Phylogenetic relationships between geographically separate ...

Polar Biol (2010) 33:1419–1428 DOI 10.1007/s00300-010-0834-8

ORIGINAL PAPER

Phylogenetic relationships between geographically separate Phormidium cyanobacteria: is there a link between north and south polar regions? Otakar Strunecký · Josef Elster · Jilí Komárek

Received: 3 June 2009 / Revised: 28 April 2010 / Accepted: 12 May 2010 / Published online: 3 June 2010 © Springer-Verlag 2010

Abstract We present a phytogeographical comparison between polar (Arctic and Antarctic) and non-polar strains of the cyanobacterial genus Phormidium, which plays a key role in Arctic and Antarctic ecosystems as primary producer. A total of 26 Phormidium strains were studied using a polyphasic approach, 18 from Arctic (Svalbard, Ellesmere Island and Scandinavian Arctic—Abisko) and Antarctic (Antarctic Peninsula—King George and James Ross Island) regions, and 8 from temperate sites (mostly situated in Central Europe). A phylogenetic tree was constructed and compared with similar 16S rRNA sequences retrieved from Genbank. Within the Phormidium autumnale cluster, genetic similarity of 16S rDNA was more related to geographical proximity of strain origin than to morphological similarity. No genetic identity of Phormidium strains from north and south polar regions was found. The cluster Phormidium autumnale apparently belongs to generic entities in which geographical limitation plays a prominent role. However, the cyanobacterial strains found in Europe suggest that the distribution areas of some Phormidium cyanobacteria overlap. The Phormidium autumnale cluster is evidently a very characteristic type and represents an isolated clade within the traditional genus Phormidium. According to morphological features and the structure of

O. Strunecký (&) · J. Elster (&) · J. Komárek Institute of Botany, Academy of Sciences of the Czech Republic, Tlebok, Czech Republic e-mail: [email protected] J. Elster e-mail: [email protected] O. Strunecký · J. Elster · J. Komárek Faculty of Science, University of South Bohemia, Beské Bud5jovice, Czech Republic

trichomes, it is most similar and thus probably belongs to the genus Microcoleus. Keywords Cyanobacteria · Phormidium · 16s rDNA gene · Arctic · Antarctic · Geographical distribution

Introduction Cyanobacteria are widely distributed in aquatic and terrestrial environments, including extreme habitats (Whitton and Potts 2000). They play a key role in Arctic and Antarctic ecosystems as primary producers (e.g. Friedmann 1993; Elster 2002; Elster and Benson 2004). Cyanobacteria are well adapted to prolonged freezing (Sabacká and Elster 2006), exhibiting activity even at temperatures as low as ¡20°C (Vincent et al. 2004). Filamentous types from the order Oscillatoriales, especially strains from the genus Phormidium Kützing ex Gomont 1892, have widely diverse morphotypes and often dominate in aquatic microbial mats and in soils (e. g. Broady 1996; Elster et al. 1997, 1999; Komárek et al. 2008). Despite the evident importance of oscillatorialean cyanobacteria in polar areas, there are yet only surprisingly few taxonomic studies focussing on phytogeographical comparisons of Arctic, Antarctic and other strains of the genus Phormidium (Casamatta et al. 2005; Comte et al. 2007). In Antarctica, the most isolated continent, the issue of endemic cyanobacteria is the subject of many debates (Mullins et al. 1995; Wilmotte et al. 1997; Komárek 1999; Nadeau et al. 2001; Komárek et al. 2008). Various factors could be involved in the long-range dispersion of microorganisms between and across the polar regions, such as atmospheric circulation, which can transfer spores or even cells over large distances (Elster et al. 2007; Gonzáles-Toril

123

1420

et al. 2009), as well as bird migrations and human activities (Frenot et al. 2005). The cyanobacterial species Phormidium autumnale (sensu lato) has a unique morphological diversity. It is generally characterized by simple, cylindrical, isopolar, nonbranched Wlaments without any heterocytes and akinetes, forming irregular clusters or colonies with more or less parallel-oriented trichomes. Several species (morphospecies and ecospecies) have been described based on a number of diacritical features, particularly the width of trichomes, length of cells and cell length/cell width ratio, length of the narrowed terminal segment of the trichome, colour of cells, and presence and shape of the terminal calyptra. A list of morphospecies is reviewed in Komárek and Anagnostidis (2005), with special focus on the morphological “Phormidium group VII” containing Ph. autumnale, a species which is common in numerous polar microhabitats. In other collections, many strains are also designated as “Ph. autumnale”, but these strains represent a wide spectrum of various ecotypes and not all are part of the morphological range of Ph. autumnale. Furthermore, their morphological variability is very pronounced, and the morphological changes and anomalies occurring in strains that have been cultured for a long time in vitro complicate the classiWcation and the understanding of the diversity of this group. In order to overcome some of these problems and to permit the identiWcation of Phormidium populations at the genetic level, we have studied the variation of the 16S rRNA gene in strains from a variety of geographical areas. The goal of this research is phytogeographical comparisons of polar (Arctic and Antarctic) and non-polar strains, which would help us to understand the phylogenetic relationship of oscillatorialean species (Phormidium) in relation to the worldwide distribution. To achieve this, we employed a polyphasic approach, combining phenotypic and genotypic characterizations (Turner et al. 1999; Wilmotte and Herdman 2001). In this paper, 26 Phormidium strains from various polar regions, such as the Arctic and subarctic: Svalbard—Ny-Ålesund and Hornsund vicinity, Norway, Ellesmere Island—Sverdrup Pass, Canada and Northern Sweden—Abisko; the Antarctic: James Ross, Vega and King George Island, as well as several temperate regions were compared. The diVerences between the ubiquity and/ or endemism and circumpolar distribution of Arctic and Antarctic Wlamentous cyanobacteria are discussed.

