Photosynthetic carbon metabolism in leaves of transgenic tobacco ...

Planta (2000) 211: 864±873

Photosynthetic carbon metabolism in leaves of transgenic tobacco (Nicotiana tabacum L.) containing decreased amounts of fructose 2,6-bisphosphate P. Scott1*, A. J. Lange2, N. J. Kruger 1 2

Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, UK Department of Biochemistry, University of Minnesota, Minneapolis, Minnesota 55455, USA

Received: 8 February 2000 / Accepted: 25 April 2000

Abstract. The aim of this work was to examine the role of fructose 2,6-bisphosphate (Fru-2,6-P2) in photosynthetic carbon partitioning. The amount of Fru-2,6-P2 in leaves of tobacco (Nicotiana tabacum L. cv. Samsun) was reduced by introduction of a modi®ed mammalian gene encoding a functional fructose-2,6-bisphosphatase (EC 3.1.3.46). Expression of this gene in transgenic plants reduced the Fru-2,6-P2 content of darkened leaves to between 54% and 80% of that in untransformed plants. During the ®rst 30 min of photosynthesis sucrose accumulated more rapidly in the transgenic lines than in the untransformed plants, whereas starch production was slower in the transgenic plants. On illumination, the proportion of 14CO2 converted to sucrose was greater in leaf disks of transgenic lines possessing reduced amounts of Fru-2,6-P2 than in those of the control plants, and there was a corresponding decrease in the proportion of carbon assimilated to starch in the transgenic lines. Furthermore, plants with smaller amounts of Fru-2,6-P2 had lower rates of net CO2 assimilation. In illuminated leaves, decreasing the amount of Fru-2,6-P2 resulted in greater amounts of hexose phosphates, but smaller amounts of 3-phosphoglycerate and dihydroxyacetone phosphate. These dierences are interpreted in terms of decreased inhibition of cytosolic fructose-1,6-bisphosphatase resulting from the lowered Fru-2,6-P2 content.

*Present address: School of Biological Sciences, University of Sussex, Falmer, Sussex, BN1 9GQ, UK Abbreviations: DHAP dihydroxyacetone phosphate; FBPase fructose-1,6-bisphosphatase (EC 3.1.3.11); Fru-2,6-P2 fructose 2,6-bisphosphate; Fru-2,6-P2ase fructose-2,6-bisphosphatase (EC 3.1.3.46); Fru-6-P fructose 6-phosphate; Glc-6-P glucose 6-phosphate; NADP-GAPDH NADP+-dependent glyceraldyhyde-3-phosphate dehydrogenase (EC 1.2.1.13); PAR photosynthetically active radiation; PFK 6-phosphofructo-1-kinase (EC 2.7.1.11); 6-PF-2-K 6-phosphofructo-2-kinase (EC 2.7.1.105); PFP pyrophosphate:fructose 6-phosphate-1-phosphotransferase (EC 2.7.1.90); 3PGA 3-phosphoglycerate; PK pyruvate kinase (EC 2.7.1.40) Correspondence to: N. J. Kruger; E-mail: [email protected]; Fax: +44-1865-275074

The data provide direct evidence for the importance of Fru-2,6-P2 in co-ordinating chloroplastic and cytosolic carbohydrate metabolism in leaves in the light. Key words: Carbon partitioning ± Fructose 2,6bisphosphate ± Fructose-2,6-bisphosphatase ± Nicotiana (transgenic) ± Photosynthesis ± Sucrose synthesis

Introduction Fructose 2,6-bisphosphate (Fru-2,6-P2) is believed to be an important regulator of carbohydrate metabolism in plants (Stitt 1990). This signal metabolite is a strong inhibitor of cytosolic fructose-1,6-bisphosphatase (FBPase), a potent activator of pyrophosphate:fructose 6-phosphate phosphotransferase (PFP), and contributes to the regulation of interconversion of hexose phosphates and triose phosphates in the cytosol. Control of this interconversion by Fru-2,6-P2 may in¯uence several aspects of carbohydrate metabolism (Kruger and Scott 1994). During photosynthesis, Fru-2,6-P2 is suggested to play an important role in co-ordination of the rates of CO2 assimilation and sucrose synthesis, and in the partitioning of carbon between sucrose and starch (Stitt 1997). Central to this view is the demonstration that the kinetic properties of the enzyme activities responsible for Fru-2,6-P2 metabolism allow the concentration of this metabolite to respond sensitively to changes in the amounts of hexose phosphates and triose phosphates. Such changes in the concentration of Fru-2,6-P2 enable ¯ux through FBPase (and hence the rate of sucrose production) to be regulated in response to the availability of substrate and demand for product in the cytosol, principally for sucrose synthesis via sucrose phosphate synthase. To test this proposal we have previously used transgenic plants containing a modi®ed rat liver cDNA

P. Scott et al.: Eect of decreased Fru-2,6-P2 on photosynthesis

865

encoding 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (6-PF-2-K/Fru-2,6-P2ase) to increase the amount of Fru-2,6-P2 in tobacco leaves (Scott et al. 1995). This gene construct contained two point mutations that changed both serine-32 and histidine-258 to alanine. These mutations removed a phosphorylation site for cyclic AMP-dependent protein kinase and an active-site histidine residue from the Fru-2,6-P2ase domain (Tauler et al. 1990; Kurland et al. 1992), and generated a polypeptide that possessed only 6-PF-2-K activity. Introduction of this gene into tobacco plants produced transgenic lines that contained up to double the normal amounts of Fru-2,6-P2 (Scott et al. 1995). In these plants, elevated Fru-2,6-P2 content reduced the rate of sucrose synthesis at the start of the light period and increased the rate of starch synthesis. These data provided direct evidence for a role of Fru-2,6-P2 in regulating assimilate partitioning in leaves during photosynthesis. In addition, using the conceptual framework of metabolic control analysis (Fell 1997), we calculated the ¯ux response coecients for changes in sucrose and starch synthesis with respect to increases in Fru-2,6-P2 to be )0.43 0.03 and 0.33 0.01, respectively (Kruger and Scott 1995). These coecients indicate that Fru-2,6-P2 is quantitatively important in regulating the ¯ow of assimilate into sucrose and starch at the beginning of the light period. To complement these previous studies (Kruger and Scott 1995; Scott et al. 1995), we have transformed tobacco with a modi®ed rat liver 6-PF-2-K/Fru-2,6P2ase cDNA encoding a polypeptide with the capacity to hydrolyse Fru-2,6-P2. This has produced tobacco plants with 54±80% of the normal amounts of Fru-2,6P2. Here we report the eects of decreased Fru-2,6-P2 content on carbohydrate metabolism during photosynthesis.

