Photosynthetic Genes of Petunia (Mitchell) Are Differentially ... - NCBI

Received for publication July 18, 1988 and in revised form October 3, 1988

Plant Physiol. (1989) 89, 776-782 0032-0889/89/89/0776/07/$01 .00/0

Photosynthetic Genes of Petunia (Mitchell) Are Differentially Expressed during the Diurnal Cycle Mark M. Stayton', Paul Brosio, and Pamela Dunsmuir*

Advanced Genetic Sciences, Inc., 6701 San Pablo Avenue, Oakland, California 94608 dark) cycle (1 1, 14, 31). Selected biological rhythms can also be classified as circadian (related to the 24 h cycle of the earth's rotation) because, although affected by their environment, these rhythms can be shown to persist even under constant conditions (9). These processes include variation in rates of leaf elongation and water deposition (25, 26). In addition, plants undergo significant biochemical changes during the diurnal cycle. For example, specific enzymes undergo reversible inactivation (for examples, see Robinson and Walter [24]) and energy metabolism within the leaf shifts from photosynthesis to respiration as the plant adjusts to the dark period. We have grown petunia under a constant light/dark cycle (10 h light, 14 h dark) and measured the levels of RNAs corresponding to five individual petunia cab genes and eight distinct genes which encode the small subunit of ribulose bisphosphate carboxylase (rbcS) (5, 6). The cab RNA pools vary during the light/dark cycle with at least two distinct patterns, while in contrast, the rbcS RNAs show no variation in concentration. The diurnal variation in cab RNA levels can be detected for up to four days after the plants are placed in complete darkness; consistent with a model in which cab gene expression is controlled primarily by an internal circadian clock and secondarily by the Pfr form of phytochrome.

ABSTRACT The petunia (Petunia [Mitchell]) chloroplast proteins, the chlorophyll a/b-binding (Cab) proteins, and the small subunit of ribulose bisphosphate carboxylase (RbcS) are encoded by nuclear genes that are expressed in a light-dependent manner. The steady-state concentrations of five cab mRNAs vary with a dramatic circadian rhythm in plants grown under a constant diumal cycle (10 hours light, 14 hours dark). cab mRNA levels reach their maximum during the light period, but begin to drop prior to the dark period. These RNAs fall to their minimum concentration during the dark period and then begin to increase again in anficipation of the light. Within this general pattem, there are variations in expression among specific classes of cab genes. The light harvesting complex of photosystem 11 LHCII-type 1 cab mRNAs rise to a well-defined maximum at 2 hours prior to the dark period. All but one of these genes are expressed in anticipation of the light period. The LHCII type 2 cab mRNA and the LHC of photosystem I cab mRNA are expressed at more constant levels throughout the light period. The expression of these genes anticipates the light more than does the expression of the LHCII type I genes. The steady state mRNA levels for the petunia rbcS genes show no significant diumal fluctuation.

In petunia, we have partially characterized a nuclear multigene family which encodes the Cab2 proteins that function in light energy capture. PSI and PSII of higher plant chloroplasts are each associated with a light harvesting complex LHCI and LHCII, respectively, comprised of Cab proteins, Chl a and b, and carotenoids (1, 12). In petunia, to date, three classes of cab genes have been described: LHCI (28) and the LHCII types 1 (7) and 2 (27). In tomato, an additional class of LHCI cab genes has been reported (15). Each class of cab gene encodes a distinctly different Chl-binding protein. In addition, these classes of genes differ in gene structure and in their pattern of expression. Expression of the cab genes is light dependent and, in etiolated tissue, the phytochrome light receptor system has been shown to control cab gene transcription (29, 30). In plants grown in white light, the LHCII type 1 cab RNAs have also been shown to vary with a dramatic circadian rhythm (17, 21, 23). Many physiological processes in higher plants are characterized by rhythms which correlate with the diurnal (light/

MATERIALS AND METHODS Plant Growth Conditions All experiments were carried out with Petunia (Mitchell), a double haploid line originating from anther culture of a hybrid between Petunia hybrida var Rose of Heaven and Petunia axillaris (20). Seeds were germinated in the greenhouse, transplanted once and then transferred to 4-inch pots. After about 1 week, the apical meristem was removed from each plant and the pots were placed in a Conviron growth chamber and grown at 24°C (10 h light and 14 h dark). Both incandescent and fluorescent light banks were utilized for a light intensity of 330 AEm-2s-'. Plants were watered daily and fertilized twice per week with mineral nutrients, half-strength Hoagland's solution (10). After 3 weeks, the apical meristem and three youngest leaves were harvested from each shoot tip at the indicated times and frozen in liquid nitrogen. Tissue was pooled from two or three plants for each time point.