Materials and methods Sampling sites and strain preparation Phormidium specimens were collected from various localities of northern and southern polar habitat types (Table 1).

123

Polar Biol (2010) 33:1419–1428

The samples were transported frozen to the laboratory. A small quantity of each sample was placed on a Petri dish with agar (solid medium with 1.5% agar containing the mineral nutrient medium BG-11; Rippka et al. 1979). The dilution plate method was used for isolation and culturing of cyanobacteria (Elster et al. 1999). This method was repeated several times to obtain isolated unialgal strain colonies. The Petri dishes were placed in an illuminated refrigerator (90 mol m¡2 s¡1 = cca. 20 W m¡2 PAR, temperature 5–8°C) with a light regime of 18 h of white Xuorescent light, 2 h of UV-B radiation, and 4 h of darkness. The germicidal lamps sterilized the cultivation box repeatedly (UV-B radiation did not penetrate through the glass dish). After a few days of cultivation, visible colonies of Phormidium were observed and separately transferred to sterile agar tubes. Subsequently, pure strains (unialgal with low bacterial contamination) were cultured at a temperature of 6°C and light of 30 mol m¡2 s¡1. In addition to these newly isolated strains, Phormidium strains obtained from CCALA (Culture collection of Algae at the Laboratory of Algology, Tlebok, Czech Republic—http://www.butbn. cas.cz/ccala/index.php) were also used in the study. All newly isolated strains were allocated to the CCALA. The cultivated strains were identiWed according to Anagnostidis and Komárek (1990) and Komárek and Anagnostidis (2005). Strain morphologies were analysed using a Leica DM 2500 light microscope (Leica Microsystems GmbH, Wetzlar, Germany). Photomicrophotographs were taken with an ARTCAM 300MI 3Mpxl CMOS USB 2.0 Camera (Artray Co., Tokyo, Japan), equipped with Quick PHOTO MICRO 2.1 software. The lengths and widths of at least 70 cells were measured for each Phormidium strain under 100£ magniWcation. The strains originating from CCALA with previously sequenced and published 16S rRNA genes: CCALA 143, 144, 145, 697 (Comte et al. 2007; Marquardt and Palinska 2007; Palinska and Marquardt 2008) were compared and used for phylogenetic analyses. Molecular analyses For DNA extraction, 100 mg of cultivated cells was used. Cyanobacterial Wlaments were transferred to autoclaved 2-ml Eppendorf tubes containing 0.1 ml of 1% sarkosyl (l-lauroylsarcosine), 0.3 ml of 3 M guanidium thiocyanate (Sigma–Aldrich, St. Louis, USA), and a supplement of 2 g of 1-mm-diameter glass beads. The sample was mixed for 15 min in a shaker, incubated for 30 min at 55°C and again shaken for 15 min. Total DNA was precipitated using the phenol–ethanol method (Sambrook et al. 1989). The 16S rRNA gene with the 16S–23S intergenetic segment was ampliWed using the primers 27F (AGAGTTTGATCMTG GCTCAG) and 23S30R (CTTCGCCTCTGTGTGCCTAG

62°10⬘ S, 58°30⬘ W 77°00⬘ 15°20⬘E

CCALA 726

CCALA 145

CCALA 816

CCALA 144

CCALA 884

CCALA 847

CCALA 697

CCALA 849

Phormidium sp.

Phormidium cf. autumnale


Phormidium setchellianum


Phormidium sp.

Phormidium autumnale

Phormidium cf. uncinatum

CCALA 856

CCALA 857

CCALA 853

CCALA 152

CCALA 143

CCALA 757

CCALA 850

CCALA 140

CCALA 147

CCALA 843




Phormidium subfuscum

Phormidium autumnale



Phormidium animale

Phormidium cf. nigrum

Phormidium cf. murrayi

CCALA 851


63°50⬘ S, 57°50⬘ W

CCALA 852

CCALA 854

Phormidium cf. murrayi

CCALA 815


69°21⬘N, 18°49⬘E

CCALA 848


Phormidium cf. irrigum

77°00⬘N 15°20⬘E

62°10⬘ S, 58°30⬘ W

63°50⬘ S, 57°50⬘ W

63°50⬘ S, 57°50⬘ W

63°50⬘ S, 57°50⬘ W

63°50⬘ S, 57°50⬘ W

63°50⬘ S, 57°50⬘ W

62°10⬘ S, 58°30⬘ W

77°00⬘N 15°20⬘E

77°00⬘N 15°20⬘E

CCALA 846

CCALA 845

Phormidium sp.

Phormidium sp.

69°21⬘N, 18°49⬘E

79°08⬘ N, 80°30⬘ W

69°21⬘N, 18°49⬘E

79°58⬘ N, 11°21⬘ E

CCALA 149

Phormidium cf. setchellianum

Latitude/longitude

Number

Strain

Antarctica, King George Isl.

Europe, Czech Republic, greenhouse in Sumperk

Europe, Italy, crater of the volcano Vesuvius

Antarctica, Vega Island, Lake Esmeralda

Asia, China, Hubei province, Wuhan city

Europe, Slovakia, Topolbany

Europe, Germany, Hamburg

Antarctica, James Ross Isl.