The ampli®ed product was digested with Hind III and cloned into the plasmid pKK233-2 (Amersham Pharmacia Biotech, Little Chalfont, Bucks., UK) to allow expression of the gene in Escherichia coli. Activity of Fru-2,6-P2ase in JM105 cells containing pKK233-2, with and without the 6-PF-2-K/Fru-2,6-P2ase coding sequence, was measured after induction of cell cultures for 2.5 h with 0.25 mM isopropyl-b-D-thiogalactopyranoside. Induction and lysis of the cells was performed as described by Tauler et al. (1989). A Hind III fragment containing 6-PF-2-K/Fru-2,6-P2ase was excised from the pKK233-2-based vector and inserted between a 35S cauli¯ower mosaic virus (CaMV) promoter and polyadenylation signal in the plasmid pJIT62K. The latter vector was produced by insertion of a Kpn I site into the EcoR V restriction site of pJIT62. This gave a vector in which the 35S CaMV promoter, polyadenylation signal and 6-PF-2-K/Fru-2,6-P2ase gene could be excised by Kpn I and directly cloned into pBIN19 (Bevan 1984). The pBIN19:6-PF-2-K/Fru-2,6-P2ase construct was then introduced into Agrobacterium tumefaciens strain LBA4404, containing pAL4404, by direct transformation (HoÈfgen and Wilmitzer 1988).

Materials and methods

Plant transformation

Plant material and growth conditions

Tobacco was transformed by Agrobacterium-mediated leaf-based transformation as described by Rosahl et al. (1987).

Tobacco (Nicotiana tabacum L. cv. Samsun) was obtained from the Department of Plant Sciences, Cambridge. Axenic plant lines were maintained in Magenta vessels (Sigma Chemicals, Poole, Dorset, UK) under a 12 h light/12 h dark regime [200 lmol photosynthetically active radiation (PAR) m)2 s)1] at 25 °C on Murashige and Skoog medium (Murashige and Skoog 1962) containing 2% sucrose and 0.8% agar. Seeds obtained from primary transformants were germinated in the presence of 200 lg ml)1 kanamycin for 1 week. The seedlings were then transferred to soil and grown in a greenhouse for 6 weeks with no supplementary lighting. Subsequently, plants were transferred to a 8 h light/16 h dark regime (200 lmol PAR m)2 s)1) at 25 °C for at least 2 weeks before metabolic measurements were made. Plants used for experiments were 9±12 weeks old. From the age of 4 weeks, plants were fed weekly with 10 ml of a preparation of 3 g l)1 of Miracle-Grow (ICI Chemicals, Haslemere, Surrey, UK). Chemicals All chemicals, biochemicals and other reagents were of the highest quality available from Sigma-Aldrich, Merck (both of Poole, Dorset, UK), or Roche Diagnostics (Lewes, East Sussex, UK).

Coupling enzymes were obtained from Roche Diagnostics and were desalted prior to use. Plasmid constructs Functional Fru-2,6-P2ase was provided by a modi®ed coding region of the rat liver 6-PF-2-K/Fru-2,6-P2ase. The sequence contained a point mutation that changed arginine-195 to alanine (Li et al. 1992). Arginine-195 is involved in the binding of fructose 6-phosphate (Fru-6-P) by 6-PF-2-K and this mutation produces a protein in which Fru-2,6-P2ase activity is unaected, whereas the anity for Fru-6-P is reduced such that 6-PF-2-K activity is markedly lower. The modi®ed 6-PF-2-K/Fru-2,6-P2ase sequence was ampli®ed from a pEMBL construct by polymerase chain reaction using primers based on the published 6-PF-2-K/Fru-2,6P2ase sequence (Darville et al. 1987). The sequences of the primers used for ampli®cation were: 5¢-6-PF-2-K, 5¢GGAAGCTTATGTCTCGAGAGATGGGAGAA CTCACTCAA3¢ 3¢-6-PF-2-K, 5¢GGAAGCTTTCAGTAATGGGCAGGTACAGTGTCCAAGGC3¢

Analysis of gene expression RNA was extracted from tobacco leaves using the method described by Lichtenstein and Draper (1985). Northern hybridisation was carried out as described by Sambrook et al. (1989). Extraction of enzymes and measurement of activity For measurement of 6-PF-2-K and Fru-2,6-P2ase activities tobacco leaves were extracted as described by Kerr and Huber (1987). To test the reliability of extraction from the leaves, recombination experiments were performed. Spinach leaf extracts, containing approximately the same activity of Fru-2,6-P2ase as was expected to be present in the tobacco leaves, were added to tobacco leaves prior to homogenisation. The percentage of the spinach Fru-2,6P2ase recovered at the end of extraction was estimated from the dierence in activity of two replicate tobacco leaf samples extracted in the presence and absence of spinach Fru-2,6-P2ase. In three separate recombination experiments, 146 38% (mean SE) of added spinach Fru-2,6-P2ase activity was recovered.


866 The activity of 6-PF-2-K was measured as described by Kerr and Huber (1987). These assay conditions were optimal for both the mammalian and the tobacco-enzyme. The activity of Fru-2,6P2ase in the mammalian bifunctional enzyme and the tobacco enzyme was measured as described by Stitt et al. (1986). Extracts for measuring the activities of other enzymes were prepared as described by Hajirezaei and Stitt (1991). The extract was centrifuged at 10,000 g for 5 min and the enzyme activities were determined in the resulting supernatant. Pyruvate kinase (PK) and 6-phosphofructo-1-kinase (PFK) were assayed as described by Hatzfeld et al. (1990). Cytosolic and stromal FBPase were measured using the dierential assays described by Stitt et al. (1982). The activity of PFP was assayed in the direction of Fru-6-P consumption as described in Kruger et al. (1983). The activity of NADP+-dependent glyceraldehyde-3-phosphate dehydrogenase (NADP-GAPDH) was determined in the direction of glyceraldyhyde 3-phosphate formation as described by Leegood (1990). Immunodetection of Rubisco Leaf extracts were fractionated by SDS-PAGE (Laemmli 1970) and electroblotted onto nitrocellulose membrane as described by Kruger (1996). The resulting blot was probed with antibodies raised in rat against tobacco Rubisco large subunit (1:1000 dilution) and subsequently detected using rabbit anti-rat IgGalkaline phosphatase conjugate (Kruger 1996). Measurement of metabolites Extraction and measurement of Fru-2,6-P2 from tobacco leaves was as described by Scott and Kruger (1994). Sucrose and starch were measured as described by Morrell and ap Rees (1986). Other metabolic intermediates were extracted and measured as described previously (Scott and Kruger 1995). Photosynthetic