General Methods and Reagents Total leaf RNA was isolated as described (4). The cab and rbcS oligonucleotides used in the primer extension analysis were synthesized, purified and quantitated as described pre-

' Present address: Department of Molecular Biology, University of Wyoming, Laramie, WY 82071.

2Abbreviations: Cab, Chl a/b binding; LHCI and LHCII, lightharvesting complexes of PSI and PSII.

776

CIRCADIAN EXPRESSION OF PHOTOSYNTHETIC GENES

viously (3). These primers were quantitatively end-labeled with [_-32P]ATP (5000 Ci/mmol, Amersham) and T4 polynucleotide kinase (18). The specific activity of the end-labeled primers differed by no more than 10%. Primer extensions (3, 8) were carried out on 10 tsg of total leaf RNA (cab primers and rbcS primers except 301T) or on 1.25 ,ug of total leaf RNA (rbcS 30 IT primer). The optimal hybridization temperature for each primer was determined empirically. The primer:RNA hybridizations were carried out in solution with a large molar excess of primer relative to the mRNA. Thus, the annealing reactions are forced to completion ensuring that all mRNA molecules will serve as templates for the reverse transcriptase. Under these conditions, differences in the rate of hybridization among the primers are not significant, since all the hybridizations go to equilibrium. A summary of the primers and their hybridization properties is presented in Table I. Four of the cab primers (15, 22L, 22R, and 37) have primer extension products of different lengths and also have similar optimal hybridization temperatures. Therefore, these four primers were extended simultaneously in a single reaction, which permitted the quantitation of the four mRNAs in a single gel lane. Control experiments which compared primer extensions carried out with a single primer with those using four primers confirm the validity of the technique (data not shown). For certain of these experiments, relative cab RNA levels were quantitated by locating the appropriate cab primer extension products on the sequencing gel by autoradiography. The bands were then excised from the gel and the radioactivity quantitated by liquid scintillation counting. At maximum, these bands contained 300 to 700 net cpm. RESULTS

Experimental Design Experiments were carried out in the following manner. Immediately prior to the dark period, half of the plants were

transferred to a light-tight cabinet and maintained in darkness for the duration of the experiment. The remainder of the plants continued in the described diurnal cycle. At the indicated times, all of the shoot tips (along with the first three leaves) were harvested from two to three plants from each plant population and total RNA was prepared. Messenger RNA levels for the cab and rbcS genes were determined for each sample by primer extension (see "Materials and Methods"). Cab Gene Expression during the Diurnal Cycle

Expression of the petunia cab genes is strictly light dependent: cab mRNAs cannot be detected in leaf RNA from plants

maintained in darkness for more than 4 d (27) or in RNA from etiolated tissue (16). During the diurnal cycling of normal plant growth, LHCII type 1 cab RNA concentrations have been shown to vary with a circadian rhythm (17, 21). We have measured mRNA levels during the light/dark cycle for five individual petunia cab genes which encompass an additional two classes of cab genes (Table II). In broad outline, these cab mRNAs show a similar pattern of expression (Figs. 1 and 2). Each cab mRNA is at its maximum concentration during the light period and then decays to a minimum during the dark period. At their minimum during the dark, the cab mRNA levels are 10- to 20-fold lower than the corresponding maxima in the light (see "Materials and Methods"). The cab mRNAs begin to accumulate in the dark as much as 6 h prior to the beginning of the light period and begin to decay before the beginning of the dark period. Thus, plants which are synchronized to the diurnal cycle express cab mRNA with a strong circadian rhythm that is offset from the light/dark cycle. Within this general pattern, specific classes of cab genes show differences in expression. The LHCII type 1 mRNAs (cab22L, cab22R and cab9 1 R) reach a well-defined maximum in concentration about 2 h prior to the dark period and a

