-induced increase in PtdIns(3,5)P2 levels did not occur in fig4∆ cells. Accordingly, the recruitment of Atg18-GFP to vacuolar membranes was not observed in fig4∆ cells following the treatment with MG (Fig. 6B). Meanwhile, the punctate structures of Atg18-GFP were more clearly observed in fig4∆ cells in the presence of MG; however, the reason for this currently remains unclear. These results indicate that the MG-induced increase in PtdIns(3,5)P2 levels occurs in vacuolar membranes in a Fig4-dependent manner. To investigate whether the MG-induced increase in PtdIns(3,5)P2 levels in vacuolar

PtdIns(3,5)P2 is necessary for the MG-induced activation of the Mpk1 MAPK cascade. We previously reported that MG activated Pkc1–Mpk1 signaling, and mutants defective in the Mpk1 MAPK cascade exhibited susceptibility to MG (17,46). Since mutants defective in the PtdIns(3,5)P2 biosynthetic pathway were also sensitive to MG (Fig. 1), PtdIns(3,5)P2 may be involved in the MG-induced activation of Pkc1– Mpk1 signaling. In order to verify this possibility,

4


we introduced the constitutively active allele of PKC1 (PKC1R398P) into fab1∆ cells, and susceptibility to MG was investigated. As shown in Fig. 5A, PKC1 (PKC1R398P) suppressed the susceptibility of fab1∆ cells to MG. This result supports our hypothesis that a relationship exists between PtdIns(3,5)P2 levels and the activation of the Pkc1–Mpk1 MAPK cascade. We then monitored the phosphorylation status of Mpk1 as an index of the activation of Pkc1–Mpk1 signaling in mutants defective in the synthesis of PtdIns(3,5)P2. In wild type cells, the phosphorylation levels of Mpk1 were elevated following the treatment with MG (Fig. 5A) (17,46). Interestingly, the MG-induced phosphorylation of Mpk1 in vps34∆, fab1∆, and vac7∆vac14∆ cells was significantly weaker than that in wild type cells (Fig. 5B). Heat shock stress is also known to activate the Pkc1–Mpk1 MAPK cascade (47). However, the heat shock-induced phosphorylation of Mpk1 in vps34∆, fab1∆, and vac7∆vac14∆ cells was not markedly impaired (Fig. 5C). These results indicate that the biosynthetic pathway of PtdIns(3,5)P2 plays a role in the MG-induced activation of the Pkc1– Mpk1 MAPK cascade.

eventually leads to the production of advanced glycation end products (AGEs). Since this step is irreversible, MG-modified proteins must be removed from cells in order to avoid adverse effects on biological systems. For example, the accumulation of MG as well as MG-derived AGEs has been implicated in type 2 diabetes and its complications. Therefore, some mutants defective in protein quality control, including E3 ubiquitin ligase (HEL2), may be isolated as MG-sensitive mutants. Besides protein carbonylation, MG is known to exert genotoxicity, thereby causing DNA damage (5,49). Hence, some mutants defective in DNA repair (RAD1, RAD50, and RAD51) conceivably exhibit MG sensitivity. We previously reported that MG induces the endocytosis of Hxts from the cytoplasmic membranes in S. cerevisiae (18). Some mutants defective in membrane traffic, such as CHC1 and CLC1 (encoding the clathrin heavy chain and light chain, and crucial for the formation of endocytotic vesicles) (50,51), PEP12 (involved in the endocytotic process) (52), and PEP3 (encoding the COEVET component, and functioning in the vesicular docking/fusion process) (53). Although the physiological significance of MG-induced endocytosis of Hxts in yeast cells remains unclear, it may provide a model of hyperglycemia in diabetic patients whose blood MG levels are higher than those of healthy individuals (18). A deficiency in the membrane traffic process, including endocytosis, appears to have serious effects on cellular functions in the presence of MG. In the present study, we focused on the mutants categorized in lipid metabolism. Besides PtdIns3P mutants, another interesting result was that mutants defective in CSG2 and ISC1, gene products involved in sphingolipid biosynthesis, showed MG sensitivity. We recently reported that MG activated the target of rapamycin complex 2 (TORC2) signaling in S. cerevisiae as well as mammalian cells (17). TORC2 is involved in the regulation of sphingolipid biosynthesis in yeast (54). Mutants defective in the sphingolipid biosynthetic process are involved in MG-sensitive mutants, suggesting a correlation between MG and the TORC2 signaling pathway. Vacuoles are dynamic organelles and their morphology is altered by environmental changes as well as some stress conditions, including hypo-osmotic stress, heat stress, and ethanol stress, conditions under which vacuoles are

DISCUSSION In the present study, we performed a comprehensive screening of mutants showing MG sensitivity using the non-essential gene knockout collections of S. cerevisiae BY4741. We eventually identified 31 mutants, the responsible genes of which were classified into 7 categories. For example, deficiencies in several transcriptional regulators (NGG1, HFI1, SWI3, TAF14, and ERT1) were found to exhibit sensitivity to MG. We previously reported that the yeast AP-1-like transcription factor Yap1 is activated through the reversible modification of C-terminal Cys residues within Yap1 with MG (15). Yap1 regulates the expression of GSH1 encoding the rate-limiting step enzyme of glutathione biosynthesis, and glutathione is necessary for the detoxification of MG (4); therefore, a yap1∆ mutant showed increased sensitivity to MG in SD medium (15). However, since YPD medium contained large amounts of glutathione, neither the yap1∆ nor gsh1∆ mutant was isolated in the 1st screening by our method. The genome-wide DNA microarray analysis revealed that the expression profile of yeast genes markedly changed following the treatment with MG (15). Therefore, the mutants defective in some transcriptional regulators were isolated as MG-sensitive mutants. Some mutants categorized in protein quality control also showed MG sensitivity. MG is capable of binding with the amino, guanidino, and sulfhydryl groups of the amino acid residues of proteins to cause protein carbonylation, which