14

CO2 metabolism

The 14C-labelling of sucrose, starch and other cell components of tobacco leaves was performed by illuminating leaf discs (10 mm diameter) in a leaf-disc oxygen electrode (Hansatech, Kings Lynn, Norfolk, UK) at 100 lmol PAR m)2 s)1 at 20 °C for 20 min. The carbon dioxide was supplied from 200 ll of 1 M NaH14CO3 (speci®c activity 3.7 GBq mol)1), pH 9.0, placed on a felt mat at the base of the inner chamber of the electrode. The distribution of radioactivity between metabolites in the leaf discs was analysed as detailed in Quick et al. (1989). The amounts of Fru-2,6-P2 were measured in the same samples using the technique described by Scott and Kruger (1994). Chlorophyll determination Chlorophyll was measured in leaf extracts as described by Arnon (1949). Statistical analysis Students t-tests were performed using MS Excel 97 (Microsoft Corporation, Seattle, USA). The term signi®cant is used to indicate dierences for which P < 0.05.

Results The coding region of a modi®ed rat liver 6-PF-2-K/Fru2,6-P2ase cDNA in which arginine-195 had been

Fig. 1. Expression of modi®ed rat liver 6-PF-2-K/Fru-2,6-P2ase in E. coli. The mutant 6-PF-2-K/Fru-2,6-P2ase coding region containing a point mutation (as shown) was inserted into the plasmid pKK233-2 and expressed in E. coli (JM105). The activities of Fru-2,6-P2ase and 6-PF-2-K, and the amount of Fru-2,6-P2 were measured in cells containing pKK233-2, with or without the 6-PF-2-K/Fru-2,6-P2ase sequence, after induction with isopropyl-b-D-thiogalactopyranoside. Values are the mean SE of measurements from three separate cultures. n.d., not detectable

mutated to alanine was used to generate a protein possessing a functional Fru-2,6-P2ase but decreased 6PF-2-K activity. To con®rm that the protein encoded by the mutated mammalian 6-PF-2-K/Fru-2,6-P2ase gene obtained by polymerase chain reaction ampli®cation possessed the appropriate enzyme activity, the coding region was ligated into the bacterial expression vector pKK233-2 and transformed into E. coli (JM105). The resulting transformed cells contained substantial Fru2,6-P2ase activity following induction with isopropyl-bD-thiogalactopyranoside (Fig. 1). No Fru-2,6-P2ase activity was detected in extracts of induced E. coli containing unmodi®ed pKK233-2. In addition, we detected a substantial activity of 6-PF-2-K in the extracts of E. coli containing the modi®ed 6-PF-2-K/ Fru-2,6-P2ase. However, this 6-PF-2-K activity was lower than that observed when a 6-PF-2-K/Fru-2,6P2ase cDNA containing a fully functional 6-PF-2-K domain is expressed in E. coli (Scott et al. 1995). Expression of the coding region of 6-PF-2-K/Fru-2,6P2ase in E. coli resulted in accumulation of Fru-2,6-P2 in the cells (Fig. 1), but again the amount of Fru-2,6-P2 was only 5% of that obtained in bacterial cells expressing a 6-PF-2-K/Fru-2,6-P2ase cDNA containing a fully functional 6-PF-2-K domain (Scott et al. 1995). Expression of the modi®ed 6-PF-2-K/Fru-2,6-P2ase gene in transgenic plants Once it had been established that the modi®ed 6-PF2-K/Fru-2,6-P2ase sequence encoded a functional Fru2,6-P2ase activity, tobacco leaves were transformed with

0.087

0.037 0.015

0.032

0.22 ± 0.27 0.22 ± 0.27 6.82 5.74 6.21 6.80 4.22 7.10 56.26 46.27 51.23 61.95 52.76 55.19 0.23 0.13 0.18 0.20 0.17 0.30 1.99 2.04 2.19 1.78 2.03 2.11 0.12 0.10 0.20 0.16 0.19 0.12

1.2 2.5 2.7 1.1 0.3 0.3 35.7 27.6 25.0 24.0 20.7 19.3 Samsun A.1.8 B.2.3 B.3.3 B.3.4 A.2.8

0.76 0.67 0.86 0.63 0.66 0.73

0.09 0.09 0.06 0.07 0.10 0.13

(5) (10) (8) (4) (3) (3)

0.167 0.148 0.182 0.178 0.170 0.194

0.018 0.017 0.013 0.021 0.018 0.012

0.090 0.070 0.082 0.078 0.090 0.079

0.027 0.010 0.012 0.005 0.013 0.019

1.12 1.08 0.87 0.76 0.83 0.81

PK NADP-GAPDH Stromal FBPase Cytosolic FBPase PFK PFP

Enzyme activity (lmol (g FW))1 min)1)

Chlorophyll content (mg (g FW))1) Fru-2,6-P2 (pmol (g FW)-1)