Table I. Properties of the Oligonucleotides Used in the Primer Extension Analyses Optimal Oligo

Gene

Specificity

Sequence (3'-5')

777

Annealing Temperature (ocr

Primer-

Extension

Products

161 nt 48 ATTCAGACGACAGAGGAAGG SSU301 115 43 SSU611 TTTTAGACGGAGTCGAAAGG 125-126b 55 SSU91 1 GTTCAGACGTCGGAGGAA 125-126 SSU112 125-126 SSU231 175 SSU491 ? SSU211 168-170 SSU511 (11A) 40 149 cab37 CAGTGTCTTACTCGAA 37 38 69 22R cab22R TGAACATGTATACCGACGTC 38 61, 63, 65 22L cab22L TTCTTGAGAAAAGAGAAGAATAAT 80d 40 LHCI-1 5 GGTAACGTCGACAACGT 15 27 69 GAAGGTAAAATGATAATGT 91 R cab91 R aDetermined empirically. bThe primer extension products observed in petunia with the 911 T primer cannot all be assigned to individual genes. Also, several of the 911 T primer extension products d Approximate length. The C Contains a single mismatch. comigrate on a sequencing gel (3). CAP site has not been mapped.

301T 61 1T 91 1T

778

STAYTON ET AL.

Plant Physiol. Vol. 89,1989

Table II. Genes Encoding the Chl-Binding Proteins of the Light-Harvesting Complexes in Petunia (Mitchell)' Antennae

Gene

Gene Class

Complex

Gene

Copy No.

Gene Structure

AA Homology to cab9l R

cab22R LHCII Type 1 cab22L LHCII >16 Type 1 No introns >95% cab9l R LHCII Type 1 cab37 LHCII Type 2 1 One intron 80 LHCI-15 LHCI NDb ND 35 bA a The data are taken from references 7, 27, and 28. genomic clone for the LHCI-1 5 cDNA has not been isolated in petunia. Genomic southern hybridizations and cDNA cloning suggest that this protein is encoded by one or a few genes which probably contain multiple introns (28). ND = not determined.

v

23

is

;

-.

1

12

16

20

22 231

_

LHCI-15

cab22R

__

w

Cab22L .. - t W

cab9lR

"WON$ lawom,

qw

as a ,-WAO

"no qwlo

*

Figure 1. Primer extension analysis of total petunia leaf RNA (top) using the cab primers, 37, 22R, 22L and 15 and (bottom) using the 91 R primer. The bar at the top of the figure represents a timeline with light and dark periods indicated by shading. Each primer extension product has been assigned to the corresponding gene as indicated on the left side. Petunia plants were grown under a 10 h light/ 14 h dark diurnal cycle. Leaves were harvested at the indicated times, frozen in liquid nitrogen and stored at -80°C until total RNA could be prepared. The experiment was carried out as described in "Materials and Methods" and "Results" using 10 ,ug of RNA/lane. Properties of the primers and the cab genes are summarized in Tables I and 11.

minimum in the dark at 6 to 8 h prior to the light period (Figs. 1 and 2). Expression of these genes anticipates the light period; however, at one hour prior to the light, these RNAs have attained only about 20% of their final maximum RNA concentration (see also Fig. 4A). In contrast, the LHCII type 2 (cab37) and the LHCI (LHCI15) mRNAs are present at relatively high levels throughout