Antarctica, Vega Isl.




Northern Sweden, Abisko

Arctic, Svalbard, Hornsund



Subarctic, Northern Sweden, Abisko

Arctic, Ellesmere Isl., Sverdrup Pass



Europe, Switzerland, TuVenwies

Subarctic, Northern Sweden, Abisko

Europe, Switzerland, Valley Verzascatal

Arctic, Svalbard, Ny-Ålesund

Europe, Germany, Hamburg, ‘Alte Suder Elbe’

Location

Table 1 Taxonomic assignment and origin of the cyanobacterial strains examined in this study

Aerophytic, whale skeleton

Periphyton, tropical aquarium

Soil

Periphyton, lake littoral

Periphyton, rice Weld

Periphyton, oxidation pond

Periphyton in river ‘Alte Suder Elbe’

Periphyton, Algal creak

Periphyton, Komarek’s seepage, mats on sand

Periphyton, Esmeralda Lake, littoral

Periphyton, Komarek’s seepage, black-green bioWlm on rocks

Periphyton, seepage, black bioWlm

Periphyton, Komarek’s seepage, black bioWlm

Periphyton, black-brown mats on wetted rock

Periphyton, shallow lake on sea terrace

Periphyton in stream

Elster et al. (2008), Kovábik

Gardavský

Hindák

Komárek et al. (2008), Knokhousová et Elster

Cepák

Marvan

Palinska and Marquart (2008)

Marvan












Periphyton in glacial stream, wetted rock Periphyton in stream

Elster et al. (1999), Comte et al. (2007), Elster

Kantovská et al. (2006), Knokhousová et Elster

Elster et al. (2008), Kovábik

Zehnder


Knokhousova at Elster

Zehnder


Kubebková et al. (2001), Kubebková

Marvan

Reference/isolator

Periphyton in glacial stream

Periphyton in littoral of lake

Aerophytic, whale skeleton on sea beach

Periphyton, experimental trough of EAWAG


Periphyton in stream


Periphyton in river

Habitat

Polar Biol (2010) 33:1419–1428 1421

123

1422

GT) (Wilmotte et al. 1993) with the following settings: a starting denaturalization step (94°C, 5 min); 40 cycles of 30 s at 94°C, 30 s at 55°C, and 3 min at 72°C; Wnal extension for 7 min at 72°C and cooling to 4°C. A successful PCR was conWrmed by running a subsample on a 1.5% agarose gel stained with ethidium bromide. PCR products were puriWed using a QIAquick PCR PuriWcation Kit (Qiagen, Düsseldorf, Germany). Sequencing of the 16S rRNA gene fragment was performed with four primers (CYA106F— CGGACGGGTGAGTAACGCGTGA; CYA781R—GAC TACTGGGGTATCTAATCCCATT (Nübel et al. 1997); CYA783F—TGGGATTAGATACCCCAGTAGTC, this study; and S17*—GGCTACCTTGTTACGAC (Wilmotte and Herdman 2001)) to obtain complementary sequences on an ABI 3100 sequencer using BD3.1 (Applied Biosystems, Foster City, USA) chemistry. Phylogenetic analysis The sequences were aligned by means of ClustalW (version 1.74) and reWned manually with BioEdit (version 7.0.1) (Hall 1999). Each sequence was subjected to a BLAST search (http://www.ncbi.nlm.nih.gov/blast), and the ten most corresponding sequences were selected for further study. Duplicate sequences from Genbank were excluded, as well as sequences which were assigned to cyanobacteria of the oscillatorialean group. Sequences of unknown place of origin were excluded as well. Representative sequences of other Phormidium and Microcoleus strains according to the published genus determination (Casamatta et al. 2005; Taton et al. 2006; Siegesmund et al. 2008) were added to the alignment. The phylogenetic tree was computed by Mega 4.0.2 (Tamura et al. 2007) using the maximum composite likelihood model within neighbours, joining this method with pairwise deletion option. Nucleotide sequence accession numbers Nucleotide sequences have been deposited in the Genbank database under the accession numbers GQ504017– GQ504037.

Results Morphological characteristics The microscopic observation of the morphology of the 26 studied strains (Fig. 1) conWrmed their relationship to the order Oscillatoriales, more speciWcally to the genus Phormidium. DiVerent morphospecies of the Ph. autumnale group are often strictly limited ecologically, and this was reXected in their determination; the typical Ph. autumnale