T-DNA containing the neomycin phosphotransferase (nptII) gene and the modi®ed 6-PF-2-K/Fru-2,6-P2ase cDNA under the control of a CaMV 35S promoter. Kanamycin-resistant plants regenerated from transformed callus were tested to con®rm expression of the 6-PF-2-K/Fru-2,6-P2ase gene construct. RNA was isolated and puri®ed from leaves of putative transgenic lines of tobacco. A radioactive probe for the 6-PF-2-K/ Fru-2,6-P2ase coding region hybridised to the anticipated 1400-nucleotide transcript in all of the transformed plants, but did not hybridise to any message from untransformed plants (data not shown). In total, of the 24 lines of tobacco that were kanamycin resistant, we tested eight independent plant lines, all of which expressed the mammalian 6-PF-2-K/Fru-2,6-P2ase transcript. The activity of Fru-2,6-P2ase in leaves of all transgenic lines tested was greater than that in untransformed tobacco. Furthermore, there was a direct correlation between mRNA levels and the in-vitro activity of Fru-2,6-P2ase. The increase in Fru-2,6-P2ase activity resulted in lower Fru-2,6-P2 content in the leaves. Compared with untransformed plants, the amounts of Fru-2,6-P2 in darkened leaves of the transgenic lines were decreased by 20±44%. There was an inverse correlation between the measured Fru-2,6-P2ase activity in the tobacco leaves and the steady-state amount of Fru-2,6-P2 (Fig. 2). Despite large changes in the activity of Fru-2,6-P2ase, there were no major pleiotropic eects in the plant lines used in this study. There were no signi®cant changes in the activities of any of the enzymes measured, including those of enzymes which catalyse metabolic steps known to be in¯uenced by Fru-2,6-P2 (Table 1). Similarly there were no signi®cant dierences between the chlorophyll contents of the transformed lines and untransformed

Plant line

Fig. 2. Relationship between increased Fru-2,6-P2ase activity and Fru-2,6-P2 content of transgenic plants. The amount of Fru-2,6-P2 was determined in darkened leaves and compared with Fru-2,6-P2ase activity. The values are the mean SE of determinations on three plants. Each point is a separate plant line: Samsun (circles), A.1.8 (squares), B.2.3 (triangles, point down), B.3.3 (triangles, point up), B.3.4 (diamonds), A.2.8 (hexagons)

867 Table 1. Enzyme activities in leaves of transgenic tobacco lines. Leaves were harvested from 10-week-old tobacco plants at the end of the night and assayed for enzyme activity. Comparable leaves were assayed for Fru-2,6-P2 and chlorophyll. Each result is the mean SE of measurements on three separate plants, except chlorophyll determinations for which the number of measurements is indicated in parentheses



868

Samsun (Table 1), or in the amount of Rubisco, determined immunochemically (data not shown). The physical appearance and growth of the transgenic lines containing the modi®ed mammalian 6-PF-2-K/Fru-2,6P2ase gene were qualitatively similar to those of normal tobacco plants. Carbohydrate metabolism in transgenic plants over-expressing Fru-2,6-P2ase To investigate the eect of decreased Fru-2,6-P2 on carbohydrate metabolism in tobacco leaves, Fru-2,6-P2 content, sucrose accumulation and starch synthesis were compared in leaves of F1 plants derived from primary transformants. The amounts of Fru-2,6-P2 were measured before the start of illumination and at both 30 min and 60 min into the light period (Table 2). The steadystate Fru-2,6-P2 content of these lines prior to illumination was decreased to between 54 and 75% of that in Samsun. In the untransformed control plants the amount of Fru-2,6-P2 initially decreased and subsequently increased upon illumination. Transgenic lines A.1.8, B.3.3 and B.3.4 exhibited a similar response. In contrast, no signi®cant changes in Fru-2,6-P2 content were observed in lines B.2.3 or A.2.8. However, it is possible that in these two lines the amount of Fru-2,6-P2 had decreased and recovered within the ®rst 30 min of illumination. The Fru-2,6-P2 content of leaves varies throughout the photoperiod in response to the availability of triose phosphate (feed-forward regulation) and accumulation of sucrose (feedback regulation) (Stitt 1997). Since both the rate of photosynthesis and the accumulation of sucrose varied between lines (see below), feed-forward and feedback regulation are likely to contribute dierentially to determining the Fru-2,6-P2 content in each of the lines at any speci®c time-point during the light phase. To avoid problems associated with the variation in metabolic state between lines, all comparisons were based on the Fru-2,6-P2 content of leaves prior to illumination when any eects of variation in the rates of photosynthesis or sucrose production are likely to be minimal. All transgenic plants possessing decreased amounts of Fru-2,6-P2 contained less sucrose in the leaves at the start of the light period than untransformed Samsun

(Fig. 3C). On illumination sucrose accumulated more rapidly in leaves of the transgenic plants than in those of the control plants over the ®rst 30 min. However, sucrose continued to accumulate in the untransformed plants over the subsequent 30 min illumination, whereas there was little further accumulation of sucrose in the transgenic plants over this period (with the exception of line A.1.8, see below). In contrast, the amount of glucose was signi®cantly greater in the transgenic lines than untransformed Samsun at the beginning of the photoperiod. In the three lines with the lowest Fru-2,6-P2 content, and in which sucrose accumulation eectively ceased after the ®rst 30 min of

Table 2. The Fru-2,6-P2 content of leaves of transgenic tobacco plants in the light. The amount Fru-2,6-P2 was determined in leaves from 10-week-old plants harvested 0, 0.5 and 1 h into the photoperiod. Each value is the mean SE of replicate measurements from three separate plants. n.d., not detectable Plant line

Fru-2,6-P2 in leaves at speci®c time after onset of illumination (pmol (g FW))1) 0h

Samsun A.1.8 B.2.3 B.3.3 B.3.4 A.2.8

37.0 27.6 24.8 23.8 20.7 20.3

2.7 2.5 4.3 2.1 0.3 5.6

0.5 h

1h

5.4 n.d. 21.7 9.2 14.1 21.7

39.4 44.0 22.2 18.9 23.7 23.7

5.4

12.5 2.6 1.9 3.4

7.1 3.7 3.3 1.9 4.4 3.9

Fig. 3A±C. Carbohydrate content of leaves in control and transgenic tobacco lines during the initial hour of illumination. Starch and soluble carbohydrates were measured in individual leaves immediately before illumination (dark shading) and after 30 min (light shading) and 60 min (unshaded ) of illumination. All values are expressed as hexose equivalents and are the mean SE of measurements from three separate plants. Data for starch are presented as the amount accumulated during the photoperiod. The starch content (expressed as lmol hexose (g FW))1) of the leaves prior to illumination were: Samsun, 23.3 2.7; A.1.8, 15.9 1.9; B.2.3, 105 3.2; B.3.3, 0.9 0.5; A.2.8, 64.5 6.1. A, starch; B, glucose; C, sucrose (data for fructose are not shown)