the light period. In the dark, these two mRNAs are at a minimum 8 h prior to the light. In addition, their RNA levels anticipate the light to a greater degree than do the LHCII, type 1 RNAs. In several experiments, these RNAs have achieved 60 to 80% of their maximal level by 1 h prior to the light period (Figs. 1 and 2). Thus the ratio ofthe concentration of an LHCII type 2 cab mRNA (or LHCI mRNA) to an LHCII type 1 cab mRNA changes during the light period. Early in the light period, the ratio is skewed toward type 2 gene expression, while in the afternoon the ratio is skewed strongly toward Type 1 gene expression. Upon placing the plants in permanent complete darkness, cab expression is normal for the initial three to four hours of the next "light" period, whereupon mRNA levels drop precipitously (Figs. 3 and 4B). The circadian rhythm begins to decay, but is detectable for about an additional 2 to 3 days of darkness (Fig. 4B, data not shown). These features of expression are common to most of the petunia cab genes examined to date (17, 21, 23). One LHCII type 1 gene (cab91 R) behaves atypically in the dark. The cab9 l R gene shows relatively little expression during the dark period of a diurnal cycle and the cab9 lR mRNA concentration shows virtually no anticipation of the light period (Figs. 1 and 2). During the light period, the cab91R mRNA varies in parallel with the other two LHCII Type 1 cab genes (22R and 22L) however, in plants that have been moved to the dark cabinet, cab9 1 R mRNA is expressed in a unique pattern. The cab91 R mRNA concentration varies as it would in diurnally grown plants, except that the total level is attenuated (Fig. 3). This contrasts with the other four cab genes, where the level of mRNA drops dramatically in extended darkness, 4 h after the light period should have begun (Figs. 3 and 4B).

Expression of the rbcS Genes During the Diumal Cycle In petunia, the eight nuclear rbcS genes have been cloned and characterized (5, 6) (Table III). The expression of these genes is also strongly light dependent: a 7 d dark treatment of plants causes a dramatic reduction in rbcS RNA in the leaves. However, the variation of rbcS mRNA levels during the diurnal cycle differs from that of the cab gene family. None of the rbcS mRNAs show significant fluctuations during the light/dark cycle (Fig. 5A). In plants that have been transferred to continuous darkness, SSU611 mRNA varies in a manner

,~~


A

~~I 162022 23 1124 911112

I

23lI 2 4 8

6 8

779

I

911112 1620 22 231--I 2 46 8

0

_

cab37

LHCI-15

BP

S Zr^_~~~~~~~

cab22R >

.*

cab22LE

B. 23 1 cab9l R

Figure 2. Primer extension analysis of total petunia leaf RNA (A) using the cab primers, 37, 22R, 22L and 15 and (B) using the 91 R primer.

2

8

4

9 11 12 16 20 22

2311

2

4 6

w~~~~~~~l

9 11 12 16 20 22

--Z -115

2311

9

2

4

6 8

0

ta*-.4

mo

m

I

23 1

I

2

6

4

8

9

11 12 16 20 22 23 1.

cab37

1

1 0

analogous to the cab genes: about 4 h after the beginning of the next "light" period, a significant and abrupt drop in mRNA level is observed (Fig. 5B). The SSU112, 231, and 911 mRNAs, which all hybridize to the 91 IT primer, decrease steadily to levels which are undetectable in 24 h (Fig. 5B). One additional primer extension product, also derived from the 91 IT primer, disappears rapidly in the dark, but the corresponding gene has not been assigned (The gene is proW ably SSUJJA or SSU491 [3].) RNA derived from the SSU301 gene is present at high levels even in extended darkness (Fig. 5B); the concentration of the SSU301 RNA is detectably reduced only after three days of darkness and is virtually undetectable after seven days (data not shown).

4

LHCI-15 cab22R

MO4000 W

w

cab22L

cab9lR

l

.

e

c _

*.

Figure 3. Primer extension analysis of total petunia leaf RNA (top) using the cab primers, 37, 22R, 22L and 15 and (bottom) using the 91 R primer. Petunia plants were grown under a 10 h light/i 4 h dark diumal cycle (in the same growth chamber with the plants for the experiment of Fig. 1), transferred to a dark cabinet at the beginning of a dark period and maintained in complete darkness for the duration of the experiment.