5


membranes is crucial for the MG-induced activation of Pkc1–Mpk1 MAPK signaling, we examined the phosphorylation levels of Mpk1 following the treatment with MG in fig4∆ cells. The MG-induced phosphorylation of Mpk1 occurred even in fig4∆ cells (Fig. 6C). In addition, the deletion of FIG4 did not enhance susceptibility to MG (Fig. 6D). Taking the results of Fig. 5 into account, the presence of a similar amount of PtdIns(3,5)P2 with the steady state level in wild type cells is sufficient for activation of the Pkc1–Mpk1 MAPK cascade in fig4∆ cells, and further increases in PtdIns(3,5)P2 levels are not necessarily required for this response cued by extracellular MG. Therefore, the presence of a similar amount of PtdIns(3,5)P2 in fig4∆ cells to that in wild type cells appears to be sufficient for adaptation to MG stress (Fig. 6D).

necessary for the MG-induced activation of TORC2–Pkc1 signaling (17). GFP-tagged Rho1 has been reported to localize at the plasma membranes and endomembrane including vacuolar membranes, in which PtdIns(3,5)P2 is abundant (57). A recent study reported that the C terminus of Rho1 has the ability to bind to some anionic lipids including PtdIns(3,5)P2 in vitro (58). These findings imply that PtdIns(3,5)P2 is involved in the MG-induced activation of the Pkc1–Mpk1 MAPK cascade via Rho1. Further studies are needed in order to elucidate the molecular mechanisms underlying the connection between PtdIns(3,5)P2 and the Pkc1–Mpk1 MAPK cascade.

EXPERIMENTAL PROCEDURES Media The media used were YPD (2% glucose, 1% yeast extract, and 2% peptone) and SD (2% glucose and 0.67% yeast nitrogen base without amino acids) with appropriate amino acids and bases being added to SD media where necessary. Strains The yeast strains used had the YPH250 background (MATa trp1-Δ1 his3-Δ200 leu2-Δ1 lys2-801 ade2-101 ura3-52) unless otherwise stated. Gene deletions of FAB1 and VAC14 were constructed by PCR-based methods with his5+ selective markers (59). Deletion constructs were amplified by PCR from BY4741-based deletion mutants (Invitrogen), and the corresponding loci of YPH250 were disrupted using PCR products. The VAC7 gene in YPH250 was disrupted by gene replacement methods using the Candida glabrata LEU2 gene (CgLEU2) as a selectable marker (60) with the following primers: 5’-ACAGAAGAAGATAGAAAGCTCACTGTA GAGACAGAAACAGTACGAAGTTATTAGG TCTAG-3’ and 5’-GGTTGCTGTTGCTGCTGCTGCTGCTGGC TGGAGGAGTCAGACGAAGTTATATTAAG GGTT-3’; and the plasmid BYP1419 as a template. In order to disrupt FIG4, the fig4∆::LEU2 allele in SEY6210 (61) was amplified by PCR with the following primers: 5’-GCCGAGCACTATTGAAATGTAAATGCT GTG-3’ and 5’-TGGTGGAATCTCACTACTTTCATGACTG AT-3’, and the resultant PCR product was introduced into YPH250.

6


swollen (37,55). The metabolism of PtdIns(3,5)P2 is involved in vacuolar morphology. PtdIns(3,5)P2 levels are lower in yeast cells than other phosphoinositides, although hyperosmotic stress has been shown to cause an acute elevation in PtdIns(3,5)P2 levels within 15 min (40). The elevation induced in PtdIns(3,5)P2 levels by MG was slower than that induced by hyperosmotic stress (Fig. 3A). Therefore, our results suggest that MG activates the machinery involved in the biosynthesis of PtdIns(3,5)P2 in a different manner by which osmotic stress elevates PtdIns(3,5)P2 levels. Hyperosmotic stress causes vacuolar fragmentation accompanied by a decrease in the volume of vacuoles. Since mutants defective in the synthetic pathway of PtdIns(3,5)P2 have a single enlarged vacuole, PtdIns(3,5)P2 appears to be linked with vacuolar morphology and size. We found that MG altered vacuolar morphology from a fragmented form to a single swollen shape through the induction of vacuolar fusion (Fig. 2), despite MG increasing PtdIns(3,5)P2 levels (Fig. 3A). A previous study reported that heat shock stress, which also alters vacuolar morphology from a fragmented form to a single swollen shape, increased PtdIns(3,5)P2 levels (56). Consequently, increase in PtdIns(3,5)P2 levels seems not necessarily correlate with vacuolar fragmentation. Fragmented vacuoles become a large single vacuole in the stationary phase of growth (37). We previously reported that intracellular levels of MG increase with cell growth and reach a maximum during the transition period from the logarithmic phase to the stationary phase, which is referred to as the diauxic shift (15). Although the mechanisms by which MG promotes vacuolar fusion currently remain unclear (Fig. 2), the MG-induced defragmentation of vacuoles may be involved in entry into the diauxic shift. A certain level of PtdIns(3,5)P2 appears to be necessary for activation of the Pkc1–Mpk1 MAPK cascade following the treatment with MG (Figs. 5 and 6); however, the heat shock-induced activation of this signaling pathway did not depend on PtdIns(3,5)P2, despite heat shock also increasing PtdIns(3,5)P2 levels (56) (Fig. 5). We recently reported that MG activated TORC2-Pkc1 signaling, which led to the phosphorylation of Mpk1 (17). Therefore, PtdIns(3,5)P2 may be involved in the regulation of TORC2 signaling. The small GTPase Rho1 is a regulator of the cell wall integrity pathway, in which the Pkc1–Mpk1 MAPK cascade is involved (47). Rho1 is also

YPD or SD agar plates containing various concentrations of MG.