869

Fig. 4. Eect of Fru-2,6-P2 on the accumulation of sucrose and starch in the ®rst 30 min of the photoperiod. The accumulation of sucrose (triangles) and starch (squares) in leaves during the initial period of illumination are compared with the Fru-2,6-P2 content of darkened leaves. Each point represents an independent plant line from Fig. 3. Each value is the mean SE of measurements from three separate plants. Inset: the relationship between Fru-2,6-P2 and the ratio of sucrose accumulation/starch accumulation in leaves 30 min into the photoperiod

Fig. 5. Eect of decreased amounts of Fru-2,6-P2 on carbohydrate ¯uxes at the onset of illumination. Leaf discs were cut from untransformed tobacco and independent transgenic lines A.1.8, B.2.3, B.3.3, B.3.4 and A.2.8 at the end of the night and illuminated at 200 lmol PAR m)2 s)1 in an oxygen electrode containing air saturated with 14CO2. After 20 min the leaf discs were extracted and the amounts of radioactivity assimilated into total non-volatile compounds (circles), sucrose (triangles) and starch (squares) were determined. Measurements are the mean SE from three separate samples for each plant line

illumination, there was appreciable accumulation of glucose during the second half-hour of photosynthesis (Fig. 3B). These changes in glucose were not accompanied by equivalent changes in the amount of fructose, which remained low throughout the ®rst 60 min of the photoperiod (data not shown). Line A.1.8, in which Fru2,6-P2 content was least aected, was exceptional. Leaves of this transformed line accumulated sucrose throughout the ®rst and second 30 min of the photoperiod (Fig. 3C). The progressive increase in sucrose was accompanied by a decrease in glucose in this line (Fig. 3B). The amount of starch in the dierent plant lines at the start of the photoperiod was variable. However starch accumulation in the transgenic lines was generally smaller than that in the untransformed control during both the ®rst and second 30 min of illumination (Fig. 3A). Over the ®rst 30 min of illumination there was a direct correlation between Fru-2,6-P2 and starch accumulation, and an inverse correlation between Fru-2,6-P2 and sucrose accumulation (Fig. 4). Consequently, tobacco leaves containing smaller amounts of Fru-2,6-P2 possessed progressively greater sucrose/starch ratios over this period (Fig. 4, inset).

studied the metabolism of 14CO2 by excised leaf discs of each of the plant lines illuminated for 20 min. The rate of 14CO2 assimilation was lower in the transgenic lines with decreased Fru-2,6-P2 content (Fig. 5). There was a corresponding decrease in the rate of [14C]starch production in these lines, but in contrast, the rate of [14C]sucrose production was largely unaected (Fig. 5). Expressing the data as a percentage of total 14CO2 metabolised, decreasing Fru-2,6-P2 content led to increased partitioning to sucrose (Fig. 6A) and decreased partitioning to starch (Fig. 6B). There was no signi®cant dierence between lines in the proportion of 14CO2 converted to organic acids (Fig. 6C). However, more 14 CO2 was metabolised to amino acids in the transgenic lines than in the control plants (Fig. 6D).

Metabolic ¯uxes during photosynthesis in transgenic plants The relationship between carbohydrate accumulation and Fru-2,6-P2 suggests that this signal metabolite has a profound aect on the partitioning of assimilates during photosynthesis. To investigate the eect of reduced amounts of Fru-2,6-P2 on photosynthetic ¯uxes, we

Metabolite content of leaves of transgenic plants To assist in analysis of the eects of altered Fru-2,6-P2 content on photoassimilate partitioning the amounts of metabolic intermediates were determined in leaves of four of the experimental lines after 20 min illumination (Table 3). Decreasing Fru-2,6-P2 led to progressive increases in the amounts of both glucose 6-phosphate (Glc-6-P) and Fru-6-P, whereas the amounts of 3phosphoglycerate (3PGA) and dihydroxyacetone phosphate (DHAP) were lower in the transgenic leaves than in the untransformed control. Consequently, the ratio Glc-6-P/3PGA increased progressively as the Fru-2,6-P2 content decreased. In contrast, the sum of the principal phosphate esters were lower in leaves with reduced amounts of Fru-2,6-P2.

870

Fig. 6A±D. Eect of decreased Fru-2,6-P2 content on photosynthetic carbon partitioning at the onset of illumination. Leaf discs from leaves of wild-type tobacco and ®ve independent transgenic lines A.1.8, B.2.3, B.3.3, B.3.4 and A.2.8 were allowed to photosynthesise in the presence of 14CO2 as described in Fig. 5. After 20 min the leaf discs were extracted and the distribution of metabolised 14C was determined. These data were used to calculate the percentage of assimilated 14CO2 metabolised to sucrose (A), starch (B), organic acids (C), and amino acids (D). Each graph is plotted to the same scale to aid comparison. Measurements are the mean SE from three separate samples for each plant line

Discussion Fructose 2,6-bisphosphate in¯uences assimilate partitioning in leaves Our results provide direct evidence that a decrease in Fru-2,6-P2 promotes the partitioning of photoassimilate into sucrose relative to starch. In leaf disks the