123

Polar Biol (2010) 33:1419–1428

sensu stricto (benthos of streaming mesotrophic waters in Central Europe), Ph. vulgare (soils), reddish-coloured Ph. setchellianum (mountain cold and stenotherm oligotrophic springs and streams), Antarctic Ph. attenuatum (subaerophytic on organic substrates), Ph. pseudopriestleyi (seepages) and other biotopes were projected into investigated types. However, similar morphotypes are known from many other habitats throughout the world, and their identiWcation is diYcult. Moreover, during microscopic observations, it was noted that the long-term cultivated strains CCALA 140, CCALA 143, CCALA 144, and CCALA 145 may have become distorted over the years of cultivation. Characters of individual strains and cell dimensions are shown in Fig. 1 and Table 2. Phylogenetic analysis For examining the molecular phylogeny, 22 sequenced strains were combined with the four strains studied by previous authors (Table 1). For the phylogenetic analysis, a fragment of approximately 925 nt was used (corresponding to E. coli K12 16S rRNA residues 269–1,215). The resulting phylogenetic tree (Fig. 3) revealed 4 distinct clusters. A sequence identity matrix (data not shown) showed that there was only a 3% diVerence in 16S rDNA among the most diverse strains within cluster I. The nucleotide composition of clusters II and III diverges from the strains of cluster I by 6–7% and 7–8%, respectively. The nucleotide composition of sequences among cluster IV diVers from cluster I by 10% and from both clusters II and III by 11%. These results indicate a distinct phylogenetic separation between cluster IV and the remaining Phormidium (and Oscillatoriales). Description of clusters The morphological parameters of strains, widths of trichomes, and cell width-to-cell length ratios are shown in Table 2. Cluster Ia included the strains CCALA 144, 145, 149, and 816, which were identical according to 16S rRNA gene sequences; the 16S rRNA gene sequence of CCALA 726 was slightly diVerent from that of the other strains of cluster Ia, but only by 0.5%. The trichomes of European strains CCALA 144, 145, and 149 were the thinnest in our set, with trichome widths of about 3 m compared with the overall average of 5.4 m; trichomes with isodiametric cells were attenuated to the calyptra. The morphology of the European strain CCALA 816 was similar to that of the other strains in the Ia cluster, except for the presence of wider trichomes. The European strain CCALA 726 had wider trichomes, and moreover, it did not form any calyptra. All strains in the cluster Ia were green, except for CCALA 816, which was brown. Strain CCALA 844, in

Polar Biol (2010) 33:1419–1428

1423

Fig. 1 Diversity of cyanobacterial morphospecies of studied strains. a Ph. cf. setchellianum CCALA 149, b Ph. sp. CCALA 726, c Ph. cf. autumnale CCALA 145, d Ph. cf. autumnale CCALA 816, e Ph. setchellianum CCALA 144, f Ph. cf. autumnale CCALA 884, g Ph. sp. CCALA 847, h Ph. autumnale CCALA 697, i Ph. cf. uncinatum CCALA 849, j Ph. sp. CCALA 846, k Ph. sp. CCALA 845, l Ph. cf. autumnale CCALA 848, m Ph. cf. irrigum CCALA 815, n Ph. cf. mur-

rayi CCALA 852, o Ph. cf. autumnale CCALA 854, p Ph. cf. autumnale CCALA 851, q Ph. cf. autumnale CCALA 856, r Ph. cf. autumnale CCALA 857, s Ph. cf. autumnale CCALA 853, t Ph. subfuscum CCALA 152, u Ph. autumnale CCALA 143, v Ph. cf. autumnale CCALA 757, w Ph. cf. autumnale CCALA 850, x Ph. animale CCALA 140, y Ph. cf. nigrum CCALA 147, z Ph. cf. murrayi CCALA 843. Scale represents 10 m to all strains

another branch of the Ia cluster, had brownish trichomes which were morphologically very similar to those of the strain CCALA 726, though this strain diVered in geograph-

ical origin (Antarctic strain). Cluster Ib included six studied strains, all of Arctic and subarctic origin. Trichome widths ranged from 2.5 m up to Wlaments 7.1 m wide. The Ib

123

1424

Polar Biol (2010) 33:1419–1428

Table 2 Morphological parameters of studied strains Strain #

Cell SD Width/length width ratio

SD Colour

Cluster #

CCALA149

2.8

0.6

1.2

0.4

Green

Ia

CCALA726

6.2

1.0

0.6

0.2

Blue-green

Ia

CCALA145

3.0

0.9

1.0

0.3

Green

Ia

CCALA816

7.1

0.7

0.8

0.2

Green

Ia

CCALA144

2.6

0.5

0.9

0.2

Blue-green

Ia

CCALA844

3.5

0.9

1.0

0.4

Brown

Ia

CCALA847

5.7

0.8

0.4

0.2

Brown

Ib

CCALA697

5.9

0.6

2.1

0.6

Blue-green

Ib

CCALA849

7.1

0.9

0.4

0.1

Brown

Ib

CCALA846

2.5

0.9

0.4

0.3

Green

Ib

CCALA845

6.6

1.1

0.6

0.2

Brown-green Ib

CCALA848

6.4

0.6

0.5

0.1

Green

CCALA815

5.0

0.7

2.0

0.5

Blue-green

Ic

CCALA852

5.6

0.9

0.7

0.3

Brown

Ic

CCALA854

6.3

0.9

0.6

0.2

Green

Id

CCALA851

8.2

0.7

0.5

0.3

Green

Id

CCALA856

3.0

0.4

0.6

0.2

Green

Id

CCALA857

5.0

0.5

0.9

0.2

Green

Id

CCALA853

5.9

0.7

0.4

0.2

Green

Id

CCALA152

5.5

0.8

0.6

0.2

Blue-green

Id

CCALA143

8.2

1.3

0.6

0.2

Blue-green

Id

CCALA757

6.3

0.8

0.5

0.1

Green

Id

CCALA850

5.8

0.9

0.6

0.2

Blue-green

II

CCALA140

2.2

0.3

0.9

0.3

Blue-green

II

CCALA147

4.3

0.8

0.5

0.2

Blue-green

III

CCALA843

3.2

1.0

0.5

0.1

Green

IV

Ib

The cell width and cell width-to-cell length ratios. Also, the position in phylogenetic tree (Fig. 3) is indicated

cluster is divided into two subclusters: the Wrst one included two strains: CCALA 847 with brownish trichomes ending in a calyptra, and the blue-green CCALA 697 with a rounded apical cell. The second subcluster of this clade contained typical strains of Phormidium autumnale with a calyptra as well as the strain CCALA 845 with no calyptra. Cluster Ic contained two sequences. Trichomes of CCALA 815 (European strains) were among the wider types, while trichomes of CCALA 852 (Antarctic strain) were among the slimmest within our studied strains of Phormidium. Clade Id included all sequences with an 11-bp insert within the 16S rRNA gene. Green trichomes of two strains of Antarctic origin, CCALA 854 and 851, were slightly narrowed towards the ends, and their apical cells were spherical. The 16S rRNA gene sequences of the strains CCALA 853, 856, and 857 were identical. However, the morphology of these strains were diVerent, all strains within this cluster originated from the area of Antarctic Peninsula. The cells of the strains CCALA 856 and 853 were wider than longer,