In order to disrupt VPS34, pKTY38, a derivative of pPHY38 (35), was digested with HindIII and KpnI, and the resultant HindIII-KpnI fragment was introduced into YPH250.

Fluorescence microscopy The fluorescence microscope BX51 (OLYMPUS) equipped with a digital camera DP70 (OLYMPUS) was used. Western blotting Procedures for the detection of Mpk1 were described previously (17). Anti-phospho-p44/42 MAP kinase (#9101; Cell Signaling) and anti-Mpk1 (sc6803; Santa Cruz Biotechnology) were used as the primary antibody. Immunoreactive bands were visualized with a BCIP-NBT solution kit (Nacalai tesque). The intensity of the immunoreactive bands was quantified using ImageJ. Vacuolar staining Yeast vacuoles were visualized in vivo by labeling with FM4-64 (Molecular Probes. Inc., Eugene, OR, U.S.A.) (63). Quinacrine (Sigma) staining for the evaluation of vacuolar acidification was performed as previously reported (28,45).

Treatment with chemicals Cells were cultured in SD medium (2% glucose, 0.67% yeast nitrogen base without amino acids) supplemented with appropriate amino acids and bases where necessary. When the A610 of the culture reached 0.3-0.5, 5 or 10 mM MG was added, and cells were incubated at 28ºC with reciprocal shaking. We verified that cell growth was temporally arrested in the presence of 10 mM MG, while cell viability was maintained.

Analysis of phosphatidylinositols Cells were cultured in SD medium containing myo-[2-3H]inositol for 20 h. When A610 reached 0.8-1.0, 10 mM MG was added and cultivation was continued for another 60 min. Phosphatidylinositols were extracted from cells, and deacylated with methylamine as described by Hama et al. (64). Phosphatidylinositols (PtdIns3P, PtdIns4P, PtdIns(3,5)P2, and PtdIns(4,5)P2) were separated with HPLC, and radioactive counts were measured (64).

Spot assay Cells were cultured in SD medium until the early log phase of growth, and then diluted to A610 = 0.1 with the sterilized 0.85% NaCl solution. Cells were diluted serially (1:10) with sterilized 0.85% NaCl solution, and spotted (4 µl) onto

ACKNOWLEDGMENTS We are grateful to S. D. Emr, M. N. Hall, and the National BioResource Project (NBRP) of the MEXT, Japan, for providing the plasmids and yeast strains. We thank Y. Takatsume for mutant construction, and S. Izawa, K. Takegawa, and A. Hosomi for their technical support and helpful discussions. This work was partially supported by a Grant-in-Aid for Challenging Exploratory Research (W.N.) from the Japan Society for the Promotion of Science (JSPS) [grant number 26560397]. CONFLICT OF INTEREST The authors declare that they have no conflicts of interest with the contents of this article. AUTHOR CONTRIBUTIONS W.N., K.M., and Y.I. designed experiments and W.N. and K.M. performed experiments. W.N. and Y.I. analyzed data and wrote the manuscript.

7


Plasmids In order to create pRS306-ATG18-GFP, the C-terminal region of ATG18 was amplified with the following primers: ATG18-GFP-F-XbaI (5’-GGATCTAGAGGATCCAACAAGCAGTA ACGG-3’) and ATG18-GFP-R-XhoI (5’-TCCCTCGAGCATCCATCAAGATGGAAT ACT-3’). The PCR product was digested with XbaI and XhoI, and the resultant fragment was introduced into the XbaI and XhoI sites of pHXT1-GFP (18). pRS306-ATG18-GFP was digested with ClaI, and linearized DNA was introduced at the ATG18 locus. A plasmid carrying PKC1R398P R398P (YCp50-PKC1 ) was donated by Dr. M.N. Hall (62).