DISCUSSION The three classes of petunia cab genes characterized to date have been distinguished on the basis of differences in gene structure, nucleotide and amino acid sequence and, for some genes, differences in the photosystem to which the encoded protein associates (7, 27, 28). We have described data which differentiate these genes by their pattern of expression during the light/dark cycle. All of the cab RNAs vary with a dramatic circadian rhythm, however the LHCII type 1 RNAs increase to a single, well-defined maximum concentration at two hours prior to darkness. The other cab RNAs reached a maximum near the beginning of the light period and did not vary dramatically during the light period. Circadian variation in RNA concentration for LHCII type 1 cab genes has previously been reported for pea and wheat (17, 21). In both reports, maximal cab RNA levels were observed two to four hours after the beginning of the light


STAYTON ET AL.

780 pl

Day

Day

4

Day

Day

22

-

C 12 16 22

22

L.

_ cab37 w uUI_

w

.:1

l

2

4

8

12 16 22 2

__

LHCI-15 > *

.,*.a

?

Figure 4. Primer extension analysis of total petunia leaf RNA using the following cab primers, 37, 22R and 15. A, Plants grown under a 10 h light/i 4 h dark diurnal cycle. B, Plants grown under a 10 h light/14 h dark diurnal cycle, transferred to the dark cabinet at the beginning of a dark period and maintained in complete darkness for the duration of the experiment.

"., im ia .4000. 'W"

I.w,

Table IlIl. Genes Encoding the Small Subunit of Ribulose Bisphosphate Carboxylase in Petunia (Mitchell)

71 117 51

4

,..

OR

,ab22R

Gene Subfamily

Day 2 Day 3

I

f I

Gene

SSU301 SSU611 SSU911 511 (1 1A) 491 231 211 112 a b Dean et al. (5). Dean et al.

Relative

Guene Structure'

LExpression Levelb

Three introns Two introns Two introns ND Two introns

47

23 NDC ND

7 15 2 5 Two introns c ND: not determined. (4). ND ND

period with a subsequent decrease in cab RNA to a minimum level after about 4 h of darkness. This pattern differs from petunia LHCII type 1 cab expression where maximum RNA levels are seen at 2 hours prior to darkness. Instead, wheat cab- 1 (LHCII-Type 1) expression most closely approximates the LHCII type 2 cab gene expression pattern in petunia. The expression of both the cab and rbcS genes is light dependent, but these two gene families differ in their response to light. The expression of cab genes has never been detected in etiolated tissue. In etiolated seedlings of maize and amaranth, by contrast, steady state levels of rbcS RNA are detectable and increase during development, independently of light (2, 22). In tomato, three of the five rbcS genes are expressed in etiolated seedlings, however, light induces a large increase in RNA concentration for all five genes (19). The cab and rbcS genes also differ in the light intensity necessary to trigger gene expression. In peas, the cab RNAs accumulate at a red light fluence 10,000 times less than that required to stimulate

rbcS RNA accumulation (16). The contrast between rbcS and cab gene expression, in response to the light/dark cycle, is also striking and has been demonstrated in pea and wheat (17, 21), in addition to petunia. In petunia, we have analyzed individual rbcS genes for expression during the diurnal cycle. The most abundant rbcS RNA in petunia (SSU301) persists in extended darkness, which could mask a circadian rhythm in the transcription rate for this gene. However, the SSU9 11, SSUJ 12, and SSU231 RNAs (and to a lesser extent the SSU611 RNA) degrade rapidly in extended darkness. Two observations suggest that the expression of the cab genes is controlled primarily by an internal circadian clock with control via phytochrome as a secondary influence. First, late in the light period, when Pfr levels are presumably saturated, the cab RNA concentrations drop in anticipation of the darkness. Second, when plants have been transferred to continuous darkness after synchronization to a light/dark cycle, the variation in cab RNAs continues even though Pfr levels are being depleted. These data are also consistent with a model in which the sole controlling influence is Pfr which varies, itself, with a circadian rhythm. However, the latter model is unlikely based on the data of Nagy et al. (21), who report that red light flashes at the end of the light period, or at different times during the dark period, affect the amplitude of the circadian variation, but do not affect the periodicity of cab RNA variation. Our data do not distinguish between the two principal mechanistic alternatives that could govern the observed circadian rhythms. The same result would be obtained if either of two extreme models were true: (a) high and constant cab gene transcription rates and diurnal fluctuation of mRNA degradation rates or (b) constant mRNA degradation rates and a circadian fluctuation in the frequency with which transcription is initiated at cab genes. Chimeric gene construc-


781

B.