123

while the cells of 857 were isodiametric. All trichomes narrowed towards their ends; trichomes of the strain 853 were twisted, calyptra was present in the strains 856 and 857, but not in 853. Two other strains from the Id cluster were of European origin, CCALA 143 and 152, and one, CCALA 757, came from Asia. Cells of these strains were generally wider than longer. The trichomes were of uneven shape; their widths varied along the Wlaments, and the trichomes were constricted at their cross walls. The apical cells of the strains 757 and 152 contained noticeable granules inside. Cluster II contained Ph. animale CCALA 140 and Ph. cf. autumnale CCALA 850, strains of European and Antarctic origin, respectively. The strain CCALA 140 had the thinnest trichomes, though of uneven thickness, with a mean width of 2.2 m. Trichomes of the strain CCALA 850 had cells of regular width, wider than longer. Both strains had extraordinarily Wn-like apical cells. Cluster III, with the green Ph. cf. nigrum CCALA 147, was acquired from a tropical aquarium with Wsh of unknown origin. Its trichomes had the most atypical shape of the studied set of strains, with a screw-like shape that coiled and entangled with one another. The apical cells were cylindrical, with Xat or very slightly rounded ends. The cells were short, between 1 and 3 m in length. Cluster IV contained Ph. cf. murrayi CCALA 843 only, collected on whale bones at King George Island, Antarctica. Its Wlaments were regular, straight or slightly curved, with a sheath, and forming a mat in culture. The trichomes were very slightly constricted at the cross walls, not tapering to their ends, the apical cells were rounded, without a terminal calyptra.

Discussion The Ph. autumnale complex is an important component of numerous ecosystems, and more detailed knowledge of its diversity is urgent. Variability of Ph. autumnale under natural conditions has been previously studied several times (Bosli-Pavoni 1970; Komárek 1972) but these studies only described the variation in terms of their unique ecological situations. Because the majority of cyanobacterial genotypes are restricted both ecologically and morphologically, an elucidation of the diversity of this cosmopolitan and widely distributed morphotype was expected to be obtained from molecular studies. However, such studies (Turner et al. 1999; Nübel et al. 2000; Nadeau et al. 2001; Taton et al. 2006) have so far shown that variation also exists in 16S rDNA throughout the group and cannot yet provide a good explanation of correlations or coincidences between natural phenotypes and ecotypes, and their genetic background. We selected a set of strains from the taxonomic

Polar Biol (2010) 33:1419–1428

1425

Fig. 2 Sampling sites of the cyanobacterial strains examined in this study

vicinity of Ph. autumnale, particularly those isolated from both polar regions, and compared them with non-polar strains. We evaluated the morphology of 26 strains with partial 16S rDNA sequences in order to Wnd combined relationships among various strains. Sequencing of a 925-bp region of the 16S rRNA gene revealed several general characteristics of the constructed clusters. However, our analysis was only able to Wnd diVerences between the strains; to further explain identities within the strains, the sequence of 16S–23S ITS or more genes would have to be included. The almost-identical 16S rDNA sequences which have been submitted to Genbank from both uncultured cyanobacteria and bacteria (Taton et al. 2003; Cadel-Six et al. 2007; Mosier et al. 2007) enabled us to identify the geographical distribution of Phormidium strains within our study. The results from sequencing also indicate that some sequences of strains uploaded to Genbank may have been misclassiWed, as already stated by Komárek (2008) (Fig. 2). The grouping of strains into clusters was in good agreement with their geographical origin (see Fig. 3). Several clusters had complete sequence identity in the 925-bp region of the 16s rDNA, one contained polar strains (CCALA 853, 856, 857) belonging to one geographical area, James Ross Island. One set of strains (part of Ia cluster) consisted of the strains within a large area such as the entire European continent. On the other hand, some clusters (such as the Microcoleus vaginatus cluster) were grouped on the basis of a close genetic 16S rDNA similarity of more than 99%, even though the strains within the cluster originated from Europe and tropic/North America (compared with Genbank data). No cluster within our set of strains