percentage of 14CO2 metabolised to sucrose is greater in transgenic plants in which the amount of Fru-2,6-P2 is lower than in untransformed control lines not expressing the modi®ed mammalian 6-PF-2-K/Fru-2,6P2ase. In contrast, there is a dramatic reduction in the proportion of 14CO2 metabolised to starch in these same transgenic lines compared with normal plants. This diversion of photoassimilate results in greater sucrose accumulation and less starch production in leaves on intact transgenic plants during the initial 30 min of the photoperiod. The consistency of response between intact plants and excised leaf disks suggests that the metabolic consequences described above are due to a direct eect of Fru-2,6-P2 on metabolism in leaves rather than in other parts of the plant. Dierences between plant lines in the amounts of metabolites in leaves support this view. The decrease in 3-carbon phosphorylated intermediates and increase in hexose phosphates (particularly Glc-6-P which in leaves is preferentially located in the cytosol (Gerhardt et al. 1987) are consistent with the decreased Fru-2,6-P2 concentration relieving inhibition of cytosolic FBPase in the transgenic lines. The increase in hexose phosphates would favour sucrose production leading to its more rapid accumulation at the beginning of the photoperiod. Moreover, the decreases in 3PGA and triose phosphates are likely to reduce starch synthesis in two ways. First, the overall decline in 3-carbon intermediates will stimulate export of carbon from chloroplasts through the triose-phosphate translocator, thus depleting the pool of available substrate for starch synthesis. Secondly, the decrease in 3PGA is likely to lower the choloroplastic 3PGA/Pi ratio thus inhibiting ADPglucose pyrophosphorylase (Copeland and Preiss 1981). In addition to the major eects on carbon partitioning into sucrose and starch, decreasing Fru-2,6-P2 also increases the proportion of 14CO2 metabolised to amino acids. This response mirrors the decrease in labelling of amino acids observed in a previous study in which the amount of Fru-2,6-P2 was increased (Scott et al. 1995). Although amino acid synthesis is a relatively minor ¯ux under the growth conditions used in these studies and the precise identity of the radiolabelled compounds within the basic fraction has not been established, it is likely that the majority are synthesised outside the chloroplast (or are derived from carbon skeletons involving at least one extra-chloroplastic step in their synthesis). This implies that altering the concentration of Fru-2,6-P2 in¯uences not only sucrose production but also other aspects of cytosolic carbon metabolism. We speculate that this eect is due to the stimulation of triose phosphate export from the chloroplast resulting from activation of cytosolic FBPase and the inevitable decrease in the triose phosphate/Pi ratio. Such an explanation suggests that decreasing the amount of Fru-2,6-P2 indirectly promotes assimilate partitioning into the cytosol to the detriment of metabolism in chloroplasts.

P. Scott et al.: Eect of decreased Fru-2,6-P2 on photosynthesis Table 3. Metabolite content of illuminated leaves of 10-week-old tobacco. Leaves were harvested 20 min into the normal photoperiod. The amount of Fru-2,6-P2 in darkened leaves of the Metabolite

Glc-6-P Fru-6-P DHAP 3PGA P P-esters Glc-6-P/3PGA

871 trangenic lines is shown in parentheses as a percentage of that in the untransformed control (Samsun). The results are the mean SE of measurements on three separate plants

Metabolite content of leaves from speci®c plant line (nmol (g FW))1) Samsun (100%)

A.1.8 (75%)

B.3.4 (58%)

A.2.8 (54%)

64.7 11.1 87.1 256.7 419.6 0.25

87.5 14.4 44.4 145.7 292.0 0.60

90.2 20.4 31.2 146.2 287.8 0.62

106.7 20.4 67.0 163.3 357.4 0.65

13.6 2.6 5.0 23.4

Fructose 2,6-bisphosphate aects co-ordination of cytosolic and chloroplastic metabolism Despite altering partitioning of photoassimilate in favour of sucrose at the expense of starch, decreasing Fru-2,6-P2 does not increase the absolute ¯ux to sucrose in this study. This is because the drop in Fru-2,6-P2 is accompanied by a decline in the rate of CO2 assimilation. There are two ways in which perturbation of the amount of Fru-2,6-P2 may lead to depression in the rate of photosynthesis. One is that super-optimal activation of cytosolic FBPase will decrease the amounts of cytosolic 3-carbon intermediates thus promoting the export of triose phosphates (principally DHAP) from the chloroplast through the triose-phosphate translocator. At the onset of photosynthesis, excessive removal of triose phosphates from the chloroplast would restrict auto-catalytic build-up of Calvin cycle intermediates and thus prevent maximum rates of photosynthesis. The lower amounts of 3PGA and triose phosphates in transgenic lines with decreased Fru-2,6-P2 content are consistent with this proposal. Alternatively, the decrease in photosynthesis could be a secondary eect of the inhibition of starch synthesis. This would result from inhibition of ADPglucose pyrophosphorylase due to lower amounts of 3PGA in the transgenic lines. Any restriction in starch synthesis will limit the regeneration of Pi in the chloroplast. This, in turn, will limit the ability of the cell to generate ATP through photophosphorylation, restrict the conversion of 3PGA to triose phosphates, and thus prevent the normal operation of the Calvin cycle. Such restrictions of CO2 assimilation have been observed in other studies in which the ability of leaves to synthesise starch is constrained (Casper et al. 1985; Neuhaus et al. 1989; Neuhaus and Stitt 1990; Smith et al. 1990). However, this explanation is unlikely to account for the inhibition of photosynthesis seen in the present study for two reasons. One is that there is no indication of the reciprocal changes in 3PGA (increasing) and DHAP (decreasing) that would be anticipated if stromal ATP was limiting in transgenic lines with decreased Fru-2,6-P2 (Stitt 1997). The other is that the sum of the esteri®ed phosphate in the intermediates measured in Table 3 is lower in the transgenic lines with decreased Fru-2,6-P2. This suggests that, if anything, the cytoplasmic Pi concentration is likely to be

7.9 2.1 15.6 17.3

5.2 3.2 2.3 6.8

22.4 4.3 2.3 6.8

larger in the transgenic lines than in the untransformed control. A further alternative is that the depression in the rate of photosynthesis is due to restriction in the photosynthetic capacity of the leaves. This would be a long-term eect resulting from repression of photosynthetic gene expression because of accumulation of sugars in leaves (e.g. Stitt et al. 1991). Two lines of evidence suggest that this explanation does not contribute to the decline in photosynthesis seen in the present study. First, despite the more rapid accumulation of sucrose in leaves of transgenic lines possessing smaller amounts of Fru-2,6-P2, after the ®rst hour of photosynthesis the amounts of sugars in leaves of the modi®ed lines are no greater than those of untransformed plants. Secondly, in the present study there is no signi®cant dierence between lines in chlorophyll content, amount of Rubisco, or activities of stromal FBPase and NADP-GAPDH, each of which is known to respond to changes in leaf sugar content (Krapp et al. 1991; Stitt et al. 1991). Thus, from the available data it seems most likely that the lower rates of CO2 assimilation in the transgenic lines possessing decreased amounts of Fru-2,6-P2 are due to enhanced export of carbon from the chloroplasts. This, in conjunction with previous studies (Kruger and Scott 1995) and consideration of amino acid synthesis in these plant lines (see above), suggests that Fru-2,6-P2 has an important role in the integration of cytosolic and chloroplastic carbon metabolism. Reducing the Fru-2,6-P2 content leads to glucose accumulation in leaves An unexpected ®nding of this study is the accumulation of glucose in leaves of the transgenic lines with the lowest Fru-2,6-P2 content. However, the source of this sugar is uncertain. One possibility is that enhanced ¯ux to sucrose (due to the relief of cytosolic FBPase from inhibition by Fru-2,6-P2) leads to increased recycling of sucrose within the leaf, and that the increased hydrolysis of sucrose by invertase exceeds the capacity of the leaf to phosphorylate the resulting glucose, but not fructose, leading to preferential accumulation of glucose. A similar preferential accumulation of glucose has been observed in leaves of transgenic tobacco expressing yeast