A.

23 1 2 4 6 8 9 11 12 16 20 22 23 1 2

23 1 2 4 6 8 9 11 12 16 20 22 23 1 2

__

Figure 5. Primer extension analysis of total petunia leaf RNA using the rbcS primers: 301T, 611T, and the 911T. The primer extension products obtained with the 91 1T primer derive from the SSU511 and SSU491 genes (upper cluster of bands) and from the SSU112, 231 and 911 genes (lower bands) (3). Properties of the primers and the SSU genes are described in Tables I and II. A, Plants grown under a 1 0 h light/i 4 h dark diumal cycle. B, Plants grown under a 10 h light/i 4 h dark diumal cycle, transferred to the dark cabinet at the beginning of a dark period and maintained in complete darkness for the duration of the experiment.

301T =

.."IIIMm ...nm"I--- g 611TT-

INWIW--l

,

aRikw

.01.,

91 1T

tions, in which the CaMV35S enhancer sequence is fused to the 3' end of the wheat cab-I gene (LHCII, type 1), are expressed without circadian rhythm in tobacco (21), which suggests that control of the circadian rhythm lies at the level of transcription initiation. The biological significance of a circadian rhythm in cab gene expression may simply be to prepare the chloroplast for the high light fluences of daylight. Consistent with this notion is the observed diurnal variation in the level of protochlorophyllide reductase, a major regulatory enzyme in the Chl biosynthetic pathway (13). However, circadian variation in cab RNA levels would be of limited physiological significance if cab proteins in the thylakoid membrane turn over slowly relative to the light/dark cycle. ACKNOWLEDGMENTS We thank Tom Lemieux and Cara Robinson for help in growing the plants. We owe a major debt to David Gilbert for late-night aid in harvesting plant tissue and for RNA isolations. We are also indebted to Rob Narberes, Joyce Hayashi, and Connie Stephens for the photography and the preparation of the figures, and John Bedbrook, Rich Jorgensen and Ed Ralston for critical reading of the

manuscript. LITERATURE CITED 1. Anderson JM (1986) Photoregulation of the composition, function, and structure of thylakoid membranes. Annu Rev Plant Physiol 37: 93-136 2. Berry J, Nikolau BJ, Carr JP, Klessig DF (1985) Transcriptional and post-translational regulation of ribulose-1,5-bisphosphate carboxylase gene expression in light- and dark-grown amaranth cotyledons. Mol Cell Biol 5: 2238-2246 3. Dean C, Favreau M, Dunsmuir P, Bedbrook J (1987) Confirmation of the relative expression levels of the Petunia (Mitch-

ell) rbcS genes. Nucleic Acids Res 15: 4655-4668 4. Dean C, van den Elzen P, Tamaki S, Dunsmuir P, Bedbrook J (1985) Differential expression of the eight genes of the petunia ribulose bisphosphate carboxylase small subunit multi-gene family. EMBO J 4: 3055-3061 5. Dean C, van den Elzen P, Tamaki S, Dunsmuir P, Bedbrook J (1985) Linkage and homology analysis divides the eight genes for the small subunit of petunia ribulose 1,5-bisphosphate carboxylase into three gene families. Proc Natl Acad Sci USA 82: 4964-4968 6. Dean C, van den Elzen P, Tamaki S, Black M, Dunsmuir P, Bedbrook J (1987) Molecular characterization of the rbcS multi-gene family of Petunia (Mitchell). Mol Gen Genet 206: 465-474 7. Dunsmuir P (1985) The petunia chlorophyll a/b-binding protein genes: a comparison of Cab genes from different gene families. Nucleic Acids Res 13: 2503-2518 8. Dunsmuir P, Bond D, Lee K, Gidoni D, Townsend J (1988) Stability of introduced genes and stability in expression. In SB Gelvin, RA Schilperoot, eds, Plant Molecular Biology Manual. Martinus Nijhoff, New York 9. Edmunds LN (1988) Cellular and Molecular Bases of Biological Clocks: Models and Mechanisms for Circadian Timekeeping. Springer-Verlag, New York, New York 10. Epstein E (1972) Mineral Nutrition of Plants: Principles and Perspectives. John Wiley & Sons, New York, p 39 11. Feldman JF (1982) Genetic approaches to circadian clocks. Annu Rev Plant Physiol 33: 583-608 12. Glazer AN (1983) Comparative biochemistry of photosynthetic light-harvesting systems. Annu Rev Biochem 52: 125-157 13. Griffiths WT, Kay SA, Oliver RP (1985) The presence and photoregulation of protochlorophyllide reductase in green tissues. Plant Mol Biol 4: 13-22 14. Hillman WS (1976) Biological rhythms and physiological timing. Annu Rev Plant Physiol 27: 159-179 15. Hoffman NE, Pichersky E, Malik VS, Castresana C, Ko K, Darr SC, Cashmore AR (1987) A cDNA clone encoding a photosystem I protein with homology to photosystem II chlorophyll a/b-binding polypeptides. Proc Natl Acad Sci USA 84: 88448848 16. Kaufman LS, Thompson WF, Briggs WR (1984) Different red