8


REFERENCES 1. Gladden, L. B. (2004) Lactate metabolism: a new paradigm for the third millennium. J. Physiol. 558, 5-30 2. Gancedo, C., and Flores, C. L. (2004) The importance of a functional trehalose biosynthetic pathway for the life of yeasts and fungi. FEMS Yeast Res. 4, 351-359 3. Pietrocola, F., Galluzzi, L., Bravo-San Pedro, J. M., Madeo, F., and Kroemer, G. (2015) Acetyl coenzyme A: a central metabolite and second messenger. Cell Metab. 21, 805-821 4. Inoue, Y., Maeta, K., and Nomura. W. (2011) Glyoxalase system in yeasts: structure, function, and physiology. Semin. Cell Dev. Biol. 22, 278-284 5. Rabbani, N., and Thornalley, P. J. (2015) Dicarbonyl stress in cell and tissue dysfunction contributing to ageing and disease. Biochem. Biophys. Res. Commun. 458, 221-226 6. Ranganathan, S., Walsh, E. S., Godwin, A. K., and Tew, K. D. (1993) Cloning and characterization of human colon glyoxalase-I. J. Biol. Chem. 268, 5661-5667 7. Thornalley, P. J., Hooper, N. I., Jennings, P. E., Florkowski, C. M., Jones, A. F., Lunec, J., and Barnett, A. H. (1989) The human red blood cell glyoxalase system in diabetes mellitus. Diabetes Res. Clin. Pract. 7, 115-120 8. Ramasamy, R., Yan, S. F., and Schmidt, A. M. (2006) Methylglyoxal comes of AGE. Cell 124, 258-260 9. Ahmed, N., Ahmed, U., Thornalley, P. J., Hager, K., Fleischer, G., and Münch, G. (2005) Protein glycation, oxidation and nitration adduct residues and free adducts of cerebrospinal fluid in Alzheimer's disease and link to cognitive impairment. J. Neurochem. 92, 255-263 10. Junaid, M. A., Kowal, D., Barua, M., Pullarkat, P. S., Sklower Brooks, S., and Pullarkat, R. K. (2004) Proteomic studies identified a single nucleotide polymorphism in glyoxalase I as autism susceptibility factor. Am. J. Med. Genet. A. 131, 11-17 11. Chen, F., Wollmer, M. A., Hoerndli, F., Münch, G., Kuhla, B., Rogaev, E. I., Tsolaki, M., Papassotiropoulos, A., and Götz, J. (2004) Role for glyoxalase I in Alzheimer's disease. Proc. Natl. Acad. Sci. U.S.A. 101, 7687-7692 12. Rabbani, N., and Thornalley, P. J. (2011) Glyoxalase in diabetes, obesity and related disorders. Semin. Cell Dev. Biol. 22, 309-317 13. Matafome, P., Sena, C., and Seiça, R. (2013) Methylglyoxal, obesity, and diabetes. Endocrine 43, 472-484 14. Angeloni, C., Zambonin, L., and Hrelia, S. (2014) Role of methylglyoxal in Alzheimer's disease. Biomed Res. Int. 2014, 238485 15. Maeta, K., Izawa, S., Okazaki, S., Kuge, S., and Inoue, Y. (2004) Activity of the Yap1 transcription factor in Saccharomyces cerevisiae is modulated by methylglyoxal, a metabolite derived from glycolysis. Mol. Cell. Biol. 24, 8753-8764 16. Takatsume, Y., Izawa, S., and Inoue, Y. (2006) Methylglyoxal as a signal initiator for activation of the stress-activated protein kinase cascade in the fission yeast Schizosaccharomyces pombe. J. Biol. Chem. 281, 9086-9092 17. Nomura, W., and Inoue, Y. (2015) Methylglyoxal activates the target of rapamycin complex 2-protein kinase C signaling pathway in Saccharomyces cerevisiae. Mol. Cell. Biol. 35, 1269-1280 18. Yoshida, A., Wei, D., Nomura, W., Izawa, S., and Inoue, Y. (2012) Reduction of glucose uptake through inhibition of hexose transporters and enhancement of their endocytosis by methylglyoxal in Saccharomyces cerevisiae. J. Biol. Chem. 287, 701-711 19. Jin, N., Lang, M. J., and Weisman, L. S. (2016) Phosphatidylinositol 3,5-bisphosphate: regulation of cellular events in space and time. Biochem. Soc. Trans. 44, 177-184 20. Strahl, T., and Thorner, J. (2007) Synthesis and function of membrane phosphoinositides in budding yeast, Saccharomyces cerevisiae. Biochim. Biophys. Acta 1771, 353-404 21. Yamamoto, A., DeWald, D. B., Boronenkov, I. V., Anderson, R. A., Emr, S. D., and Koshland, D. (1995) Novel PI(4)P 5-kinase homologue, Fab1p, essential for normal vacuole function and morphology in yeast. Mol. Biol. Cell 6, 525-539 22. Gary, J. D., Wurmser, A. E., Bonangelino, C. J., Weisman, L. S., and Emr, S. D. (1998) Fab1p is essential for PtdIns(3)P 5-kinase activity and the maintenance of vacuolar size and membrane

23.

24. 25.

26.

27.

28.

30.

31. 32. 33.

34.

35.

36. 37. 38. 39. 40. 41.

42.

9


29.