872

acid invertase in the vacuole (Sonnewald et al. 1991) and in potato tubers in which sucrose metabolism is increased by expression of the same invertase in the cytosol (Sonnewald et al. 1997). In the latter instance, proof that the accumulation of glucose is due to the restricted capacity of the tuber to metabolise this hexose is provided by co-expression of a bacterial glucokinase activity which abolished glucose accumulation in the transgenic tubers (Trethewey et al. 1998). An alternative explanation for the accumulation of glucose is that it is derived directly from starch. This could occur if the more rapid accumulation of sucrose caused greater partitioning of assimilate to starch earlier in the photoperiod in plant lines with lower Fru-2,6-P2 content than wild-type plants. Subsequent hydrolysis of starch in the light could result in glucose accumulation. Decreased amounts of 3PGA in the transgenic lines may limit the activity of ADPglucose pyrophosphorylase and thus account for the inability of these plants to recycle this glucose into starch. Previous studies in which increasing the amount of Fru-2,6-P2 leads to a decrease in the rate of starch mobilisation in leaves in the dark support the view that manipulating the amount of this signal metabolite can in¯uence starch metabolism in the chloroplast (Scott and Kruger 1995). Moreover, a similar response is seen in transgenic tobacco leaves in which expression of the triose-phosphate translocator is reduced by antisense inhibition. These plants display increased rates of starch synthesis which result in increased starch hydrolysis in the light and, in some circumstances, a marked increase in the glucose/fructose ratio (HaÈusler et al. 1998). At present there is insucient information to distinguish between the two possible sources of glucose. Since the amounts of glucose that accumulate in some of the plant lines are substantial, uncertainty over the source of such glucose could appreciably aect estimates of ¯ux to sucrose and starch in leaves. However, in our study there is no signi®cant labelling of glucose from 14 CO2 in leaf disks during the ®rst 20 min of illumination, and there is no substantial glucose accumulation until the second 30 min of the photoperiod. In contrast, our evidence for the role of Fru-2,6-P2 in carbon partitioning is provided principally by measurements obtained in the ®rst half-hour of photosynthesis. Thus, irrespective of its route of synthesis, the unexpected accumulation of glucose in some of the transgenic lines does not substantially weaken the arguments presented in this paper. To conclude, the properties of the transgenic plants possessing altered amounts of Fru-2,6-P2 described in this report and our previous work (Kruger and Scott 1994; Scott et al. 1995; Scott and Kruger 1995) demonstrate directly the importance of this signal metabolite in integration of cytosolic and chloroplastic carbohydrate metabolism in plants during photosynthesis. In particular, they provide decisive evidence for the crucial roles of Fru-2,6-P2 in co-ordinating sucrose synthesis with the rate of CO2 ®xation, and in regulating the partitioning of assimilate between the major photosynthetic endproducts (Stitt 1997).

P. Scott et al.: Eect of decreased Fru-2,6-P2 on photosynthesis This research was supported by the Biotechnology and Biological Sciences Research Council (formerly Agriculture and Food Research Council, grant No. PG43/531), and the Royal Society, UK. We thank Dr. P. Mullineaux (John Innes Centre) for providing plasmid pJIT62, Dr. M.A.J. Parry (IACR Rothamsted) for supplying Rubisco antibodies, Dr. M.R. Truesdale (University of Sussex) for performing chlorophyll determinations and V. Tekin (University of Oxford) for technical assistance throughout this work. We are deeply grateful to Prof. Simon Pilkis (deceased) for his encouragement and advice during the early stages of this study.

References Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol 24: 1±15 Bevan M (1984) Binary vectors for plant transformation. Nucleic Acids Res 12: 8711±8721 Casper T, Huber SC, Somerville C (1985) Alterations in growth, photosynthesis, and respiration in a starchless mutant of Arabidopsis thaliana (L.) de®cient in chloroplast phosphoglucomutase activity. Plant Physiol 79: 11±17 Copeland L, Preiss J (1981) Puri®cation of leaf ADPglucose pyrophosphorylase. Plant Physiol 68: 996±1001 Darville MI, Crepin KM, Vandekerhove J, Van Damme J, Octave JN, Rider MH, Marchand MJ, Hue L, Rousseau GG (1987) Complete nucleotide sequence coding for rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase derived from a cDNA clone. FEBS Lett 224: 317±321 Fell D (1997) Understanding the control of metabolism. Portland Press, London Gerhardt R, Stitt M, Heldt HW (1987) Subcellular metabolite levels in spinach leaves. Regulation of sucrose synthesis during diurnal alterations in photosynthesis. Plant Physiol 83: 399±407 Hajirezaei MR, Stitt M (1991) Contrasting roles for pyrophosphate: fructose-6-phosphate phosphotransferase during ageing of tissues from potato tubers and carrot storage tissues. Plant Sci 77: 177±183 Hatzfeld W-D, Dancer J, Stitt M (1990) Fructose-2,6-bisphosphate, metabolites and ``coarse'' control of pyrophosphate: fructose 6-phosphate phosphotransferase during triose phosphate recycling in heterotrophic cell suspension cultures of Chenopodium rubrum. Planta 180: 205±211 HaÈusler RE, Schlieben NH, Schulz B, FluÈgge UI (1998) Compensation of decreased triose phosphate/phosphate transport activity by accelerated starch turnover and glucose transport in transgenic tobacco. Planta 204: 366±376 HoÈfgen R, Willmitzer L (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res 16: 9877 Kerr PS, Huber SC (1987) Coordinate control of sucrose formation in soybean leaves with sucrose-phosphate synthase and fructose 2,6-bisphosphate. Planta 170: 197±204 Krapp A, Quick WP, Stitt M (1991) Ribulose-1,5-bisphosphate carboxylase/oxygenase, other Calvin-cycle enzymes, and chlorophyll decrease when glucose is supplied to mature spinach leaves via the transpiration stream. Planta 186: 58±69 Kruger NJ (1996) Detection of polypeptides on immunoblots using secondary antibodies or protein A. In: Walker J (ed) The protein protocols handbook. Humana Press, New Jersey, pp 313±321 Kruger NJ, Scott P (1994) Manipulation of fructose 2,6-bisphosphate levels in trangenic plants. Biochem Soc Trans 22: 904±909 Kruger NJ, Scott P (1995) Integration of cytosolic and plastidic carbon metabolism by fructose 2,6-bisphosphate. J Exp Bot 46: 1325±1333 Kruger NJ, Kombrink E, Beevers H (1983) Pyrophosphate: fructose 6-phosphate phosphotransferase in germinating castor bean seedlings. FEBS Lett 153: 409±412 Kurland IJ, El-Maghrabi MR, Correira JJ, Pilkis SJ (1992) Rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. Properties of phospho- and dephospho forms of two mutants