782

17.

18.

19.

20. 21.

22. 23.

24.

25.

STAYTON ET AL. light requirements for phytochrome-induced accumulation of cab RNA and rbcS RNA. Science 226: 1447-1449 Kloppstech K (1985) Diurnal and circadian rhythmicity in the expression of light-induced plant nuclear messenger RNAs. Planta 165: 502-506 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Manzara T, Gruissem W (1988) Organization and expression of the genes encoding ribulose-1,5-bisphosphate carboxylase in higher plants. Photosynth Res 16: 117-139 Mitchell AZ (1979) Anther Culture in Petunia. BA thesis, (Hons.), Harvard University, Cambridge, MA Nagy F, Kay SA, Chua N-H (1988) A circadian clock regulates transcription of the wheat Cab-l gene. Genes Dev 2: 376-382 Nelson T, Harpster MH, Mayfield SP, Taylor WC (1984) Lightregulated gene expression during maize leaf development. J Cell Biol 98: 558-564 Piechulla B, Gruissem W (1987) Diurnal mRNA fluctuations of nuclear and plastid genes in developing tomato fruits. EMBO J 6: 3593-3599 Robinson SP, Walker DA (1981) Photosynthetic carbon reduction cycle. In MD Hatch and NK Boardman, eds, The Biochemistry of Plants: Photosynthesis, Vol 8. Academic Press, NY, pp 194-236 Schnyder H, Nelson CJ (1988) Diurnal growth of tall fescue leaf

26.

27.

28.

29. 30.

31.


blades. I. Spatial distribution of growth, deposition of water, and assimilate import in the elongation zone. Plant Physiol 86:1070-1076 Schnyder H, Nelson CJ, Spollen WG (1988) Diurnal growth of tall fescue leaf blades. II. Dry matter partitioning and carbohydrate metabolism in the elongation zone and adjacent expanded tissue. Plant Physiol 86: 1077-1083 Stayton MM, Black M, Bedbrook J, Dunsmuir P (1986) A novel chlorophyll a/b binding (Cab) protein gene from petunia which encodes the lower molecular weight Cab precursor protein. Nucleic Acids Res 14: 9781-9796 Stayton MM, Brosio P, Dunsmuir P (1987) Characterization of a full-length petunia cDNA encoding a polypeptide of the lightharvesting complex associated with photosystem I. Plant Mol Biol 10: 127-137 Tobin EM, Silverthorne J (1985) Light regulation of gene expression in higher plants. Annu Rev Plant Physiol 36: 569-593 Tobin EM, Wimpee CF, KarHn-Neumana GA, Silverthrone J, Kohorn BD (1985) Phytochrome regulation of nuclear gene expression. In K Steinback, S Bonitz, L Bogorad, CJ Arntzen, eds, Molecular Biology of the Photosynthetic Apparatus. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp 373380 Vince-Prue D (1983) Photomorphogenesis and flowering. In W Shropshire Jr, H Mohr, eds, Encyclopedia of Plant Physiology, Vol 16B. Springer-Verlag, Berlin, pp 458-490