homeostasis. J. Cell Biol. 143, 65-79 Li, S. C., Diakov, T. T., Xu, T., Tarsio, M., Zhu, W., Couoh-Cardel, S., Weisman, L. S., and Kane. P. M. (2014) The signaling lipid PI(3,5)P₂ stabilizes V₁-V(o) sector interactions and activates the V-ATPase. Mol. Biol. Cell 25, 1251-1262 Bonangelino, C. J., Catlett, N. L., and Weisman, L. S. (1997) Vac7p, a novel vacuolar protein, is required for normal vacuole inheritance and morphology. Mol. Cell. Biol. 17, 6847-6858 Duex, J. E., Nau, J. J., Kauffman, E. J., and Weisman, L. S. (2006) Phosphoinositide 5-phosphatase Fig 4p is required for both acute rise and subsequent fall in stress-induced phosphatidylinositol 3,5-bisphosphate levels. Eukaryot. Cell 5, 723-731 Gary, J. D., Sato, T. K., Stefan, C. J., Bonangelino, C. J., Weisman, L. S., and Emr, S. D. (2002) Regulation of Fab1 phosphatidylinositol 3-phosphate 5-kinase pathway by Vac7 protein and Fig4, a polyphosphoinositide phosphatase family member. Mol. Biol. Cell 13, 1238-1251 Bonangelino, C. J., Nau, J. J., Duex, J. E., Brinkman, M., Wurmser, A. E., Gary, J. D., Emr, S. D., and Weisman, L. S. (2002) Osmotic stress-induced increase of phosphatidylinositol 3,5-bisphosphate requires Vac14p, an activator of the lipid kinase Fab1p. J. Cell Biol. 156, 1015-1028 Dove, S. K., McEwen, R. K., Mayes, A., Hughes, D. C., Beggs, J. D., and Michell, R. H. (2002) Vac14 controls PtdIns(3,5)P2 synthesis and Fab1-dependent protein trafficking to the multivesicular body. Curr. Biol. 12, 885-893 Jin, N., Chow, C. Y., Liu, L., Zolov, S. N., Bronson, R., Davisson, M., Petersen, J. L., Zhang, Y., Park, S., Duex, J. E., Goldowitz, D., Meisler, M. H., and Weisman, L. S. (2008) VAC14 nucleates a protein complex essential for the acute interconversion of PI3P and PI(3,5)P2 in yeast and mouse. EMBO J. 27, 3221-3234 Cooke, F. T., Dove, S. K., McEwen, R. K., Painter, G., Holmes, A. B., Hall, M. N., Michell, R. H., and Parker, P. J. (1998) The stress-activated phosphatidylinositol 3-phosphate 5-kinase Fab1p is essential for vacuole function in S. cerevisiae. Curr. Biol. 8, 1219-1222 Efe, J. A., Botelho, R. J., and Emr, S. D. (2005) The Fab1 phosphatidylinositol kinase pathway in the regulation of vacuole morphology. Curr. Opin. Cell Biol. 17, 402-408 McCartney, A. J., Zhang, Y., and Weisman, L. S. (2014) Phosphatidylinositol 3,5-bisphosphate: low abundance, high significance. Bioessays 36, 52-64 Li, X., Wang, X., Zhang, X., Zhao, M., Tsang, W. L., Zhang, Y., Yau, R. G., Weisman, L. S., and Xu, H. (2013) Genetically encoded fluorescent probe to visualize intracellular phosphatidylinositol 3,5-bisphosphate localization and dynamics. Proc. Natl. Acad. Sci. U. S. A. 110, 21165-21170 Dove, S. K., Dong, K., Kobayashi, T., Williams, F. K., and Michell, R. H. (2009) Phosphatidylinositol 3,5-bisphosphate and Fab1p/PIKfyve underPPIn endo-lysosome function. Biochem. J. 419, 1-13 Herman, P. K., and Emr, S. D. (1990) Characterization of VPS34, a gene required for vacuolar protein sorting and vacuole segregation in Saccharomyces cerevisiae. Mol. Cell. Biol. 10, 6742-6754 Seeley, E. S., Kato, M., Margolis, N., Wickner, W., and Eitzen, G. (2002) Genomic analysis of homotypic vacuole fusion. Mol. Biol. Cell 13, 782-794 Li, S. C., and Kane, P. M. (2009) The yeast lysosome-like vacuole: endpoint and crossroads. Biochim. Biophys. Acta 1793, 650-663 Balderhaar, H. J., and Ungermann, C. (2013) CORVET and HOPS tethering complexes coordinators of endosome and lysosome fusion. J. Cell Sci. 126, 1307-1316 Bowers, K., and Stevens, T. H. (2005) Protein transport from the late Golgi to the vacuole in the yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta 1744, 438-454 Dove, S. K., Cooke, F. T., Douglas, M. R., Sayers, L. G., Parker, P. J., and Michell, R. H. (1997) Osmotic stress activates phosphatidylinositol-3,5-bisphosphate synthesis. Nature 390, 187-192 Dove, S. K., Piper, R. C., McEwen, R. K., Yu, J. W., King, M. C., Hughes, D. C., Thuring, J., Holmes, A. B., Cooke, F. T., Michell, R. H., Parker, P. J., and Lemmon, M. A. (2004) Svp1p defines a family of phosphatidylinositol 3,5-bisphosphate effectors. EMBO J. 23, 1922-1933 Efe, J. A., Botelho, R. J., and Emr, S. D. (2007) Atg18 regulates organelle morphology and Fab1 kinase activity independent of its membrane recruitment by phosphatidylinositol 3,5-bisphosphate.

43. 44. 45.

46. 47. 48. 49.

51. 52.

53.

54. 55.

56. 57. 58.

59.

60.

61.

62. 63. 64.

10


50.