P. Scott et al.: Eect of decreased Fru-2,6-P2 on photosynthesis in which ser32 has been changed by site directed mutagenesis. J Biol Chem 267: 4416±4423 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680±685 Li L, Lin K, Kurland IJ, Correia JJ, Pilkis SJ (1992) Site-directed mutagenesis in the rat liver 6-phosphofructo-2-kinase. Mutation at the fructose 6-phosphate binding site aects phosphate activation. J Biol Chem 267: 4386±4393 Leegood RC (1990) Enzymes of the Calvin cycle. In: Lea PJ (ed) Methods in plant biochemistry, vol 3. Academic Press, London, pp 15±37 Lichtenstein CP, Draper J (1985) Genetic engineering of plants. In: Glover DM (ed) DNA cloning a practical approach, vol 2. IRL Press, Oxford, pp 67±119 Morrell S, ap Rees T (1986) Control of hexose content of potato tubers. Phytochemistry 25: 1073±1076 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15: 473±497 Neuhaus HE, Stitt M (1990) Control analysis of photosynthate partitioning. Impact of reduced activity of ADPglucose pyrophosphorylase or plastid phosphoglucomutase on the ¯uxes to starch and sucroce in Arabidopsis thaliana (L) Heynh. Planta 182: 445±454 Neuhaus HE, Kruckeberg AL, Feil R, Stitt M (1989) Reducedactivity mutants of phosphoglucose isomerase in the cytosol and chloroplast of Clarkia xantiana. II. Study of the mechanisms which regulate photosynthate partitioning. Planta 178: 110±122 Quick WP, Neuhaus HE, Stitt M (1989) Increased pyrophosphate is responsible for a restriction of sucrose synthesis after supplying ¯uoride to spinach leaf discs. Biochim Biophys Acta 973: 263±271 Rosahl S, Schell J, Willmitzer L (1987) Expression of tuber speci®c storage proteins in transgenic tobacco plants: demonstration of esterase activity. EMBO J 6: 1155±1159 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, New York Scott P, Kruger NJ (1994) Fructose 2,6-bisphosphate levels in mature leaves of tobacco (Nicotiana tabacum) and potato (Solanum tuberosum). Planta 193: 16±20 Scott P, Kruger NJ (1995) In¯uence of elevated fructose 2,6bisphosphate levels on starch mobilization in trangenic tobacco leaves in the dark. Plant Physiol 108: 1569±1577

873 Scott P, Lange AJ, Pilkis SJ, Kruger NJ (1995) Carbon metabolism in leaves of transgenic tobacco (Nicotiana tabacum L.) containing elevated fructose 2,6-bisphosphate levels. Plant J 7: 461±469 Smith AM, Neuhaus HE, Stitt M (1990) The impact of decreased activity of starch-branching enzyme on photosynthetic starch synthesis in leaves of wrinkled-seeded peas. Planta 181: 310±315 Sonnewald U, Brauer M, von Schaewen A, Stitt M, Willmitzer L (1991) Transgenic tobacco plants expressing yeast-derived invertase in either the cytosol, vacuole or apoplast: a powerful tool for studying sucrose metabolism and sink/source interactions. Plant J 1: 95±106 Sonnewald U, Hajiraezaei M-R, Kossmann J, Heyer A, Trethewey RN, Willmitzer L (1997) Expression of a yeast invertase in the apoplast of potato tubers increases tuber size. Nature Biotech 15: 794±797 Stitt M (1990) Fructose 2,6-bisphosphate as a regulatory molecule in plants. Annu Rev Plant Physiol Plant Mol Biol 41: 153±185 Stitt M (1997) The ¯ux of carbon between the chloroplast and cytoplasm. In: Dennis DT, Turpin DH, Lefebvre DD, Layzell DB (eds) Plant metabolism. Longman, Harlow, Essex, pp 382±400 Stitt M, Miekes G, SoÈling H-D, Heldt HW (1982) On a possible role of fructose 2,6-bisphosphate in regulating photosynthetic metabolism in leaves. FEBS Lett 145: 217±222 Stitt M, Miekes G, SoÈling H-D, Groûe H, Heldt HW (1986) Diurnal changes of 6-phosphofructo-2-kinase and fructose-2,6bisphosphatase activities in spinach leaves. Z NaturfoÈrsch 41c: 291±296 Stitt M, Von Schaewen A, Willmitzer L (1991) ``Sink'' regulation of photosynthetic metabolism in transgenic tobacco plants expressing yeast invertase in their cell wall involves a decrease of the Calvin-cycle enzymes and an increase of glycolytic enzymes. Planta 183: 40±50 Tauler A, Lange AJ, El-Maghrabi MR, Pilkis SJ (1989) Expression of rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase and its kinase domain in Escherichia coli. Proc Natl Acad Sci 86: 7316±7320 Tauler A, Lin K Pilkis SJ (1990) Hepatic 6-phosphofructo-2kinase/fructose-2,6-bisphosphatase. Use of site directed mutagenesis to evaluate the roles of His-258 and His-392 in catalysis. J Biol Chem 265: 15617±15622 Trethewey RN, Geigenberger P, Riedel K, Hajirezaei M-R, Sonnewald U, Stitt M, Riesmeier JW, Willmitzer L (1998) Combined expression of glucokinase and invertase in potato tubers leads to a dramatic reduction in starch accumulation and stimulation of glycolysis. Plant J 15: 109±118