joined with Genbank sequences included strains from both (north and south) polar areas. We found only two sequences that were identical with 16S rRNA gene sequences from Genbank—the Antarctic strain CCALA 843 and the Mediterranean strain CCALA 152 (Ph. subfucsum) from Vesuvius, the 16s rRNA gene sequences of which were identical with a sequence of an uncultured soil bacterium from Romanian oil Welds. Considering the unclear status of some Phormidium species, we propose that Ph. cf. nigrum CCALA 147 should more likely belong to the genus Arthrospira. Similarly, Suda et al. (2002) assigned the strain CCAP 1459/11B as the type strain of Tychonema bourrellyi which was clustering with the strain Ph. cf autumnale CCALA 852. For this reason, Ph. cf autumnale CCALA 852 belonged according to 16S rDNA to the core Ph. autumnale clusters from our study. In addition, our strain was morphologically not diVerent from Suda’s et al. (2002) photomicrographs of the strain CCAP 1459/11B. It is more likely that both strains belonged to the Ph. autumnale group. The Antarctic strain CCALA 843, which was originally determined as Ph. murrayi, came to a close vicinity of the Arthronema-Limnothrix-Pseudanabaenaceae clade. The blast search reported that this strain had an identical 16S rRNA gene sequence as Limnothrix redekei CCAP 1443/1, which originated from north-west Europe. Many other sequenced strains of Limnothrix sp. (Suda et al. 2002) and Phormidium. sp. (Nadeau et al. 2001) belonged to this clade, together with Pseudanabaena sp. (Rippka et al. 1979; Ishida et al. 2001) and Arthronema sp. (Casamatta et al. 2005) from both hemispheres. Even though the

123

1426

Polar Biol (2010) 33:1419–1428

Fig. 3 Phylogenetic relationships of Phormidium and Phormidium-like cyanobacteria estimated by neighbour-joining of 16S rRNA gene. Original sequences from this study are in bold. The symbols denote the following: Wlled circle European, Wlled diamond Antarctic, Wlled triangle Arctic, open square American and open circle other temperate zones origin. The origin of species without symbol is unknown. The evolutionary distances were computed using the maximum composite likelihood method, and values indicate nodes with bootstrap values higher than 50%

Ph. cf. setchellianum CCALA149 Ph. sp. CCALA726 Ph. autumnale CCAP 1462/6 AM778719 97

Ph. cf. autumnale CCALA816 Ph. cf. autumnale CCALA145 Ph. setchellianum CCALA144

Ia

Ph. autumnale SAG 78.79 16S AM778717 59

Ph. cf. autumnale CCALA844 Oscillatoria sp. Ant-G16 AF263333 Uncultured cyanob. RD065 DQ181772 Ph. autumnale Ant-Ph68 DQ493874

56

Ph. autumnale CCAP 1462/10 AM398959 92 99

Ph. sp. CCALA847 Ph. autumnale CCALA697 Oscillatoria sp. E17 1AF263338 Ph. cf. uncinatum CCALA849

Ib

Ph. sp. CCALA846

79

Ph. sp. CCALA845

92

Ph. cf. autumnale CCALA848 Ph. cf. irrigum CCALA815 Ph. cf. autumnale CCALA852

73

Ic

Tychonema bourrellyi CCAP 1459/11B AB045 Uncultured b. ANTLV2 A01 DQ521503 Ph. cf. autumnale CCALA854

86

Ph. sp. Ant-Skua AF263341 Ph. sp. Ant-Lunch AF263335 Ph. cf. autumnale CCALA851

81

Ph. sp. Ant-Orange AF263336 Ph. cf. autumnale CCALA857 97

Ph. cf. autumnale CCALA853

100

Ph. cf. autumnale CCALA856

Id

Uncultured soil b. M37 DQ378254.1

98

Ph. subfuscum CCALA152 Microcoleus vaginatus PCC 9802 AF284803

56 61

Oscillatoria sp. PCC 7112 EF178274 Microcoleus vaginatus SAG 2211 EF654074. 86

Ph. cf. autumnale CCALA757 Oscillatoria sp. 195-A20 EU282430

51 80

Ph. autumnale CCALA143 Microcoleus antarcticus UTCC 474 AF21837

74

Microcoleus rushforthii UTCC 296 AF21837 Oscillatoria sp. Ant-G17 AF263334

96 60

Ph. pseudopristleyi ANT.ACEV5.3 AY493629 Ph. lumbricale UTCC 476 1AF218375

100

II

Ph. cf. autumnale CCALA850 Ph. cf. terebriformis KR2003/25 AY575936

63 69

Ph. animale CCALA140 Microcoleus chthonoplastes EBD EF654031

100 55

Microcoleus chthonoplastes MEL EF654038 Microcoleus glaciei UTCC 475 AF218374 Ph. uncinatum SAG 81.79 AM398953

III

Arthrospira fusiformis AICB665 AY672720

100

Arthrospira platensis SAG 257.80 DQ39328 Ph. autumnale UTEX 1580 AM778713 83

Ph. cf. nigrum CCALA147 Pseudanabaena sp. 0tu30s18 AM259268 Arthronema gygaxiana UTCC 393 AF218370