Mol. Biol. Cell 18, 4232-4244 Krick, R., Henke, S., Tolstrup, J., and Thumm, M. (2008) Dissecting the localization and function of Atg18, Atg21 and Ygr223c. Autophagy 4, 896-910 Desfougères, Y., Vavassori, S., Rompf, M., Gerasimaite, R., and Mayer, A. (2016) Organelle acidification negatively regulates vacuole membrane fusion in vivo. Sci. Rep. 6, 29045 Weisman, L. S., Bacallao, R., and Wickner, W. (1987) Multiple methods of visualizing the yeast vacuole permit evaluation of its morphology and inheritance during the cell cycle. J. Cell Biol. 105, 1539-1547 Nomura, W., Ito, Y., and Inoue, Y. (2017) Role of phosphatidylserine in the activation of Rho1-related Pkc1 signaling in Saccharomyces cerevisiae. Cell. Signal. 31, 146-153 Levin, D. E. (2005) Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 69, 262-291 Duex, J. E., Tang, F., and Weisman, L. S. (2006) The Vac14p-Fig4p complex acts independently of Vac7p and couples PI3,5P2 synthesis and turnover. J. Cell Biol. 172, 693-704 Shapiro, R., Cohen, B. I., Shiuey, S. J., and Maurer, H. (1969) On the reaction of guanine with glyoxal, pyruvaldehyde, and kethoxal, and the structure of the acylguanines. A new synthesis of N2-alkylguanines. Biochemistry 8, 238-245 Payne, G. S., and Schekman, R. (1985) A test of clathrin function in protein secretion and cell growth. Science 230, 1009-1014 Silveira, L. A., Wong, D. H., Masiarz, F. R., and Schekman, R. (1990) Yeast clathrin has a distinctive light chain that is important for cell growth. J Cell Biol. 111, 1437-1449 Gerrard, S. R., Levi, B. P., and Stevens, T. H. (2000) Pep12p is a multifunctional yeast syntaxin that controls entry of biosynthetic, endocytic and retrograde traffic into the prevacuolar compartment. Traffic 1, 259-269 Peplowska, K., Markgraf, D. F., Ostrowicz, C. W., Bange, G., and Ungermann, C. (2007) The CORVET tethering complex interacts with the yeast Rab5 homolog Vps21 and is involved in endo-lysosomal biogenesis. Dev. Cell 12, 739-750 Gaubitz, C., Prouteau, M., Kusmider, B., and Loewith, R. (2016) TORC2 Structure and Function. Trends Biochem. Sci. 41, 532-545 Meaden, P. G., Arneborg, N., Guldfeldt, L. U., Siegumfeldt, H., and Jakobsen, M. (1999) Endocytosis and vacuolar morphology in Saccharomyces cerevisiae are altered in response to ethanol stress or heat shock. Yeast 15, 1211-1222 Dove, S. K., and Johnson, Z. E. (2007) Our FABulous VACation: a decade of phosphatidylinositol 3,5-bisphosphate. Biochem. Soc. Symp. 74, 129-139 Yoshida, S., Bartolini, S., and Pellman, D. (2009) Mechanisms for concentrating Rho1 during cytokinesis. Genes Dev. 23, 810-823 Hatakeyama, R., Kono, K., Yoshida, S. (2017) Ypk1 and Ypk2 kinases maintain Rho1 at the plasma membrane by flippase-dependent lipid remodeling after membrane stresses. J. Cell Sci. 130, 1169-1178 Longtine, M. S., McKenzie, A. 3rd., Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953-961 Sakumoto, N., Mukai, Y., Uchida, K., Kouchi, T., Kuwajima, J., Nakagawa, Y., Sugioka, S., Yamamoto, E., Furuyama, T., Mizubuchi, H., Ohsugi, N., Sakuno, T., Kikuchi, K., Matsuoka, I., Ogawa, N., Kaneko, Y., and Harashima, S. (1999) A series of protein phosphatase gene disruptants in Saccharomyces cerevisiae. Yeast 15, 1669-1679 Rudge, S. A., Anderson, D. M., and Emr, S. D. (2004) Vacuole size control: regulation of PtdIns(3,5)P2 levels by the vacuole-associated Vac14-Fig4 complex, a PtdIns(3,5)P2-specific phosphatase. Mol. Biol. Cell 15, 24-36 Helliwell, S. B., Schmidt, A., Ohya, Y., and Hall, M. N. (1998) The Rho1 effector Pkc1, but not Bni1, mediates signalling from Tor2 to the actin cytoskeleton. Curr. Biol. 8, 1211-1214 Vida, T. A., and Emr, S. D. (1995) A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128, 779-792 Hama, H., Takemoto, J. Y., and DeWald, D. B. (2000) Analysis of phosphoinositides in protein

trafficking. Methods 20, 465-473

FOOTNOTES Abbreviations: MG, methylglyoxal; MAPK, mitogen-activated protein kinase; PtdIns, phosphatidylinositol; V-ATPase, vacuolar H+ ATPase; Hxt, hexose transporter; TORC2, target of rapamycin complex 2.


11

Table 1. List of relevant genes involved in susceptibility to MG Relevant genes

Cell organization

SAC6, WHI2, BUD25

Gene expression

NGG1, HFI1, SWI3, TAF14, ERT1

Protein quality control

SSZ1, HEL2, VMS1, ATG17

Sugar or amino acid metabolism

GLO1, GLO2, GLY1, SHP1

Lipid metabolism

VPS34, VPS15, CSG2, ISC1, KCS1, ERG2, ERG3

DNA repair

RAD50, RAD51, RAD1

Membrane traffic

PEP3, PEP12, CHC1, CLC1

Unknown

YEL045c


Functional categories

12

Table 2. Levels of phosphatidylinositols Phosphatidylinositols

w/o MG

w/ MG

PtdIns3P

1.00 ± 0.11

0.97 ± 0.06

PtdIns4P

1.64 ± 0.07

1.51 ± 0.07

PtdIns(3,5)P2

0.020 ± 0.004

0.065 ± 0.001

PtdIns(4,5)P2

0.68 ± 0.04

0.57 ± 0.02

Wild type cells were treated with 10 mM MG for 60 min. The level of each phosphatidylinositol is shown as a percentage of total phosphatidylinositol levels (average ± standard deviation, n≥3).


13

FIGURE LEGENDS FIGURE 1. Involvement of the PtdIns(3,5)P2 biosynthesis pathway in tolerance to MG. A, Outline of the phosphoinositide synthesis pathway in S. cerevisiae. B, Wild type (BY4741), glo1∆, vps15∆, vps34∆, and fab1∆ cells, which are BY4741 background strains, were cultured in YPD medium until A610 = 0.3, 4 µl of each cell suspension was spotted onto YPD agar plates with (20 mM) or without MG, and cells were then incubated at 28ºC for 3 days. C, Wild type (BY4741) and fab1∆ (BY4741 background) cells were cultured in SD medium until A610 = 0.3, and cell suspensions were spotted onto SD agar plates with (8 mM) or without MG, as described in B. D, Wild type (YPH250), fab1∆, and vac7∆vac14∆ cells were cultured in SD medium until A610 = 0.3, and cell suspensions were spotted onto SD agar plates with or without MG, as described in B.

FIGURE 3. Effects of MG on PtdIns(3,5)P2 levels. A, Wild type (YPH250) cells were cultured in SD medium until A610 = 0.3-0.5, and treated with 10 mM MG. The time course of the number of vacuoles per cell (open circles), vacuole size (closed circles) (left panel), and PtdIns(3,5)P2 levels (right panel) were assessed. B, Wild type (YPH250) and vac14∆ cells carrying ATG18-GFP were cultured in SD medium until A610 = 0.3-0.5, and treated with 10 mM MG. After 90 min, Atg18-GFP and the vacuole (FM4-64) were observed using a fluorescence microscope. FIGURE 4. Vacuolar acidification is not affected by a treatment with MG. Wild type (YPH250), fab1∆, and vac7∆vac14∆ cells were cultured in SD medium until A610 = 0.4, and then treated with 10 mM MG for 60 min. Cells were labeled with 200 µM quinacrine to assess vacuolar acidification. Quinacrine fluorescence images were superimposed on low-light bright field images to reveal cell outlines. FIGURE 5. Involvement of PtdIns(3,5)P2 in the MG-induced activation of the Mpk1 MAPK cascade. A, Wild type (YPH250) and fab1∆ cells carrying either an empty plasmid (vector, YCp50) or YCp50-PKC1R398P were cultured in SD medium until A610 = 0.3, 4 µl of each cell suspension was spotted onto SD agar plates with (4 mM) or without MG, and cells were then incubated at 28ºC for 3 days. B, Wild type (YPH250), vps34∆, fab1∆, and vac7∆vac14∆ cells were cultured in SD medium until A610 = 0.3, and 10 mM MG was added. The levels of phosphorylation of Mpk1 (p-Mpk1) and the Mpk1 protein (Mpk1) were assessed after incubations for the prescribed times. The intensity of immunoreactive bands was quantified by image analysis. The ratio of p-Mpk1/Mpk1 at 0 min in each strain was relatively taken as 1. Data are for three independent experiments (average plus standard deviation, n≥3). C, Wild type (YPH250), vps34∆, fab1∆, and vac7∆vac14∆ cells were cultured in SD medium at 28ºC until A610 = 0.3, and were then shifted to 38ºC. The levels of phosphorylation of Mpk1 (p-Mpk1) and the Mpk1 protein (Mpk1) were assessed after incubations for the prescribed times. The intensity of immunoreactive bands was quantified as described in B. FIGURE 6. An increase in PtdIns(3,5)P2 is not necessary for the MG-induced activation of the Mpk1 MAPK cascade. A, Wild type (YPH250) and fig4∆ cells were labeled with myo-[2-3H]inositol, and treated with MG for 60 min. The extraction of phosphatidylinositols and measurement of PtdIns(3,5)P2 levels were described in the EXPERIMENTAL PROCEDURES. PtdIns(3,5)P2 levels are

14


FIGURE 2. Effects of MG on vacuolar morphology. A, Cells (YPH250) were cultured in SD medium until A610 = 0.3-0.5, and treated with 10 mM MG for the period indicated. The vacuolar membrane was stained with FM4-64. The number of vacuoles per cell and vacuole size were measured for more than 50 cells, and mean values ± standard deviation were shown below each picture. Bar, 5 µm. B, Wild type (YPH250) cells were cultured in SD medium until A610 = 0.3-0.5, and treated with 10 mM MG for 60 min. Cells were washed with 0.85% NaCl solution, suspended in fresh SD medium with or without 10 mM MG for 30-60 min, and the vacuolar membrane was then stained with FM4-64. The number of vacuoles per cell and vacuole size were measured for more than 50 cells, and mean values (± standard deviation) were shown below each picture. Bar, 5 µm. C, Wild type (YPH250), vps41∆, and vam3∆ cells were cultured in SD medium until A610 = 0.3-0.5, and treated with 10 mM MG for 90 min. The vacuolar membrane was stained with FM4-64.

shown as a percentage of total phosphatidylinositol levels. Data are for three independent experiments (average ± standard deviation, n≥3). B, Wild type (YPH250) and fig4∆ cells carrying ATG18-GFP were cultured in SD medium until A610 = 0.3-0.5, and treated with 10 mM MG. After 90 min, Atg18-GFP and the vacuole (FM4-64) were observed using a fluorescence microscope. C, Wild type (YPH250) and fig4∆ cells were cultured in SD medium until A610 = 0.3, and 10 mM MG was added. The levels of phosphorylation of Mpk1 (p-Mpk1) and the Mpk1 protein (Mpk1) were assessed after incubations for the prescribed times. Quantification of the ratio of p-Mpk1/Mpk1 was described in FIGURE 5B, and data are for three independent experiments (average plus standard deviation, n≥3). D, Wild type (YPH250) and fig4∆ cells were cultured in SD medium until A610 = 0.3, 4 µl of each cell suspension was spotted onto SD agar plates with (4 mM) or without MG, and cells were then incubated at 28ºC for 3 days.