100

Limnothrix sp. MR1 AJ580008

98

Limnothrix redekei CCAP 1443/1 AJ580007

94 0.01

123

99

Ph. cf. murrayi CCALA843

IV

Polar Biol (2010) 33:1419–1428

generic relationships in this cluster are still unclear, it is apparent that this entire group forms another clade-Ph. murrayi and does not belong to group VII Phormidium (Komárek and Anagnostidis 2005), which is conWrmed by their strains morphology. Our results showed a close molecular clustering of similar strains isolated from neighbour areas, the Phormidium autumnale cluster belonging apparently to generic entities in which the geographical limitation plays a prominent role. We have also found an 11-bp insert in loop six of the 16S rRNA gene (bp 423–433) (Boyer et al. 2002) within the strains CCALA 851, 856, 857, 853, 152, 143, and 757. This insert was originally described by Garcia-Pichel et al. (2001) in Microcoleus vaginatus and has been assigned so far to strains probably belonging to the Microcoleus clade (Rudi and Jakobsen 1997; Nadeau et al. 2001). Branching of Microcoleus-Phormidium strains with this 11-bp insert was characteristic of a constructed phylogenetic tree which created a semi-separate clade. Therefore, the Phormidium autumnale cluster is evidently a very characteristic type and represents an isolated clade within the traditional genus Phormidium. According to morphological features and the structure of trichomes, it is most similar to Microcoleus, especially when considering the 11-bp insert; and probably belongs to one generic unit. We were unable to show genetic identity of Phormidium-like strains from the north and south polar regions on the basis of 16S rDNA. However, the fact that the cyanobacterial strains from Europe studied by us were associated with Phormidium clusters from both polar areas suggests that the geographical areas of at least some Phormidiumlike cyanobacteria intersect. To resolve this problem, more Phormidium-like cyanobacteria need to be included in future studies employing more detailed genetic analyses. Acknowledgments We would like to thank the Ministry of Education of the Czech Republic (Kontakt ME 934, ME 945, INGO LA 341 and MEB 080822) for funding our research. We are very grateful to Mrs. Jana Knokhousová for her technical assistance. Finally, we highly acknowledge the insightful comments of the reviewers that have signiWcantly improved our paper.

References Anagnostidis K, Komárek J (1990) Modern approach to the classiWcation system of Cyanophytes 5–Stigonematales. Arch Hydrobiol/ Algolog Stud 59:1–73 Bosli-Pavoni M (1970) 9ber die Verteilung von Phormidien in ModellXiessgewässern. Schweiz Z Hydrol 32:486 Boyer SL, Johansen JR, Flechtner VR (2002) Phylogeny and genetic variance in terrestrial Microcoleus (Cyanophyceae) species based on sequence analysis of the 16S rRNA gene and associated 16S– 23S ITS region. J Phycol 38:1222–1235 Broady PA (1996) Diversity, distribution and dispersal of Antarctic terrestrial algae. Biodiv Conserv 5:1307–1335

1427 Cadel-Six S, Peyraud-Thomas C, Brient L, de Marsac NT, Rippka R, Mejean A (2007) DiVerent genotypes of anatoxin-producing cyanobacteria coexist in the Tarn River, France. Appl Environ Microbiol 73:7605–7614 Casamatta DA, Johansen JR, Vis ML, Broadwater ST (2005) Molecular and morphological characterization of ten polar and near-polar strains within the Oscillatoriales (Cyanobacteria). J Phycol 41:421–438 Comte K, Sabacka M, Carre-Mlouka A, Elster J, Komarek J (2007) Relationships between the Arctic and the Antarctic cyanobacteria; three Phormidium-like strains evaluated by a polyphasic approach. FEMS Microbiol Ecol 59:366–376 Elster J (2002) Ecological classiWcation of terrestrial algal communities of polar environment. In: Beyer L, Boelter M (eds) Ecological studies. Springer, Heidelberg, pp 303–319 Elster J, Benson EE (2004) Life in the polar terrestrial environment a focus on algae and cyanobacteria. In: Fuller B, Benson EE (eds) Life in the frozen state. Taylor and Francis, London, pp 111–149 Elster J, Svoboda J, Komárek J, Marvan P (1997) Algal and cyanoprocaryote communities in a glacial stream, Sverdrup Pass, 79oN, Central Ellesmere Island, Canada. Arch Hydrobiol/Suppl Algol Studies 85:57–93 Elster J, Lukesova A, Svoboda J, Kopecky J, Kanda H (1999) Diversity and abundance of soil algae in the polar desert, Sverdrup Pass central Ellesmere Island. Polar Rec 35:231–254 Elster J, Delmas RJ, Petit JR, Rehaková K (2007) Composition of microbial communities of aerosol, snow and ice samples from remote glaciated areas (Antarctica, Alps, Andes). Biogeosci Discuss 4:349–384 Elster J, Degma P, Kovábik F, Valentová L, Krámková K, Pereira AB (2008) Freezing and desiccation injury resistance in the Wlamentous green alga Klebsormidium from the Antarctic, Arctic and Slovakia. Biologia 63(6):839–847 Frenot Y, Steven L, Chown A, Whinam J, Selkirk PM, Convey P, Skotnicki M, Bergstrom DM (2005) Biological invasions in the Antarctic: extent, impacts and implications. Biol Rev Camb Philos Soc 80:45–72 Friedmann EI (ed) (1993) Antarctic microbiology. Wiley, New York Garcia-Pichel F, Lopez-Cortes A, Nubel U (2001) Phylogenetic and morphological diversity of cyanobacteria in soil desert crusts from the Colorado plateau. Appl Environ Microbiol 67:1902– 1910 Gonzáles-Toril E, Amils R, Delmas RJ, Petit JR, Komárek J, Elster J (2009) Bacterial diversity of autotrophic enriched cultures from remote, glacial Antarctic, Alpine and Andean aerosol, snow and soil samples. Biogeoscience 6:33–44 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95–98 Ishida T, Watanabe MM, Sugiyama J, Yokota A (2001) Evidence for polyphyletic origin of the members of the orders of Oscillatoriales and Pleurocapsales as determined by 16S rDNA analysis. FEMS Microbiol Lett 201:79–82 Kastovská K, Stibal M, Sabacká M, Cerná B, Santrucková H, Elster J (2006) Microbial community structure and ecology of subglacial sediments in two polythermal Svalbard glaciers characterized by the epiXuorescence microscopy and PLFA. Polar Biol 30(3):277–287 Komárek J (1972) Temperaturbedingte morphologische Variabilität bei drei Phormidium -Arten in Kulturen. Preslia 44:293–307 Komárek J (1999) Diversity of cyanoprokaryotes (cyanobacteria) of King George Island, maritime Antarctica–a survey. Arch Hydrobiol/Algolog Stud 94:181–193 Komárek J (2008) Recent changes in cyanobacterial taxonomy based on combined molecular, phenotype and ecological consequences. In: The Bat Sheva de Rotschild Seminar on Phytoplankton in the Physical Environment, 15th workshop IAP

123

1428 Komárek J, Anagnostidis K (2005) Cyanoprokaryota -2. Teil/2nd Part: Oscillatoriales, SüsswasserXora von Mitteleuropa 19/2 edn. Elsevier/Spektrum, Heidelberg Komárek J, Elster J, Komárek O (2008) Diversity of cyanobacterial microXora of the northern part of James Ross Island, NW Weddell Sea, Antarctica. Polar Biol 31:853–865 Kubecková K, Elster J, Kanda H (2001) Periphyton ecology of glacial and snow-fed streams, Ny-Ålesund, Svalbard:the inXuence of discharge disturbances due to sloughing, scraping and peeling. In: Elster J et al (eds) Proceedings of international conference—algae and extreme environments—ecology and physiology, Nova Hedvigia, Beiheft 123:141–172 Marquardt J, Palinska KA (2007) Genotypic and phenotypic diversity of cyanobacteria assigned to the genus Phormidium (Oscillatoriales) from diVerent habitats and geographical sites. Arch Microbiol 187:397–413 Mosier AC, Murray AE, Fritsen CH (2007) Microbiota within the perennial ice cover of Lake Vida, Antarctica. FEMS Microbiol Ecol 59:274–288 Mullins T, Britschgi TB, Krest RL, Giovannoni SJ (1995) Genetic comparisons repeal the same unknown bacterial linages in Atlantic and PaciWk bacterioplankton communities. Limnol Oceanogr 40:148–158 Nadeau TN, Milbrandt EC, Castenholz RW (2001) Evolutionary relationships of cultivated Antarctic oscillatorians (cyanobacteria). J Phycol 37:650–654 Nübel U, Garcia-Pichel F, Muyzer G (1997) PCR primers to amplify 16S rRNA genes from cyanobacteria. Appl Environ Microbiol 63:3327–3332 Nübel U, Garcia-Pichel F, Clavero E, Muyzer G (2000) Matching molecular diversity and ecophysiology of benthic cyanobacteria and diatoms in communities along a salinity gradient. Environ Microbiol 2:217–226 Palinska K, Marquardt J (2008) Genotypic and phenotypic analysis of strains assigned to the widespread cyanobacterial morphospecies Phormidium autumnale (Oscillatoriales). Arch Microbiol 189:325–335 Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier RY (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111:1–61 Rudi K, Jakobsen KS (1997) Cyanobacterial tRNA(Leu)(UAA) group I introns have polyphyletic origin. FEMS Microbiol Lett 156:293–298 Sabacká M, Elster J (2006) Response of cyanobacteria and algae from Antarctic wetland habitats to freezing and desiccation stress. Polar Biol 30:31–37

123

Polar Biol (2010) 33:1419–1428 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, New York Siegesmund MA, Johansen JR, Karsten U, Friedl T (2008) Coleofasciculus gen. nov. (Cyanobacteria): morphological and molecular criteria for revision of the genus Microcoleus Gomont. J Phycol 44:1572–1585 Suda S, Watanabe MM, Otsuka S, Mahakahant A, Yongmanitchai W, Nopartnaraporn N, Liu Y, Day JG (2002) Taxonomic revision of water-bloom-forming species of oscillatorioid cyanobacteria. Int J Syst Evol Microbiol 52:1577–1595 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Taton A, Grubisic S, Brambilla E, de Wit R, Wilmotte A (2003) Cyanobacterial diversity in natural and artiWcial microbial mats of Lake Fryxell (McMurdo Dry Valleys, Antarctica): a morphological and molecular approach. Appl Environ Microbiol 69:5157– 5169 Taton A, Grubisic S, Balthasart P, Hodgson DA, Laybourn-Parry J, Wilmotte A (2006) Biogeographical distribution and ecological ranges of benthic cyanobacteria in East Antarctic lakes. FEMS Microbiol Ecol 57:272–289 Turner S, Pryer MK, Miao V, Palmer JD (1999) Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J Eukar Microbiol 46:327–338 Vincent WF, Mueller DR, Bonilla S (2004) Ecosystems on ice: the microbial ecology of Markham Ice Shelf in the high Arctic. Cryobiology 48:103–112 Whitton BA, Potts M (eds) (2000) The ecology of cyanobacteria, their diversity in time and space. Springer, Berlin Wilmotte A, Herdman M (2001) Phylogenetic relationships among cyanobacteria based on 16S rRNA sequences. In: Boone DR, Castenholz RW (eds) Bergey’s manual of systematic bacteriology. Springer, New York, pp 487–493 Wilmotte A, Van der Auwera G, De Wachter R (1993) Structure of the 16 S ribosomal RNA of the thermophilic cyanobacterium Chlorogloeopsis HTF (‘Mastigocladus laminosus HTF’) strain PCC7518, and phylogenetic analysis. FEBS Lett 317:96–100 Wilmotte A, Stam W, Demoulin V (1997) Taxonomic study of marine oscillatorieaen strains (Cyanophyceae, Cyanobacteria) with narrow trichomes III. DNA-DNA hybridization studies and taxonomic conclusions. Arch Hydrobiol/Suppl Algol Studies 87:11– 28