15

FIGURE 1

A!

Vac7 Vac14

Fab1 Vps34/Vps15

PtdIns3P

PtdIns(3,5)P2

PtdIns Pik1, Stt4, or Lsb6

Mss4

C!

YPD plate w/o MG

PtdIns(4,5)P2

SD plate

w/ MG

w/o MG

w/ MG

WT (BY4741)!

WT (BY4741)!

fab1∆

glo1∆ vps15∆ vps34∆ fab1∆

D! MG (mM)! 0! Wild-type! fab1∆ vac7∆vac14∆

2!

4!

6!


B!

PtdIns4P

FIGURE 2

30!

A!

60!

90! (min)!

0! – MG!

FM4-64!

1.80 ± 0.82! 1.92 ± 0.85! 1.96 ± 0.88! 1.73 ± 0.87! 1.59 ± 0.69! 1.76 ± 0.82!

BF! + MG!

Mean number of vacuoles per cell!

1.96 ± 0.99!

Mean vacuole size (µm)!

1.67 ± 0.76!

30!

B!

0!

– MG!

60! MG!

FM4-64!

60! (min)!

1.42 ! (± 0.62)!

2.00 ! (± 0.77)!

2.34 ! (± 0.88)!

1.85 ! (± 0.81)!

1.13 ! (± 0.35)!

1.04 ! (± 0.19)!

3.08 ! (± 0.55)!

3.35 ! (± 0.44)!

BF! Mean number of 1.97 ! vacuoles per cell! (± 0.97)! Mean vacuole size (µm)!

C!

1.65 ! (± 0.73)!

Wild-type! MG!

FM4-64!

BF!

1.03 ! + MG ! (± 0.17)! 3.10 ! (± 0.57)!

vps41∆!

vam3∆!


1.43 ± 0.77! 1.22 ± 0.59! 1.05 ± 0.22! 2.06 ± 0.79! 2.37 ± 0.79! 2.74 ± 0.66!

2.5! 2.0!

1.5! 1.0! 0.5!

0!

Percentage of total PtdIns!

3.0!

2.0! 1.5! 1.0! 0.5!

0!

15! 30! 45!

Time (min)!

Wild-type!

B! MG!

Atg18GFP! FM4-64!

BF!

60! 75! 90!

vac14∆!

PtdIns(3,5)P2!

0.06!

+ MG! 0.04! 0.02!

0! 0!

– MG!

15! 30! 45! Time (min)!

60!


Mean vacuole size (µm) !

A!

Mean number of vacuoles per cell!

FIGURE 3

FIGURE 4

Wild-type!


vac7∆vac14∆! fab1∆! MG!

FIGURE 5

A MG (mM)! 0!

4! Wild-type!

vector! vector!

fab1∆

PKC1R398P

B

C Heat shock!

MG!

0!

15!

30! 45! 60!

59

min

kDa

15!

30! 45! 60!

min

59

Mpk1!

59

p-Mpk1!

vps34∆! 59

Mpk1!

59

p-Mpk1!

Mpk1! p-Mpk1!

59

vps34∆! 59

Mpk1!

59

p-Mpk1!

fab1∆!

fab1∆!

59

Mpk1!

59

p-Mpk1!

vac7∆ vac14∆! 59

WT vps34∆ fab1∆ vac7∆vac14∆

5! 4! 3! 2! 1!

Mpk1!

59

p-Mpk1!

vac7∆ vac14∆!

Mpk1!

59

Mpk1!

6!

59

WT vps34∆

6!

fab1∆ vac7∆vac14∆

5! 4! 3! 2! 1! 0!

0! 0!

15!

30!

45!

Time (min)!

60!

0!

15!

30!

45!

Time (min)!

60!


p-Mpk1!

WT!

59

p-Mpk1/ Mpk1 ratio !

0!

59

p-Mpk1!

WT!


kDa

FIGURE 6

B! Wild-type!

PtdIns(3,5)P2!

MG!

0.06!

Atg18GFP!

0.04! FM4-64!

0.02! BF!

0! MG! Wild-type!

C!

fig4∆!

D!

MG! kDa

0!

15!

MG (mM)!

30! 45! 60!

59

min p-Mpk1!

WT!

59

Mpk1!

59

p-Mpk1!

fig4∆! 59


fig4∆!

Mpk1!

5! 4! 3! 2!

WT fig4∆

1! 0! 0!

15!

30!

45!

Time (min)!

60!

0! Wild-type! fig4∆

4!


Percentage of total PtdIns!

A!

Phosphatidylinositol 3,5-bisphosphate is involved in methylglyoxal-induced activation of the Mpk1 mitogen-activated protein kinase cascade in Saccharomyces cerevisiae Wataru Nomura, Kazuhiro Maeta and Yoshiharu Inoue J. Biol. Chem. published online July 25, 2017

Access the most updated version of this article at doi: 10.1074/jbc.M117.791590 Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts

http://www.jbc.org/content/suppl/2017/07/25/M117.791590.DC1 This article cites 0 references, 0 of which can be accessed free at http://www.jbc.org/content/early/2017/07/25/jbc.M117.791590.full.html#ref-list-1


Supplemental material: