phylogenetic relationships in pleurothallidinae ...

American Journal of Botany 88(12): 2286–2308. 2001.

PHYLOGENETIC RELATIONSHIPS IN PLEUROTHALLIDINAE (ORCHIDACEAE): COMBINED EVIDENCE FROM NUCLEAR AND PLASTID

DNA

SEQUENCES1

ALEC M. PRIDGEON,2,4 RODOLFO SOLANO,3

AND

MARK W. CHASE2

Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK; and 3Instituto de Ecologıá, Universidad Nacional Autońoma de Me´xico, Apartado Postal 70-275, 04510 Me´xico, D.F. Me´xico

2

To evaluate the monophyly of subtribe Pleurothallidinae (Epidendreae: Orchidaceae) and the component genera and to reveal evolutionary relationships and trends, we sequenced the nuclear ribosomal DNA internal transcribed spacers (ITS1 and ITS2) and 5.8S gene for 185 taxa. In addition, to improve the overall assessments along the spine of the topology, we added plastid sequences from matK, the trnL intron, and the trnL-F intergenic spacer for a representative subset of those taxa in the ITS study. All results were highly congruent, and so we then combined the sequence data from all three data sets in a separate analysis of 58 representative taxa. There is strong support in most analyses for the monophyly of Pleurothallidinae and in some for inclusion of Dilomilis and Neocognauxia of Laeliinae. Although most genera in the nine clades identified in the analyses are monophyletic, all data sets are highly congruent in revealing the polyphyly of Pleurothallis and its constitutent subgenera as presently understood. The high degree of homoplasy in morphological characters, especially floral characters, limits their usefulness in phylogenetic reconstruction of the subtribe. Key words:

ITS; matK; Orchidaceae; Pleurothallidinae; rDNA; trnL.

Subtribe Pleurothallidinae (Epidendreae: Orchidaceae) comprise an estimated 4000 Neotropical species in ;30 genera (Luer, 1986a), accounting for 15–20% of the species in the entire family. The vast majority are dipteran-, deceit-pollinated epiphytes with sympodial growth, unifoliate nonpseudobulbous stems or ‘‘ramicauls,’’ conduplicate leaves, velamentous roots, and an articulation between the pedicel and ovary. Genera have been circumscribed on the basis of number of pollinia—eight, six, four, or two—although there can be either eight or six in Brachionidium Lindl. (Luer, 1986a) and two or four (one large pair and one small pair) in Myoxanthus Poepp. & Endl. and Lepanthes Sw. (Stenzel, in press). Other floral characters used to distinguish genera include number of stigma lobes, sepal connation, resupination, and similarity of perianth parts (Luer, 1986a). Luer (1986a, 1987, 2000b) also placed great weight on the evolution of lip mobility and segregated species having any one of the various mechanisms in which this trait has independently evolved. This feature presumably 1 Manuscript received 14 December 2000; revision accepted 15 March 2001. The authors thank the following for contributions of plant materials, without which this study would have been impossible: Ignacio Aguirre-Olavarrieta, Steve Beckendorf, Rodrigo Escobar, Eric Ha´gsater, Johan and Clare Hermans, J & L Orchids (Cordelia Head, Marguerite Webb, Lucinda Winn), H. Phillips and Ann Jesup, Rolando Jimenez-Machorro, Carlyle Luer, Steve Manning, Alberto Mulas, Henry Scardefield, Ton Sijm, Miguel Soto, and Norris Williams; Cassio van den Berg for supplying some outgroup sequences and sharing critical information on Epidendreae; Gerardo Salazar for assisting RS in the laboratory during his stay at the Royal Botanic Gardens, Kew, UK; Carlyle Luer for offering his taxonomic thoughts in the early stages of this study and helping to obtain materials; and James Clarkson, Dion S. Devey, Jeffrey Joseph, Jenny Moore, Martyn Powell, and Sophie Wood for providing technical assistance in the Jodrell Laboratory. This study was supported by the Royal Botanic Gardens, Kew, UK, and a research grant from the American Orchid Society. AMP gratefully acknowledges Lady Sainsbury for her continuing support of research toward Genera Orchidacearum, toward which this study is a contribution. 4 Author for reprint requests (e-mail: [email protected]).

represents a more efficient method of pollen transfer to vectors not known for their efficiency (e.g., flies), although pollination has never been observed for any of the species with these mechanisms. From a broadly described Pleurothallis R.Br., several genera have been segregated since 1813: Barbosella Schltr., Lepanthopsis (Cogn.) Ames, Restrepiella Garay & Dunst., Dresslerella Luer, and Frondaria Luer. In addition, the type species of Trichosalpinx Luer and Zootrophion Luer were originally described as species of Specklinia Lindl., currently treated as a subgenus of Pleurothallis (Luer, 1986c). Even now, Pleurothallis includes some 2000 species grouped artificially into 32 subgenera with numerous sections, subsections, and series (Luer, 1986c, 1989, 1994, 1998a, b, 1999). Lindley (1859) was loath to split Pleurothallis further in the absence of distinguishing characters and preferred to maintain the admittedly artificial assemblage for ease of study and identification. Luer (1986c) agreed with Lindley and followed his broad-based approach, saying that ‘‘a Pleurothallis might be described as any pleurothallid that does not fit into any of the other genera,’’ but he divided the genus artificially into numerous subgenera, sections, and subsections using morphological characters and approached the intrageneric classifications of Masdevallia (Luer, 1986b) and Dracula (Luer, 1993) similarly. Identification of morphological and anatomical synapomorphies in the subtribe is complicated by the homoplasy rife in vegetative and floral features (Pridgeon, 1982), as shown in the cladistic study by Neyland, Urbatsch, and Pridgeon (1995). Morphological features such as fleshy or terete leaves, variously connate sepals, attenuated petals with apical osmophores, actively mobile labella, and ornamented ovaries occur in clearly unrelated species (Luer, 1986a). The same is true for anatomical features such as thickenings in the foliar hypodermis, differentiation of foliar chlorenchyma, and spirally thickened idioblasts (Pridgeon, 1982; Neyland, Urbatsch, and Pridgeon, 1995). Most of the above are either xeromorphic

2286

December 2001]

PRIDGEON

ET AL.—PHYLOGENETICS OF

adaptations or phenotypic responses to selection pressures imposed by pollinators with similar behaviors. Thus, in the absence of reliably homologous morphological and anatomical characters to interpret as synapomorphies, no satisfactory phylogenetic treatment of this large group has been published to date. To evaluate the monophyly of the subtribe and constitutent genera and reveal evolutionary relationships and trends, we sequenced the nuclear ribosomal DNA internal transcribed spacers (ITS1 and ITS2) and the 5.8S gene (hereafter simply ITS) for 185 taxa of Pleurothallidinae, including two accessions each of Masdevallia venezuelana, Brachionidium valerioi, and Ophidion pleurothallopsis, as well as the outgroup taxa Dilomilis montana, Neocogniauxia hexaptera, Arpophyllum giganteum, and Isochilus amparoanus (mostly Laeliinae sensu Dressler, 1981, 1993). All but seven of the 32 subgenera of the megagenus Pleurothallis are represented here by one or more taxa; those subgenera not represented are monospecific or comprise only a few species. As a result, the overall morphological diversity is sampled to minimize spurious attractions; such a strategy is recommended for large study groups in particular (Hillis, 1998). Internal transcribed spacer sequence variation has been previously used in phylogenetic studies of orchids to identify monophyletic groups at the genus level and below and to provide a molecular basis for taxonomic restructuring, particularly in Cypripedioideae (Cox et al., 1997), Orchidinae (Pridgeon et al., 1997; Bateman, Pridgeon, and Chase, 1997), Catasetinae (Pridgeon and Chase, 1998), Diseae (Douzery et al., 1999), Pogoniinae (Cameron and Chase, 1999), Lycastinae (Ryan et al., 2000), Laeliinae (van den Berg et al., 2000), and Maxillarieae (Whitten, Williams, and Chase, 2000). To resolve internal nodes in the ITS topology and offer additional evidence from another genome, we also sequenced the plastid gene matK and the trnL intron with the trnL-F intergenic spacer (hereafter simply trnL-F) for a representative subset of the taxa in the ITS study. Sequences of rbcL (Chase et al., 1994; Kores et al., 1997; Cameron et al., 1999; van den Berg, 2000), matK (Ryan et al., 2000; van den Berg, 2000; Whitten, Williams, and Chase, 2000; Kores et al., in press), and trnL-F (van den Berg, 2000; Whitten, Williams, and Chase, 2000; Kores et al., in press) have been useful in evaluating higher-level relationships in Orchidaceae by virtue of the relatively conservative evolution of the plastid genome. Finally, we combined the plastid data with the corresponding ITS sequences for a separate analysis of 58 representative taxa to assess congruence among the separate and combined data sets. In this way we were able to compare topologies of DNA regions with different functional constraints (e.g., coding vs. noncoding, nuclear vs. plastid, concerted evolution in ribosomal ITS sequences) before combining them to limit spurious results in the separate analyses (Johnson and Soltis, 1998; Wiens, 1998; Soltis, Soltis, and Chase, 1999). Following the definitions proposed by Seelanan, Schnabel, and Wendel (1997), we considered bootstrap consensus trees to be incongruent only if they showed ‘‘hard’’ incongruence (high bootstrap support), which possibly reflects biological processes such as hybridization. ‘‘Soft’’ incongruence (weakly supported conflicts) on the other hand, probably represent stochastic error from undersampling of taxa or characters. The effects of differing functional constraints are best corrected by directly combining data; common patterns in each partition, presumably the historical ones, will be strengthened and over-

PLEUROTHALLIDINAE (ORCHIDACEAE)

2287

come the unique patterns created by different constraints (Qiu et al., 1999). MATERIALS AND METHODS Plant material—Sources of plant material and vouchers are listed in Table 1, and representatives of intrageneric taxa of the large and well-studied genera Dracula Luer, Masdevallia Ruı´z & Pav., and Pleurothallis as proposed by Luer (1986b, c, 1989, 1993, 1998a, b, 1999) are listed in Table 2. All genera of Pleurothallidinae except Chamelophyton Garay (one species) and Teagueia (Luer) Luer (six species) were included in the study. Designation of outgroup was based on ITS nrDNA studies of Laeliinae and other Epidendreae (van den Berg et al., 2000), a four-loci study of the same groups (van den Berg, 2000), and rbcL sequences of Orchidaceae (Cameron et al., 1999): Arpophyllum giganteum. Authority abbreviations for taxa follow those of Brummitt and Powell (1992). DNA extraction—DNA was extracted from 0.1–1.0 g of fresh or silicadried leaves and/or flowers following a modified 23 CTAB (hexadecyltrimethylammonium bromide) procedure of Doyle and Doyle (1987). DNA was then precipitated with 100% ethanol or isopropanol, chilled for at least 24 h at 48C, pelleted and purified by centrifugation through CsCl2-ethidium bromide (1.55 g/mL) and subsequent dialysis in sterile double-distilled H2O and TE buffer, pH 8.0. For some taxa, DNA was instead purified using QIAquick (Qiagen, Crawley, UK) or CONCERT (Life Technologies, Paisley, UK) silica columns following the manufacturer’s protocols. Purified DNAs were then stored at 2808C in the Royal Botanic Gardens, Kew, DNA bank. Amplification and sequencing—ITS was amplified using the methods and primers described by Baldwin (1992) or Sun et al. (1994). The thermal cycling protocol of the polymerase chain reaction comprised 25–28 cycles, each with 1 min denaturation at 978C, 1 min annealing at 48–508C, and an extension of 3 min at 728C, concluding with an extension of 7 min at 728C. Amplification was improved with the addition of 1 mol/L betaine (final concentration; Sigma-Aldrich, Poole, Dorset, UK, product no. B0300) to the polymerase chain reaction (PCR) mixture, which is reported to reduce the effects of base-pair composition on DNA strand melting, thus improving PCR primer binding. Amplification of the matK gene and spacer was achieved in two parts using primers designed for Epidendroideae:—19F (CGTTCTCATATTGCACTATG; Whitten, Williams, and Chase, 2000), 881R (TMTTCATCAGAATAAGAGT; new for this study), 731F (TCTGGAGTCTTTCTTGAGCGA; new for this study), and trnK-2R (AACTAGTCGGATGGAGTAG; Johnson and Soltis, 1995). The PCR protocol comprised 27–30 cycles, each with 1 min denaturation at 948C, 30 sec annealing at 48–528C, and an extension of 1 min at 728C, ending with an extension of 7 min at 728C. Amplification of trnL-F used the primers c and f described by Taberlet et al. (1991). The thermal cycling program was the same as that for matK. Amplified products were cleaned with QIAquick or CONCERT silica columns following manufacturer’s protocols, including the addition of guanidinium chloride 35% to remove primer dimers (if present). Cleaned products were then sequenced using the BigDyey Terminator Cycle Sequencing Ready Reaction kit with AmpliTaqt DNA Polymerase (Applied Biosystems, Warrington, Cheshire, UK). Unincorporated dye terminators were removed by precipitating with 1 : 25 3 mol/L NaOAc : 100% ethanol and then washing twice with 70% ethanol. Pelleted samples were sequenced on an Applied Biosystems 377 automated sequencer. Sequence editing and assembly of complementary strands were accomplished using the ‘‘Sequence Navigator’’ and ‘‘AutoAssembler’’ programs, respectively, of Applied Biosystems. Each base position was checked for ambiguity and agreement with the complimentary strand. GenBank accession numbers for all sequences used in this study are listed in Table 1. Matrices are also available from AMP ([email protected]) and MWC ([email protected]). Phylogenetic analyses—All sequences were initially aligned with CLUSTAL W (Thompson, Higgins, and Gibson, 1994) and adjusted by eye. Each data set was analyzed with PAUP* version 4.0b4a (Swofford, 2000) with

2288

AMERICAN JOURNAL

OF

BOTANY

[Vol. 88

TABLE 1. Plant materials used in this study. Taxon

Acostaea costaricensis Schltr. Andinia pensilis (Schltr.) Luer Arpophyllum giganteum Hartw. ex Lindl. Barbosella cucullata (Lindl.) Schltr. Barbosella handroi Hoehne Barbosella orbicularis Luer Barbrodia miersii (Lindl.) Luer Brachionidium valerioi Ames & C.Schweinf. Brachionidium valerioi Ames & C.Schweinf. Condylago rodrigoi Luer Dilomilis montana (Sw.) Summerh. Dracula andreettae (Luer) Luer Dracula astuta (Rchb.f.) Luer Dracula bella (Rchb.f.) Luer Dracula chestertonii (Rchb.f.) Luer Dracula chimaera (Rchb.f.) Luer Dracula cochliops Luer & R.Escobar Dracula dodsonii (Luer) Luer Dracula erythrochaete (Rchb.f.) Luer Dracula sodiroi (Schltr.) Luer Dracula vampira (Luer) Luer Dracula xenos Luer & R.Escobar Dresslerella elvallensis Luer Dresslerella hirsutissima (C.Schweinf.) Luer Dresslerella pertusa (Dressler) Luer Dryadella edwallii (Cogn.) Luer Dryadella simula (Rchb.f.) Luer Frondaria caulescens (Lindl.) Luer Isochilus amparoanus Schltr. Lepanthes felis Luer & R.Escobar Lepanthes nautilus Luer & R.Escobar Lepanthes steyermarkii Foldats Lepanthes woodburyana Stimson Lepanthopsis astrophora (Rchb.f. ex Kra¨nzl.) Garay Luerella pelecaniceps Braas Masdevallia amaluzae Luer & Malo Masdevallia ampullacea Luer & Andreetta Masdevallia aphanes Ko¨niger Masdevallia bicornis Luer Masdevallia caesia Roezl Masdevallia caloptera Rchb.f. Masdevallia caudivolvula Kra¨nzl.

Source/voucher

J & L Orchids s.n., unvouchered Hermans 4223 (K) Chase s.n., unvouchered Kew 1997-5285 (K) Hermans 2330 (K) Jesup s.n., unvouchered J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered Manning 980403 (K) Kew Spirit 62101 Hermans 1926 (K) Kew Spirit 57031 Chase s.n., unvouchered Hermans 2952 (K) Kew Spirit 59692 Hermans 2055 (K) Kew Spirit 57724 Hermans 1826 (K) Kew Spirit 58946 Hermans 2363 (K) Kew Spirit 56870 Hermans 1357 (K) Kew Spirit 58741 Hermans 889 (K) Hermans 2750 (K) Kew Spirit 60135 Hermans 1000 (K) Hermans 2836 (K) Kew Spirit 59696 Hermans 1277 (K) Kew Spirit 61141 Hermans 3665 (K) Kew Spirit 58487 J & L Orchids s.n. Kew Spirit 60155 J & L Orchids s.n., unvouchered Kew 1976-1976 (K) Chase s.n., unvouchered Hermans 875 (K) Kew Spirit 56902 Luer 18778 (K) Kew Spirit 61336 Chase s.n., unvouchered Hermans 2899 (K) Kew Spirit 57774 Kew 1997-5314 (K) Kew Spirit 60234 Hermans 2682 (K) Kew Spirit 60132 Hermans 2931 (K) Kew Spirit 57773 Manning 921101 (K) Kew Spirit 61340 Hermans 3662 (K) Manning 941040 (K) Kew Spirit 60912 Kew 1997-5319 (K) J & L Orchids s.n., unvouchered Williams 224 (FLAS) Hermans 1257 (K) Kew Spirit 58884 Kew 1997-5424 (K) Beckendorf s.n., unvouchered

ITSa

matKa

trnLa

GBAN-AF262865

GBAN-AF265457

GBAN-AF265507

GBAN-AF262826 GBAN-AF266742 GBAN-AF262815 GBAN-AF262813 GBAN-AF262814 GBAN-AF262816

GBAN-AF265455 GBAN-AF265485 GBAN-AF265483


GBAN-AF262913

GBAN-AF265488

GBAN-AF265529

GBAN-AF291098

GBAN-AF291102

GBAN-AF262829

GBAN-AF265460

GBAN-AF265516

GBAN-AF262915 GBAN-AF262765

GBAN-AF263765

GBAN-AF266967

GBAN-AF265444

GBAN-AF265489

GBAN-AF265477

GBAN-AF265521


GBAN-AF265454

GBAN-AF265505

GBAN-AF262914

GBAN-AF265471

GBAN-AF265528


GBAN-AF263762

GBAN-AF266962

GBAN-AF262890

GBAN-AF265472

GBAN-AF265494

GBAN-AF262893

GBAN-AF265487

GBAN-AF265493


GBAN-AF265450

GBAN-AF265512

GBAN-AF265447

GBAN-AF263432

GBAN-AF262762 GBAN-AF262760 GBAN-AF262758 GBAN-AF262966 GBAN-AF262767 GBAN-AF262759 GBAN-AF262763 GBAN-AF262764 GBAN-AF262761 GBAN-AF262768 GBAN-AF262901 GBAN-AF262902



December 2001]

PRIDGEON



2289

TABLE 1. Continued. Taxon

Masdevallia chaparensis Hashim. Masdevallia citrinella Luer & Malo Masdevallia coccinea Linden ex Lindl. Masdevallia collina L.O.Williams Masdevallia coriacea Lindl. Masdevallia decumana Ko¨niger Masdevallia erinacea Rchb.f. Masdevallia floribunda Lindl. Masdevallia heteroptera Rchb.f. Masdevallia Masdevallia Masdevallia Masdevallia

hieroglyphica Rchb.f. infracta Lindl. limax Luer mentosa Luer

Masdevallia nidifia Rchb.f. Masdevallia ophioglossa Rchb.f. Masdevallia oreas Luer & R.Va´squez Masdevallia picturata Rchb.f. Masdevallia pinocchio Luer & Andreetta Masdevallia racemosa Lindl. Masdevallia reichenbachiana Endres ex Rchb.f. Masdevallia rubeola Luer & R.Va´squez Masdevallia saltatrix Rchb.f. Masdevallia teaguei Luer Masdevallia titan Luer Masdevallia uniflora Ruiz & Pav. Masdevallia venezuelana H.R.Sweet Masdevallia venezuelana Masdevallia ximenae Luer & Hirtz Myoxanthus aspasicensis (Rchb.f.) Luer Myoxanthus exasperatus (Lindl.) Luer Myoxanthus lonchophyllus (Barb.Rodr.) Luer Myoxanthus puncatatus (Barb.Rodr.) Luer Myoxanthus serripetalus (Kra¨nzl.) Luer Myoxanthus uncinatus (Fawc.) Luer Neocogniauxia hexaptera (Cogn.) Schltr. Octomeria gracilis Lodd. ex Lindl. Octomeria lithophila Rodr. Ophidion pleurothallopsis (Kra¨nzl.) Luer Ophidion pleurothallopsis (Kra¨nzl.) Luer Platystele compacta (Ames) Ames Platystele misera (Lindl.) Garay Platystele stenostachya (Rchb.f.) Garay

Source/voucher

ITSa

Manning 900908 (K) Kew Spirit 61344 Kew 1997-5325 (K) Hermans 3663 (K) Manning 890809 (K) Kew Spirit 60913 Kew 1977-4593 (K) Kew 1997-5330 (K) Hermans 2143 (K) Kew Spirit 57770 Chase s.n., unvouchered Beckendorf s.n., unvouchered Kew 1997-5335 (K) Hermans 3703 (K) Kew 1997-5427 (K) J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered Manning 891127 (K) Kew Spirit 62102 Kew 1997-5432 (K) Hermans 2379 (K) Kew Spirit 56945 Beckendorf s.n., unvouchered Kew 1997-5347 (K) J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered Kew 1997-5356 (K) Manning 96106 (K) Kew Spirit 61348 Manning 950788 (K) J & L Orchids s.n., unvouchered Hermans 2160 (K) Kew Spirit 61095 Kew 1997-5416 (K) Kew Spirit 60240 Kew 1963-3771 (K) Kew Spirit 60881 Kew 1970-3331 (K) Kew Spirit 60911 Kew 1983-4038 (K) Kew 1980-3412 (K) C. van den Berg C244 (K)

GBAN-AF262797

Hermans 2334 (K) Kew Spirit 58256 Kew 1973-13651 (K) Kew Spirit 60888 Hermans 2140 (K) Manning 961086 (K) Kew Spirit 60908 Manning 970304 (K) Kew Spirit 60902 Manning 890811 (K) Kew Spirit 61338 Manning 931108 (K) Kew Spirit 61347

matKa

trnLa

GBAN-AF262774 GBAN-AF262789 GBAN-AF262784 GBAN-AF262781 GBAN-AF262795 GBAN-AF262788 GBAN-AF262776 GBAN-AF262800 GBAN-AF262798 GBAN-AF262785 GBAN-AF262796 GBAN-AF262777 GBAN-AF262787 GBAN-AF262790 GBAN-AF262779 GBAN-AF262775 GBAN-AF262778

GBAN-AF265445

GBAN-AF293433

GBAN-AF265446

GBAN-AF265490

GBAN-AF302645

GBAN-AF292434

GBAN-AF262885

GBAN-AF265479

GBAN-AF265519



GBAN-AF262911

GBAN-AF265484

GBAN-AF265520 GBAN-AF266968, GBAN-AF266969 GBAN-AF265526

GBAN-AF265451

GBAN-AF265511

GBAN-AF265470

GBAN-AF265504

GBAN-AF262771 GBAN-AF262783 GBAN-AF262791 GBAN-AF262793 GBAN-AF262801 GBAN-AF262803 GBAN-AF262769 GBAN-AF262782 GBAN-AF262780 GBAN-AF262794 GBAN-AF262905 GBAN-AF262882 GBAN-AF262884


2290

AMERICAN JOURNAL

OF

BOTANY

[Vol. 88


Pleurothallis allenii L.O.Williams Pleurothallis amparoana Schltr. Pleurothallis angustilabia Schltr. Pleurothallis asaroides (Kra¨nzl.) Luer Pleurothallis auriculata Lindl. Pleurothallis Pleurothallis Pleurothallis Pleurothallis Pleurothallis Pleurothallis

brighamii S.Watson cardiantha Rchb.f. cardiothallis Rchb.f. circumplexa Lindl. cobanensis Schltr. condylata Luer

Pleurothallis corticicola Schltr. Pleurothallis costaricensis Rolfe Pleurothallis endotrachys Rchb.f. Pleurothallis erinacea Rchb.f. Pleurothallis excavata Schltr. Pleurothallis fenestrata Barb.Rodr. Pleurothallis fulgens Rchb.f. Pleurothallis glumacea Lindl. Pleurothallis gracillima Lindl. Pleurothallis grobyi Batem. ex Lindl. Pleurothallis guttata Luer Pleurothallis hemirhoda Lindl. Pleurothallis immersa Linden & Rchb.f. Pleurothallis johnsonii Ames Pleurothallis lanceola (Sw.) Spreng. Pleurothallis lentiginosa Lehm. & Kra¨nzl. Pleurothallis leptotifolia Barb.Rodr. Pleurothallis linearifolia Cogn. Pleurothallis loranthophylla Rchb.f. Pleurothallis Pleurothallis Pleurothallis Pleurothallis

luteola Lindl. marginata Lindl. melanochthoda Luer & Hirtz mentosa Barb.Rodr.

Pleurothallis microgemma Schltr. Pleurothallis minutalis Lindl. Pleurothallis mirabilis Schltr. Pleurothallis miranda Luer Pleurothallis mystax Luer Pleurothallis neoharlingii Luer Pleurothallis niveoglobula Luer Pleurothallis ochreata Lindl. Pleurothallis pectinata Lindl. Pleurothallis penicillata Luer Pleurothallis peperomioides Ames Pleurothallis powellii Schltr.

Source/voucher

Kew 1997-7404 (K) Hermans 2039 (K) Kew Spirit 56872 Manning 890604 (K) Kew Spirit 60905 Beckendorf s.n., unvouchered J & L Orchids s.n., unvouchered Solano 761 (UNAM) Hermans 2950 (K) Soto 5232 (UNAM) Soto 5946 (UNAM) Soto 4807 (UNAM) J & L Orchids s.n. Kew Spirit 61356 Hermans 3685 (K) Kew 1997-7405 (K) Kew Spirit 60907 Hermans 2840 (K) Solano 900 (UNAM) J & L Orchids s.n. Kew Spirit 61354 J & L Orchids s.n., unvouchered Manning 910225 (K) Kew Spirit 60916 Hermans 3705 (K) Manning 930905 (K) Hermans 2095 (K) Kew Spirit 57029 Hermans 2963 (K) Kew Spirit 58153 Hermans 2378 (K) Kew Spirit 57883 Hermans 1708 (K) Kew Spirit 58244 Soto 3638 (UNAM) Hermans 2617 (K) Kew Spirit 59585 Sijm s.n., unvouchered Manning 921049 (K) Hermans 2336 (K) Kew Spirit 56971 Kew 1963-5301 (K) Kew Spirit 60884 Borba 556 (UEC) Aguirre-O. 1151 (UNAM) Jesup s.n., unvouchered J & L Orchids s.n., unvouchered Manning 940319 (K) Kew Spirit 61345 Jimenez-M. 1044 (UNAM) J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered J & L Orchids s.n., unvouchered Kew 1957-46701 (K) Kew Spirit 60883 Kew 1999-2803 (K) Kew Spirit 62030 Kew 1974-1034 (K) Kew Spirit 40339 Hermans 3689 (K) Kew Spirit 61147 Hermans 2275 (K) Kew Spirit 56942 Glicenstein s.n., unvouchered J & L Orchids s.n., unvouchered

ITSa

matKa

trnLa


GBAN-AF265467

GBAN-AF265517

GBAN-AF262868

GBAN-AF302647

GBAN-AF293438

GBAN-AF265462

GBAN-AF265501

GBAN-AF265459

GBAN-AF265506


GBAN-AF265456

GBAN-AF265508

GBAN-AF262857

GBAN-AF265468

GBAN-AF265518

GBAN-AF265696

GBAN-AF276028

GBAN-AF265473

GBAN-AF265495

GBAN-AF265486

GBAN-AF293435

GBAN-AF275689 GBAN-AF262856 GBAN-AF262925 GBAN-AF262832 GBAN-AF262917 GBAN-AF262919 GBAN-AF262926 GBAN-AF262873 GBAN-AF262870 GBAN-AF262862

GBAN-AF262872 GBAN-AF262850 GBAN-AF262863 GBAN-AF262860 GBAN-AF262833 GBAN-AF262874 GBAN-AF262828 GBAN-AF262920 GBAN-AF262861 GBAN-AF275692 GBAN-AF262854 GBAN-AF262869 GBAN-AF262837 GBAN-AF275691 GBAN-AF262921 GBAN-AF262853 GBAN-AF262864 GBAN-AF262894 GBAN-AF262922 GBAN-AF262830

GBAN-AF293436


GBAN-AF265465

GBAN-AF265509

GBAN-AY008458

GBAN-AY008446, GBAN-AY008447

GBAN-AF275690

GBAN-AF291103

GBAN-AF291101

GBAN-AF262843

GBAN-AF265461

GBAN-AF265513

GBAN-AF262839 GBAN-AF262858 GBAN-AF262849 GBAN-AF262835

December 2001]

PRIDGEON



2291


Pleurothallis prolifera Herb. ex Lindl. Pleurothallis resupinata Ames Pleurothallis rowleei Ames Pleurothallis ruscifolia (Jacq.) R.Br. Pleurothallis sarracenia Luer Pleurothallis saurocephala Lodd Pleurothallis segoviensis Rchb.f. Pleurothallis sertularioides (Sw.) Spreng. Pleurothallis setosa C.Schweinf. Pleurothallis sicaria Lindl. Pleurothallis strupifolia Lindl. Pleurothallis tacanensis in ed. Pleurothallis talpinaria Rchb.f. Pleurothallis teaguei Luer Pleurothallis tribuloides (Sw.) Lindl. Pleurothallis tripterantha Rchb.f. Pleurothallis truncata Lindl. Pleurothallis tubata (Lodd.) Steud. Pleurothallis tuerckheimii Schltr. Pleurothallis velaticaulis Rchb.f. Pleurothallis viduata Luer Pleurothallopsis nemorosa (Barb.Rodr.) Porto & Brade Porroglossum amethystinum (Rchb.f.) Garay Porroglossum rodrigoi Sweet Porroglossum uxorium Luer Restrepia antennifera H.B.K. Restrepia aristulifera Garay & Dunst. Restrepia muscifera (Lindl.) Rchb.f. ex Lindl. Restrepiella ophiocephala (Lindl.) Garay & Dunst. Restrepiopsis striata Luer & R.Escobar Salpistele lutea Dressler Scaphosepalum gibberosum (Rchb.f.) Rolfe Scaphosepalum grande Kra¨nzl. Scaphosepalum swertiifolium (Rchb.f.) Rolfe Scaphosepalum verrucosum (Rchb.f.) Pfitzer Stelis argentata Lindl. Stelis atroviolacea Rchb.f. Stelis ciliaris Lindl. Stelis gemma Garay Stelis guatemalensis Schltr. Stelis lanata Lindl. Trichosalpinx arbuscula (Lindl.) Luer Trichosalpinx berlineri (Luer) Luer Trichosalpinx blaisdellii (S.Watson) Luer Trichosalpinx orbicularis (Lindl.) Luer

Source/voucher

Borba 555 (UEC) Ha´gsater 2867 (UNAM) Manning 941209 (K) Kew Spirit 60910 Hermans 2625 (K) Kew Spirit 60833 J & L Orchids s.n., unvouchered Kew 1968-192 (K) Kew Spirit 60235 Manning 890812 (K) Kew Spirit 60915 Solano 807 (UNAM) Solano 769 (UNAM) Manning 950742 (K) Kew Spirit 60903 Hermans 3712 (K) Soto 2939 (UNAM) J & L Orchids s.n. Kew Spirit 60154 Beckendorf s.n. Kew Spirit 62032 Kew 1997-7408 (K) Scardefield s.n. Kew Spirit 62103 J & L Orchids s.n. Kew Spirit 60157 Kew 1973-3662 (K) Kew Spirit 60239 Kew 1942-9135 (K) Kew Spirit 60890 Kew 1995-40102 (K) Manning 950438 (K) Kew Spirit 61337 Bock s.n. Kew Spirit 62104 Kew 1997-5400 (K) Kew 1997-5402 (K) Kew Spirit 60236 Hermans 2213 (K) Kew Spirit 56966 Hermans 1319 (K) Kew Spirit 56881 Hermans 2639 (K) Kew Spirit 58144 Chase s.n., unvouchered Chase s.n., unvouchered Hermans 2652 (K) Kew Spirit 56922 J & L Orchids s.n. Kew Spirit 62031 Hermans 2366 (K) Kew Spirit 57889 Hermans 2656 (K) Kew Spirit 57891 Hermans 1460 (K) Kew Spirit 56944 Kew 1980-2661 (K) Kew Spirit 60238 Kew 1984-4053 (K) Kew Spirit 60886 Kew 1997-7410 (K) Kew Spirit 60909 Solano 610 (UNAM) Kew 1997-7411 (K) Soto 6850 (UNAM) Hermans 1286 (K) Hermans 1266 (K) Kew Spirit 60810 Hermans 1605 (K) Kew Spirit 56862 Kew 1997-7412 (K) Hermans 1349 (K) Kew Spirit 56883

ITSa

matKa

trnLa


GBAN-AF275697

GBAN-AF276027

GBAN-AF262836

GBAN-AF265463

GBAN-AF265500

GBAN-AF262866

GBAN-AF276313

GBAN-AF265515


GBAN-AF302648

GBAN-AF276026

GBAN-AF302649

GBAN-AF293439

GBAN-AF265466

GBAN-AF265514


GBAN-AF302646

GBAN-AF293437

GBAN-AF291099

GBAN-AF291104

GBAN-AF291100


GBAN-AF265448

GBAN-AF265491

GBAN-AF262907

GBAN-AF265481

GBAN-AF265522




GBAN-AF265458

GBAN-AF265503

GBAN-AF265464

GBAN-AF265510

GBAN-AF262900

GBAN-AF265475

GBAN-AF265497





GBAN-AF262855 GBAN-AF262918 GBAN-AF262840 GBAN-AF275695 GBAN-AF262867 GBAN-AF275694 GBAN-AF262834 GBAN-AF262845 GBAN-AF262877


GBAN-AF262827 GBAN-AF262817 GBAN-AF262819 GBAN-AF262818 GBAN-AF262820 GBAN-AF262878 GBAN-AF262879 GBAN-AF262927 GBAN-AF262880 GBAN-AF262928 GBAN-AF262881 GBAN-AF262888

2292

AMERICAN JOURNAL

OF

BOTANY

[Vol. 88


Source/voucher

Trisetella gemmata (Rchb.f.) Luer Trisetella scobina Luer Trisetella triglochin (Rchb.f.) Luer Zootrophion atropurpureum Rolfe Zootrophion dayanum (Rchb.f.) Luer Zootrophion hirtzii Luer Zootrophion serpentinum Luer Zootrophion vulturiceps (Luer) Luer

Kew 1997-5447 (K) Kew Spirit 60237 Kew 1997-5449 (K) Kew Spirit 60914 Kew 1997-6011 (K) Kew Spirit 60879 Kew 1997-7414 (K) Kew Spirit 60906 Hermans 2142 (K) Kew Spirit 60145 Hermans 2270 (K) Kew Spirit 60122 Manning 921030 (K) Kew Spirit 61350 Hermans 2638 (K) Kew Spirit 60140

ITSa

matKa

trnLa


GBAN-AF265449

GBAN-AF265492

GBAN-AF265452

GBAN-AF265499


a The prefix GBAN- has been added to each GenBank accession to link the online version of American Journal of Botany to GenBank but is not part of the actual accession number.

Arpophyllum giganteum designated as the single outgroup. Gaps were coded as missing values. Sequencing artefacts at the ends of all matrices and two regions of ambiguous alignment in the trnL matrix (totaling 529 bases and 40 bases, respectively) were excluded prior to analysis. Additionally, unambiguous indels of four or more base pairs were coded for all sequences, totaling an additional seven characters for the ITS matrices, three for matK, and 26 for trnL. For each heuristic search, 1000 replicates of random sequence additions were run using subtree-pruning-regrafting (SPR) branch-swapping with MulTrees under the Fitch criterion (unordered states and equal weights; Fitch, 1971), but limiting the number of trees saved per replicate to ten to reduce time spent in swapping on large islands of trees. The shortest trees identified from this search were then used as starting trees, swapping on them up to 10 000 trees using tree bisection-reconnection (TBR). Relative support for trees from each of the equally weighted, indel-coded data sets was evaluated with 1000 bootstrap replicates (Felsenstein, 1985), saving no more than ten trees per replicate. We describe bootstrap values of 85–100% as strong, 75– 84% as moderate, and 50–74% as weak. For comparison with results of Fitch parsimony, successive approximation weighting (SW; Farris, 1969) using the rescaled consistency index (RC) was applied to the combined data set only (using the Fitch trees to calculate the initial weights) until tree length remained the same in two successive rounds. Tree and character manipulations were accomplished using MacClade version 4.0b9 (Maddison and Maddison, 1997). We analyzed patterns of sequence evolution using MacClade and PAUP* (Swofford, 2000) with the same abridged matrices used in parsimony analysis based on the one successively weighted tree from the combined matrix, which had the highest level of bootstrap support. To determine number of steps, CI (consistency index), and RI (retention index) for tranversions in each of the gene regions, we used a stepmatrix to weight the transitions to zero. Using the transversion data, we then calculated the number of transitions and their CI and RI.

RESULTS ITS—Large ITS matrix—Without indel-coding, the aligned ITS nrDNA matrix of 185 taxa comprised 759 characters, of which 500 (65%) were variable and 397 (52%) potentially parsimony informative. With a maximum tree number set at 10 000, 10 000 most parsimonious trees of Fitch length 3374 (CI 5 0.29, including autapomorphies, RI 5 0.70) resulted from the heuristic search of 1000 replicates. Following the addition of seven indel-coded characters (Table 3), the Fitch length of 10 000 most parsimonious trees increased to 3381

with only marginally higher CI (0.30, including autapomorphies) and RI (0.71). One of those 10 000 trees with Fitch branch lengths and bootstrap percentages .50% is presented in Figs. 1–3. Although not all clades recognized below receive strong bootstrap support in all analyses, they do in the combined analysis (see Fig. 7). Groups not present in the strict consensus tree are marked with an arrowhead. There is 93% bootstrap support for the monophyly of Pleurothallidinae, dropping to 59% for inclusion of nearest outgroups Dilomilis Raf. and Neocogniauxia Schltr. (Fig. 1). Octomeria R.Br. with eight pollinia received strong support for monophyly (100%), as did several genera with four pollinia in clade B: Dresslerella (96%), Restrepia (96%), and Barbosella, including Barbrodia Luer (100%). In addition, Restrepiopsis Luer (four pollinia) is sister to Pleurothallopsis Porto & Brade (eight pollinia) with strong support (98%). Subgenus Myoxanthus and subgenus Silenia Luer of Myoxanthus (Luer, 1992) received strong support (98% and 97%, respectively), but there was no support for the genus s.l. (sensu lato). Interrelationships of the supported groups collapsed in the strict consensus tree (arrowheads in Fig. 1). The two accessions of Brachionidium valerioi (six pollinia) have identical sequences. The next clade (C) in the grade shown in Fig. 1 comprises Pleurothallis subgenus Acianthera (Schweid.) Luer, embedded within which is the strongly supported (100%) relationship of P. sarracenia and P. asaroides of subgenus Sarracenella (Luer) Luer. Within Acianthera there is 100% support for a sister relationship between P. ochreata (sect. Brachystachyae Lindl.) and P. glumacea (sect. Tricarinatae Luer), 94% for subsect. Pectinatae Luer of sect. Sicariae Lindl. (P. prolifera and P. pectinata), and 62% for sect. Sicariae as a whole. Although there is ,50% support for the Acianthera clade in the complete ITS tree, it received 90–100% support in all other analyses except the small ITS analysis (64%). The next successively branching clade (D) is the strongly supported (91%) Lepanthes clade, including Frondaria, Lepanthes, Lepanthopsis (Cogn.) Ames, Pleurothallis subgenus Acuminatia Luer (P. angustilabia, P. linearifolia), Pleurothallis subgenus Specklinia sect. Muscosae Lindl. (P. microgemma, P. corticicola, P. minutalis, P. sertularioides), Trichosalpinx, and Zootrophion (Fig. 1). The Pleurothallis subclade

December 2001]

PRIDGEON


receives 97% support, with strong support as well for the monophyly of Zootrophion (96%), Lepanthes (100%), and Trichosalpinx subgenus Trichosalpinx (100%) but not Trichosalpinx s.l. Trichosalpinx berlineri, a pendent rather than caespitose species in subgenus Trichosalpinx, and T. arbuscula, in subgenus Tubella Luer, are isolated from the others in all shortest trees in positions that receive .50% bootstrap support or collapse in the strict consensus tree. The Pleurothallis s.s.–Stelis clade (clade E; Fig. 2) encompasses the majority of subgenera of Pleurothallis, most of which are not monophyletic. Pleurothallis mentosa and P. tripterantha (representing two sections of subgenus Specklinia) are moderately supported (78%) as sister to P. mirabilis of subgenus Mirandia Luer. In the Stelis Sw. subclade, Stelis is clearly monophyletic (100%) but is embedded in a grade of Pleurothallis subgenera Crocodeilanthe (Rchb.f. & Warsc.) Luer (P. velaticaulis), Physothallis (Garay) Luer (P. neoharlingii), Physosiphon (Lindl.) Luer (P. tubata, P. tacanensis [in ed.]), Effusia Luer (P. resupinata, P. amparoana, P. immersa), Mystax (P. mystax), Elongatia Luer (P. guttata), Dracontia Luer (P. powellii, P. tuerckheimii, P. cobanensis), and Salpistele lutea (subgenus Salpistele Dressler). Several branches collapsed in the strict consensus, blurring the distinction between the large genus Stelis and a miscellany of Pleurothallis subgenera. Condylago rodrigoi and Pleurothallis segoviensis (subgenus Unciferia Luer) are only weakly supported (59%) as belonging here. Sister to the Stelis subclade is the Pleurothallis s.s. subclade with seven subgenera separated by only a few steps or branches that collapse in the strict consensus tree: subgenus Pleurothallis (P. cardiantha, P. teaguei, P. truncata, P. cardiothallis, P. ruscifolia, P. rowleei, P. allenii), Scopula Luer (P. penicillata), Ancipitia Luer (P. excavata, P. viduata, P. niveoglobula), Mirandia Luer (P. miranda), Restrepioidia Luer (P. hemirhoda), Rhynchopera (Kl.) Luer (P. loranthophylla), and Talpinaria (Karst.) Luer (P. talpinaria). However, there is strong support for the assemblage (92%). Sister to the other subclades in clade E is Andinia pensilis. Sister to the Pleurothallis s.s.–Stelis clade is the Scaphosepalum Pfitz. clade (clade F; Fig. 2), which comprises a monophyletic Dryadella Luer (100%), several sections of Pleurothallis subgenus Specklinia, including the type of the subgenus (P. lanceola), Pleurothallis subgenera Empusella Luer (P. endotrachys) and Pseudoctomeria (Kra¨nzl.) Luer (P. lentiginosa), Acostaea Schltr., Scaphosepalum, and Platystele Schltr. There was only weak support for the monophyly of the latter two. The two accessions of Pleurothallis costaricensis are sister to each other with strong support (99%), although the sequences are more different than those between other paired accessions of the same species. The Luerella-Ophidion-Pleurothallis peperomioides group (clade G; Fig. 3) lacks bootstrap support .50% in the ITS analysis but received strong support in the combined treatment (see below). The two accessions of Ophidion pleurothallopsis are sister to each other with 100% support. Sister to clade G is the strongly supported (97%) Masdevallia clade (clade H; Fig. 3) comprising a monophyletic Trisetella Luer (100%), Masdevallia erinacea (representing subgenus Amanda Luer sect. Pygmaea Luer), and a monophyletic Porroglossum Schltr. (88% support) sister to the Masdevallia species studied plus Dracula xenos, which fall into two tenuous subclades. The subclade with the type species, M. uniflora, comprising subgenus Masdevallia sections Caudivolvulae


2293

Luer and Masdevallia, is sister to another subclade in which M. amaluzae (sect. Amaluzae Luer) and M. aphanes (sect. Aphanes Luer) are sister to one another with 100% support. The type subclade is sister to a polytomy with three subclades: (1) M. racemosa (subgenus Masdevallia sect. Racemosae Woolw.) sister to Masdevallia teaguei (subgenus Teagueia Luer) with only weak support; (2) representatives of several other sections of subgenus Masdevallia; (3) representatives of subgenus Amanda (e.g., M. caloptera), sister to subgenus Meleagris Luer (M. heteroptera). Overall, there is little or ,50% bootstrap support for the monophyly of any subgeneric taxa of Masdevallia. Finally, sister to Masdevallia-Porroglossum is moderately supported Dracula. Subgenus Sodiroa (Luer) Luer (D. sodiroi) is embedded in species of subgenus Dracula, and subgenus Xenosia Luer (D. xenos) is instead sister to Masdevallia picturata (79%). Small ITS matrix—This data set comprised 58 taxa, representing each of the major clades and outgroups identified in the larger analysis and also those taxa in the plastid and combined analyses. The same seven indels were included as before. Of the 394 variable sites (51%), 296 (75%) were potentially parsimony informative. Twelve most parsimonious trees of Fitch length 1749 were produced with a CI of 0.39 and RI of 0.52 (Table 3). The ITS bootstrap consensus tree (Fig. 4) shows that the level of support for monophyly of Pleurothallidinae increased slightly to 94%, whereas that for inclusion of Dilomilis and Neocogniauxia was still weak. Except for clades F and H, resolution is poor. Support for the monophyly of Masdevallia increased to 80%, and support remained high for the entire Dracula–Masdevallia–Porroglossum–Trisetella clade. Sister relationships were somewhat better supported than in the complete ITS study for Scaphosepalum–Platystele, Pleurothallis lentiginosa–P. endotrachys, P. cardiantha–P. ruscifolia, P. mentosa–P. tripterantha, Myoxanthus uncinatus–M. aspasicensis, and for clades D and E. matK—Of the 1914 included characters, 675 (35%) were variable, and of these 324 (48%) were potentially parsimony informative. In the analysis without the three coded indels, the Fitch length of the 10 000 most parsimonious trees was 1442 (CI 5 0.59, RI 5 0.53). With the addition of the three indels, the Fitch length increased to 1448, and the number of most parsimonious trees fell to 2040 (Table 3). The CI (0.59) was higher than the CI for the both ITS data sets, but the RI (0.53) was lower than that for the large ITS data set and only slighter better than that for the small ITS data set (Table 3), with less than one-half to one-third of the average changes per variable site observed for ITS. Third-codon positions accounted for the most steps (41.7%), followed by first-codon (32.1%) and then second-codon (26.2%) positions (Table 4). The CI and RI for first-codon positions were equal to slightly higher (0.60 and 0.54, respectively) than those for other positions (Table 4). The Fitch bootstrap consensus (Fig. 5) provided strong support for the monophyly of Pleurothallidinae but only if Dilomilis and Neocogniauxia are included. There was strong support for many of the same clades identified in ITS but also stronger support for Brachionidium–Octomeria (clade A), Restrepiella–Barbosella (clade B), Pleurothallis subgenus Acianthera (clade C), and Scaphosepalum–Platystele (clade

Subgenus Acianthera

Amaluzae Aphanes Caudivolvulae Coriaceae

Amandae Fissae Nidificae Ophioglossae Pygmeae

Andreettaea Chestertonia Cochliopsida Dodsonia Dracula

Section Section Section Section

Brachystachyae Cryptophoranthae Phloeophilae Sicariae

Section Reichenbachianae

Section Mentosae Section Minutae Section Polyanthae

Section Cucullatae Section Masdevallia

Section Section Section Section

Section Section Section Section Section


caloptera picturata nidifica ophioglossa erinacea

bella chimaera vampira erythrochaete astuta sodiroi xenos

Subsect. Pectinatae Subsect. Sicariae

Subsect. Dentatae Subsect. Reichenbachianae

Subsect. Polyanthae Subsect. Racemosae

Subsect. Alaticaules

collina reichenbachiana ximenae, M. heteroptera pelecaniceps

pinocchio infracta oreas racemosa

BOTANY

P. pectinata, P. prolifera P. sicaria, P. circumplexa

P. saurocephala, P. strupifolia P. fenestrata P. peperomioides

M. M. M. M.

M. M. M. M.

M. decumana M. coccinea M. uniflora, M. chaparensis M. citrinella, M. rubeola M. saltatrix, M. limax M. venezuelana M mentosa M. floribunda

Subsect. Subsect. Subsect. Subsect. Subsect. Subsect.

Caudatae Coccineae Masdevallia Oscillantes Saltatrices Tubulosae

M. caesia, M. coriacea M. titan (0/4)

M. amaluzae M. aphanes M. caudivolvula

M. M. M. M. M.

D. D. D. D. D. D. D.

andreettae chestertonii cochliops dodsonii

Subsect. Coriaceae Subsect. Durae

Subsect. Costatae Subsect. Dracula

D. D. D. D.

OF

Subgenus Meleagris Subgenus Pelecaniceps

Subgenus Masdevallia

Subgenus Amanda

Subgenus Sodiroa Subgenus Xenosia

Subgenus Dracula

AMERICAN JOURNAL

Pleurothallis

Masdevallia

Dracula

TABLE 2. Representative sampling in Dracula, Masdevallia, and Pleurothallis according to intrageneric sytematics proposed by Luer (1986b, c, 1989, 1993, 1994, 1998a, b, 1999). Where no species are listed, the number sampled (0) is entered along with the approximate number of species in the taxon.

2294 [Vol. 88

TABLE 2. Continued.

Pseudoctomeria Pseudostelis Restrepioidia Rhynchopera Rubellia Sarracenella Scopula Specklinia

Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus

Acroniae Antenniferae Longiracemosae Macrophyllae-Fasciculatae Macrophyllae-Racemosae Perplexae Pleurothallis


Mentosae Muscariae Muscosae Tribuloides Tripteranthae

Section Cucumeres Section Hymenodanthe

Section Truncatae

Subsect. Apoda-Caespitosae Subsect. Longicaule

P. fulgens, P. condylata P. grobyi, P. costaricensis P. mentosa P. setosa P. microgemma, P. corticicola P. tribuloides P. tripterantha P. segoviensis P. talpinaria (0/2)

(0/1)


P. rowleei, P. allenii (0/38) (0/8) P. cardiantha, P. cardiothallis (0/37) (0/1) P. ruscifolia P. truncata P. lentiginosa (0/6) P. hemirhoda P. loranthophylla (0/1) P. sarracenia, P. asaroides P. penicillata

P. excavata

Section Abortivae Section Pleurothallis Subsect. Subsect. Subsect. Subsect. Subsect. Subsect. Subsect.

(0/4) (0/1) P. viduata, P. niveoglobula (0/1) (0/11) P. melanochthoda P. auriculata P. velaticaulis P. powellii, P. tuerckheimii (0/1) P. amparoana, P. immersa P. guttata P. endotrachys P. erinacea (0/2) P. mirabilis P. miranda P. mystax P. tubata P. neoharlingii (0/7)

Section Aenigmata Section Vestigipetalae

PRIDGEON PLEUROTHALLIDINAE (ORCHIDACEAE)

Subgenus Unciferia Subgenus Talpinaria Subgenus Xenion

Ancipitia Andreettaea Antilla Apoda-Prorepentia Arthrosia Crocodeilanthe Dracontia Dresslera Effusia Elongatia Empusella Kraenzlinella Masdevalliantha Mirabilia Mirandia Mystax Physosiphon Physothallis Pleurobotryum Pleurothallis

Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus Subgenus

Subgenus Acuminatia Subgenus Aenigma

(0/10) P. glumacea P. angustilabia, P. linearifolia

Section Tomentosae Section Tricarinatae

December 2001] 2295

2296

AMERICAN JOURNAL

OF

BOTANY

[Vol. 88

TABLE 3. Values and statistics of separate and combined indel-coded data matrices for the same 58 taxa. The number in parentheses for the combined data matrix refers to the successively weighted (SW) tree. ITS (large)

ITS (small)

matK

trnL-F

Combined

Included positions in matrix Variable sites Parsimony-informative sites Trees Steps

766 507 404 10 0001 3381

766 394 296 12 1749

1917 678 327 2040 1448

1346 495 228 2520 939

4029 1567 851 4 4180

CI RI Average changes/variable site

0.30 0.71 6.7

0.39 0.52 4.4

0.59 0.53 2.1

0.65 0.64 1.9

0.51 0.54 2.7

SW

— — — 1 1382.888 (Fitch length 4180) 0.84 0.79 —

Fig. 1. A portion of one of the 10 0001 most parsimonious trees of the complete ITS nrDNA and gap-coded matrix. Numbers above each branch are Fitch lengths (ACCTRAN optimization), and those below branches are equally weighted bootstrap percentages .50%. Arrows indicate groups absent in the strict consensus.

December 2001]

PRIDGEON


Fig. 2.


2297

Continuation of the most parsimonious tree in Fig. 1.

F). On the other hand, support for inclusion of Porroglossum within clade H was only 52% (95% support in the ITS study). trnL-F—Of the 469 variable characters, 204 (44%) were potentially parsimony informative. Without the 26 coded indels in the matrix, the Fitch length of 10 0001 most parsimonious trees was 885 (CI 5 0.66, RI 5 0.64). With the addition of the 26 coded indels, the number of trees fell to 260 with a Fitch length of 939 (Table 3). The CI (0.65) and RI (0.64) in the indel-coded matrix were slightly higher than for matK (0.59 and 0.53, respectively; Table 3).

The bootstrap consensus tree (Fig. 6) is slightly more resolved than either the matK or small ITS tree and supports the monophyly of Pleurothallidinae, more strongly with the inclusion of Dilomilis and Neocogniauxia. There is a clear relationship (100%) between Luerella Braas and P. peperomioides (clade G) not present in the other topologies. Compared to the matK analysis, there is stronger support for clades D and H, although as before there is still strong support for clade C, P. mentosa–P. tripterantha and P. ruscifolia–P. cardiantha in clade E, and Myoxanthus uncinatus–M. aspasicensis (excluding M. punctatus) in clade B.

2298

AMERICAN JOURNAL

Fig. 3.

OF

BOTANY

[Vol. 88

Continuation of the most parsimonious tree in Figs. 1 and 2.

Combined analysis—There were no hard incongruencies among the nuclear and plastid data sets, so we combined the ITS, matK, and trnL matrices for the same 58 taxa to resolve minor differences and improve bootstrap support for the internal nodes of the topologies. A heuristic search of the combined matrices resulted in four trees of 4180 (CI 5 0.51, RI 5 0.54). After three rounds of successive weighting, one of the Fitch trees was identified as the optimal SW tree, SW length 5 1382.888 steps, SW CI 5 0.84, and SW RI 5 0.79 (Fitch length 5 4180; Table 3). Figure 7 shows the single successively weighted tree with

Fitch lengths above the branches and equally weighted bootstrap percentages below. Based on the single successively weighted tree from the combined analysis (Fig. 7; Table 5), the number of transversions in ITS1 was 336 (CI 5 0.41; RI 5 0.46) and the number of transitions 600 (CI 5 0.35; RI 5 0.52). For ITS2, 274 of the 783 steps were transversions (CI 5 0.46; RI 5 0.57) and 509 were transitions (CI 5 0.37; RI 5 0.51). Finally, of the 32 changes in 5.8S, nine were transversions (CI 5 0.56; RI 5 0.20) and 23 transitions (CI 5 0.42; RI 5 0.73). The transition/transversion (ts/tv) ratio for the coding region (5.8S) was

December 2001]

Fig. 4. branch.

PRIDGEON



2299

Bootstrap consensus tree of the stripped ITS nrDNA and gap-coded matrix (Fitch parsimony). Bootstrap percentages .50% are given above each

TABLE 4. Values and statistics for each codon position in matK, based on the single successively weighted tree from the combined analysis. Codon position

No. steps

CI

RI

1 2 3

363 (32.1%) 296 (26.2%) 471 (41.7%)

0.60 0.60 0.55

0.54 0.46 0.52

predictably higher (2.56) than for either ITS1 (1.79) or ITS2 (1.86). Again based on the single successively weighted tree, 682 (60%) of the changes in the matK tree were transversions (CI 5 0.51; RI 5 0.48) and 448 (40%) transitions (CI 5 0.69; RI 5 0.56) with a ts/tv ratio of 0.66 (Table 5). As for trnL, transversions for all three regions—intron, exon, and spacer— contributed more than transitions did to the number of steps (62, 63, and 70%, respectively; Table 5). The intron had the highest ts/tv value (0.61) and the spacer the lowest (0.43). The CI of transitions in all three regions (0.74, 0.76, 0.84, respectively) was higher than that of tranversions, as was the RI of transitions except for the exon (0.79, 0.23, 0.67, respectively; Table 5). The combined matrix (Fig. 7) shows many more groups

2300

AMERICAN JOURNAL

Fig. 5.

OF

BOTANY

[Vol. 88

Bootstrap consensus tree of the matK data set (Fitch parsimony). Bootstrap percentages .50% are given above each branch.

with substantially higher bootstrap support than any of the component data sets analyzed separately. There is 100% support for a monophyletic Pleurothallidinae without Dilomilis and Neocogniauxia and 98% for their inclusion. Support for the major clades identified in the separate analyses increased for clades A (84%), C (100%), D (100%), E (86% excluding Ophidion), F (84%), G (92%), and H (100%). DISCUSSION Molecular evolution—As for Maxillarieae of Orchidaceae (Whitten, Williams, and Chase, 2000), there is a substantial excess of transversions over transitions in matK with an equivalent ts/tv ratio (0.66). Most changes occur in the third-posi-

tion codon in both studies, although there are slightly more in Pleurothallidinae (41.7%) than in Maxillarieae (39.2%). Firstcodon changes in both studies account for ;32% of the total. The proportion of change at third positions for matK is substantially less than for other plastid protein-coding genes, such as rbcL and atpB (Savolainen et al., 2000). The rate of change at variable positions in matK is similar to that of trnL-F (i.e., the average changes per variable site). The situation is reversed in ITS nrDNA, in which an excess of transitions was observed (Table 5), which Bakker et al. (2000) attributed to different patterns of evolution between nuclear and plastid DNA. Sampling effects—Comparisons of the statistics for the large and small data sets of ITS (Table 3) show that adding

December 2001]

Fig. 6.

PRIDGEON



2301

Bootstrap consensus tree of the trnL data set (Fitch parsimony). Bootstrap percentages .50% are given below each branch.

taxa greatly increases the estimated number of changes at variable sites and therefore lowers the CI slightly but produces a much higher RI and perhaps more accurate result by better revealing the structure of homoplasy. If the object of phylogenetic studies is to determine accurately the number of times each character changes, then increased sampling is likely to produce a better result due to the drastically greater number of changes detected in variable base positions. If the improved RI is an accurate measure of character performance, then increased taxonomic sampling improves the information content of each variable position because the RI is higher with the larger matrix than it is with the smaller matrix. Ironically, in this case, the analysis with the higher RI receives lower overall

levels of bootstrap support, but that information alone does not tell us which result is more accurate. To us, it would be interesting to know which topology is more accurate, the one with higher bootstrap support or the one with a higher RI. If we can assume that the combined tree is more accurate than any of the trees from the component matrices (because it has higher levels of overall bootstrap support than any of the individual analyses), then by standardizing the numbers of taxa and characters to those held in common by all analyses, we can ask which version of the ITS matrix (large or small) produced a tree more similar to the combined tree (i.e., the tree with a length more similar to the combined tree is therefore the more accurate one). Compared to the com-

2302

AMERICAN JOURNAL

OF

BOTANY

[Vol. 88

Fig. 7. The single, most parsimonious, successively weighted tree from the combined, gap-coded matK/trnL-F/ITS nrDNA data set. Values above each branch are Fitch lengths (ACCTRAN optimization), and those below branches are equally weighted bootstrap percentages .50%. (Note: this SW tree is one of the four trees found in the Fitch analysis; the Fitch length for both is the same, 4180 steps). Morphological character states refer to the entire clade and not to an individual species.

TABLE 5. Number of steps, CI, and RI for transitions (ts) and transversions (tv) for each locus based on the single successively weighted tree from the combined analysis. matK

No. steps CI RI ts/tv

5.8S

ITS 1

ITS 2

trnL intron

trnL-F intergenic spacer

trnL exon

ts

tv

ts

tv

ts

tv

ts

tv

ts

tv

ts

tv

ts

tv

448 0.69 0.56

682 0.51 0.48

23 0.42 0.73

9 0.56 0.20

600 0.35 0.52

336 0.41 0.46

509 0.37 0.51

274 0.46 0.57

174 0.74 0.79

286 0.63 0.58

16 0.76 0.23

27 0.41 0.30

118 0.84 0.67

277 0.57 0.57

0.66

2.56

1.79

1.86

0.61

0.59

0.43

December 2001]

PRIDGEON


bined tree topology, the better-sampled (larger) ITS analysis is more similar in length; the length of the small ITS data set was 1749 steps, whereas that of the large ITS matrix stripped to just the taxa in the combined analysis was 1763 steps; the ITS contribution to the combined tree was 1761 steps. Thus, the length of the trees produced with more taxa was more like that produced with more characters (matK and trnL-F plus ITS). Which of the three is the most accurate is still a question we cannot answer, but it seems clear to us in this case that RI is a better measure of data performance than overall levels of bootstrap support. However, the use of overall measures for a tree (such as RI, which tells us how well character changes collectively fit the resulting trees) cannot tell us anything about the accuracy of individual groups, so ultimately bootstrap support for a given clade is the only measure of internal support available. Many previous phylogenetic studies of DNA sequence data have used frequency of change as the basis for weighting under the assumption that characters that change more frequently are less reliable. However, based on the combined analysis, frequency of change and performance (as measured by the RI) are not correlated. Therefore, if weighting of any sort is to be employed, it must not be based on whole-category weights, which is why we employed successive approximations weighting. A similar conclusion about whole-category weighting was reached by Olmstead, Reeves, and Yen (1998), although they favored simply eliminating characters that were changing excessively (i.e., weighting them to zero), whereas SW uses a graded scale. Previous cladistic studies—In a cladistic study using 45 morphological and anatomical characters, Neyland, Urbatsch, and Pridgeon (1995) also designated Arpophyllum giganteum as outgroup along with Brassavola nodosa (L.) Lindl. and Epidendrum ciliare L. of Laeliinae. Some results were similar to those reported here, e.g., Porroglossum was sister to Masdevallia, and Trisetella was sister to both of them (but they fell in the same clade as Scaphosepalum–Platystele–Dryadella). Furthermore, Lepanthes was sister to sect. Hymenodanthe of Pleurothallis subgenus Specklinia instead of Lepanthopsis, which was part of a polytomy with Pleurothallis s.s. and Restrepia. Brachionidium was sister to Dracula, a relationship based in large part on the absence of a leaf hypodermis. In light of these results, the anatomical similarity between those two genera represents a reversal in Dracula, and perhaps also in Brachionidium, rather than a synapomorphy. Although the morphological analysis likewise clearly showed the polyphyly of Pleurothallis, the distribution of its various components differed substantially from the highly bootstrap supported topology shown here. Molecules vs. morphology—The results of the Neyland, Urbatsch, and Pridgeon (1995) attempt to classify Pleurothallidinae based on morphological/anatomical data differ radically from the results here in part because of the homoplasy of most of the characters used. For example, wall thickenings of leaf hypodermal cells and mesophyll idioblasts (specializations for water storage) have arisen or been lost several times in the phylogeny of the group (Fig. 7). The only unequivocal anatomical synapomorphy of which we are aware is that of elevated, cyclocytic stomata in Dresslerella and Myoxanthus subgenera Silenia and Satyria. The morphological analysis also


2303

suffered simply because not enough reliable characters relative to the number of taxa were analyzed. Some of the morphological characters adduced by Luer (1986a), in assorted combinations, to classify Pleurothallidinae (Fig. 7) include presence of an annulus on the stem or ramicaul, variously connate sepals, presence of actively motile lips, anther position (apical, subapical, or ventral), number of pollinia (two, four, six, or eight), bilobed stigmas, and a number of autapomorphies. Actively motile lips have evolved independently in Acostaea, Condylago, Porroglossum, and Masdevallia teaguei, and bilobed stigmas occur in such unrelated genera as Lepanthes, Pleurothallis s.s./Stelis, and Platystele. The anther is apical, subapical, or ventral within every one of the major clades identified here. Number of pollinia is not necessarily evidence of relationship, as illustrated above by Restrepiopsis and Pleurothallopsis. Such homoplasy in floral characters and their lack of congruence with molecular data are attributable to the fact that flowers of most Pleurothallidinae are deceit-pollinated and exhibit various combinations of the same features: (1) attract dipterans by simulation of a food source or breeding site, (2) literally toss them against the column for deposition and extraction of pollinia (though this has never observed in nature), or (3) limit pollinator size by the size of openings in connate sepals. In orchid groups such as Catasetinae and Stanhopeinae that offer rewards in the form of floral fragrances, however, floral characters more closely reflect phylogenetic relationships based on molecular data (Chase and Hills, 1992; Pridgeon and Chase, 1998; Whitten, Williams, and Chase, 2000). On the other hand, the stem annulus, which is not subject to pollination selection pressures, is consistently absent (Fig. 7) in the more ancestral genera represented by clades A, B, and C but (except for P. peperomioides) consistently present in all derived genera, which have two pollinia (Stern, Pridgeon, and Luer, 1985). The anatomy and morphology of Pleurothallidinae are well studied compared to many orchids, but these features are relatively homogenous, leaving us with the distinct impression that more study of nonmolecular characters is unlikely to reveal the vastly greater numbers of characters required for a more accurate assessment of intergeneric relationships. This is, of course, why we turned to DNA sequence analyses for additional characters. Compared to the extensive number of species that have to be sampled to characterize accurately the distribution of any newly found potentially useful character, DNA sequence studies are a vastly more efficient, if less elegant, method of finding useful information. We believe that both types of studies are required to understand the evolutionary history of Pleurothallidinae, but it is also clear to us that if we are going to make rapid strides in understanding these often bizarre and fascinating plants before they become extinct, then molecular studies are the only option that is likely to succeed in the limited time remaining. Furthermore, studies of DNA sequences have been demonstrated to produce results that are well corroborated by other characters, both at the level of angiosperm families (Nandi, Chase, and Endress, 1998) as well as at the level of genus (Rudall et al., 1998, 2000) and species (Cameron and Chase, 1999). The results presented here demonstrate that the morphological characters of Neyland, Urbatsch, and Pridgeon (1995) change much more frequently when mapped onto the molecular topology than they did in Neyland, Urbatsch, and Pridgeon (1995), but not to the point that their change is random. It is clear that their patterns

2304

AMERICAN JOURNAL

of change are still highly structured when optimized on the DNA-based topology, just less so than on the morphological topology. Subtribe Pleurothallidinae and outgroups—Dressler (1993) suggested that Pleurothallidinae could be sister to or derived from something similar to Dilomilis, which has eight pollinia and reed stems with persistent leaf sheaths (Ackerman, 1995). Its sister genus, Neocogniauxia, has sheathed stems terminated by a single leaf. The leaf anatomy of both (Baker, 1972) is similar in many respects to that of most Pleurothallidinae: adaxial and abaxial hypodermis, helically thickened mesophyll cells, and absence of extravascular fibers (Pridgeon, 1982). In the matK, trnL, and combined analyses here, Dilomilis montana and Neocogniauxia hexaptera received strong support (91, 85, and 98%, respectively) as the sister taxa to Pleurothallidinae. The comprehensive ITS study of Laeliinae (van den Berg et al., 2000), the rbcL study of Orchidaceae (Cameron et al., 1999), the four-region study of Epidendreae and Laeliinae (van den Berg, 2000), and the mitochondrial DNA study by Freudenstein, Senyo, and Chase (2000) offered even stronger support for inclusion of Dilomilis and Neocogniauxia in Pleurothallidinae. There is only one morphological synapomorphy uniting the members of Pleurothallidinae as presently understood—an articulation between the ovary and pedicel—that Dilomilis and Neocogniauxia lack. However, taking into account the highly supported molecular evidence from multiple DNA regions, the shared number of pollinia in some taxa (eight) and leaf anatomy, the ancestral reed-stem condition in other clades of Epidendroideae (van den Berg, 2000), and evolutionary remnants thereof in present-day Pleurothallidinae (see below), Pleurothallidinae should be expanded to include Dilomilis, Neocogniauxia, and presumably the monospecific Tomzanonia Nir (segregated from Dilomilis by Nir, 1997), thereby forming a more natural unit. Furthermore, recognition of a new subtribe comprising only three genera that are collectively sister to Pleurothallidinae seems an unnecessary case of taxonomic inflation. Clade A—Octomeria, a genus of ;150 species distributed throughout the Neotropics but most diverse in Brazil, is sister to the rest of Pleurothallidinae and has features that could be considered unspecialized, e.g., eight pollinia and a stem without an annulus at the insertion of the inflorescence (Fig. 7). A relationship with Brachionidium, which likewise has subsimilar sepals and petals, eight pollinia (some species), and also lacks an annulus (Luer, 1986a; Stenzel, in press), received moderate support in the matK and combined analyses but was at best weakly supported in the remaining analyses. Sampling additional species of Brachionidium and Octomeria as well as Chamelophyton might alter the position of Brachionidium. Clade B—This clade, which received ,50% support (Fig. 7), comprises clearly monophyletic genera with four or eight pollinia (Restrepia, Restrepiella, Barbosella including Barbrodia, and Restrepiopsis–Pleurothallopsis Porto & Brade). All lack an annulus (the ancestral condition), but there are specializations to attract pollinators. Species of Restrepia have well-developed osmophores at apices of the dorsal sepal and petals (Pridgeon and Stern, 1983), and more generalized osmophores occur over the sepals of Restrepiella (A. M. Pridgeon and W. L. Stern, unpublished data). Luer (2000b) maintained that on the basis of the different

OF

BOTANY

[Vol. 88

form of attachment of the lip to the column (a simple hinge instead of the ball-and-socket articulation that characterizes Barbosella species), Barbrodia should be maintained as a monospecific genus. The same ball-and-socket joint also occurs in Pleurothallis subgenus Crocodeilanthe and elsewhere. The same holds true for the column character (apical anther) that Luer (2000b) used to distinguish Barbrodia from Barbosella (with a ventral anther). An apical anther also occurs in such unrelated taxa as Porroglossum, Lepanthes, Andinia Luer, Acostaea, and Pleurothallis s.s. Contrary to Luer’s segregation of Barbrodia, it is embedded within Barbosella in all analyses (with 100% support) and cannot be maintained if Barbosella is to remain monophyletic. There is strong support (88–100%) in all analyses for a sister relationship between Restrepiopsis (four pollinia) and Pleurothallopsis (eight pollinia), with relatively few steps between them to justify treating them as separate genera. Pleurothallopsis has been treated as a subgenus of Octomeria (Luer, 1991), and this relationship is strongly refuted. This disparity casts doubt on the conventional wisdom (Brieger, 1977; Freudenstein and Rasmussen, 1999; and others) of using pollinium number to circumscribe genera, which has also been shown to vary in Broughtonia R.Br. (van den Berg, 2000), Myoxanthus (Stenzel, in press), and Maxillarieae in general. Reduction in number is a multiple parallelism in Laeliinae (van den Berg et al., 2000) and probably also in Pleurothallidinae. However, from these data it is impossible to determine with certainty how many times this has occurred in Pleurothallidinae. Dresslerella and Myoxanthus s.l. form a polytomy with the remaining genera in the bootstrap consensus trees of most analyses but comprise a clade with ,50% support in the combined analysis. The Pleurothallis subgenus Acianthera clade (C) is next to clade B in the grade in the successively weighted tree, but the relationship between it and clade B received ,50% bootstrap support. The Myoxanthus uncinatus–M. aspasicensis group, treated by Luer as subgenus Silenia (1992), is highly supported (92–100%) and may include the M. punctatus group (subgenus Myoxanthus) based on these results. Myoxanthus subgenus Silenia and subgenus Satyria Luer share cyclocytic, elevated foliar stomata with Dresslerella (Pridgeon and Williams, 1979; Pridgeon, 1982; Pridgeon and Stern, 1982), a significant synapomorphy not yet found elsewhere in Orchidaceae, including subgenus Myoxanthus. On the other hand, subgenera Silenia and Satyria both lack the autapomorphic coralloid raphide clusters that characterize the foliar epidermis of species in subgenus Myoxanthus (Pridgeon, 1982; Pridgeon and Stern, 1982). Both Dresslerella and Myoxanthus s.l. also lack an annulus on the stem or ramicaul. Further, the discovery of an additional, smaller pair of pollinia in some species of subgenus Myoxanthus (Stenzel, in press) strengthens the link to Dresslerella, which also has one pair of large and one pair of small pollinia. Clade C—In the plastid and combined analyses there is strong support (90–100%) for a monophyletic P. subgenus Acianthera, far removed from the type clade of Pleurothallis, although the ITS trees provide strong support for only three of the terminal clades (Fig. 1). From Luer’s (1986c) treatment, sections Brachystachyae Lindl. (P. johnsonii, P. leptotifolia, P. ochreata, P. saurocephala, P. strupifolia), Cryptophoranthae Luer (P. fenestrata), Phloeophilae Luer (P. raduliglossa), Sicariae Lindl. (P. circumplexa, P. luteola, P. pectinata, P. prolifera, P. sicaria), and Tricarinatae Luer (P. glumacea) are

December 2001]

PRIDGEON


all represented, though not necessarily in subclades reflecting these same relationships. In addition, subgenera Arthrosia (P. auriculata) and a monophyletic Sarracenella (P. sarracenia, P. asaroides) are embedded in P. subgenus Acianthera (Fig. 1). Like other species in P. subgenus Acianthera, species in these two subgenera lack an annulus on the stem. Pleurothallis peperomioides of subgenus Phloeophilae is placed not with subgenus Acianthera at all but with Luerella (see below). Pleurothallis melanocthoda, which Luer (1996) assigned to subgenus Specklinia (Lindl.) Garay sect. Muscosae Lindl., is instead a member of subgenus Acianthera according to the complete ITS study. All species in clade C and those that follow below have only two pollinia. Clade D—In many respects this clade, which received strong support in every analysis except matK and 100% support in the combined analysis, is the most interesting and unanticipated from a phylogenetic perspective. It includes Lepanthes and Zootrophion, genera with highly divergent floral morphologies, as well as Pleurothallis subgenus Acuminatia, P. subgenus Specklinia sect. Muscosae, Frondaria, and Trichosalpinx. What unites this florally disparate group is a many-noded stem with infundibular sheaths, either imbricating as in Zootrophion and P. subgenus Specklinia sect. Muscosae or sclerotic as in Lepanthes, Lepanthopsis, Trichosalpinx, and some members of P. subgenus Acuminatia. Reduced and sclerified sheaths would reduce water loss at lower elevations or during the alternating wet and dry periods of the Pleistocene described by Gentry (1982). It is most parsimonious to explain the expanded leaf sheaths on the stem of Frondaria as a reversal toward the reed-stem condition; indeed, with the leaf sheaths subtending a true apical leaf it approaches Neocogniauxia in vegetative morphology. All genera in this clade are monophyletic with the possible exception of Lepanthopsis (only one species was studied) and Trichosalpinx. There is at best a weakly supported relationship between the pendent species T. berlineri and the erect speciespair T. orbicularis–T. blaisdellii in subgenus Trichosalpinx (Figs. 1, 4–7). Subgenus Tubella, represented by T. arbuscula here, has a different, proliferating habit such that new plants arise from nodes on the stem or ramicaul (Luer, 1997); Trichosalpinx arbuscula has an isolated position (Fig. 1) with no apparent relationship to T. berlineri or T. orbicularis–T. blaisdellii. Clade E—Three subclades comprise this strongly supported clade (Fig. 7). The first unites sections Mentosae Luer and monospecific Tripteranthae Luer of Pleurothallis subgenus Specklinia with monospecific subgenus Mirabilia Luer (Figs. 2, 4–7). Vegetatively all three groups are similar, the latter differing florally from the others in having a much longer column foot. Sister to this subclade is the type group of Pleurothallis, including P. ruscifolia and P. cardiantha. It, too, is a highly supported group in all analyses (Figs. 2, 4–7). However, the monophyly of the subclade can be established only if several other subgenera, separated by only a few steps (Fig. 2), are sunk into it: Scopula (P. penicillata), Ancipitia (P. viduata, P. niveoglobula), Mirandia (P. miranda), Restrepioidia (P. hemirhoda), Rhynchopera (P. loranthophylla), and Talpinaria (P. talpinaria). Furthermore, some sections and subsections of P. subgenus Pleurothallis are not supported as monophyletic units. For example, P. truncata (sect. Truncatae Luer) forms


2305

a polytomy with P. teaguei, P. cardiantha, and P. cardiothallis (sect. Pleurothallis subsect. Macrophyllae–Fasciculatae Lindl.). Pleurothallis rowleei and P. allenii (sect. Pleurothallis subsect. Acroniae Luer) form a polytomy with other subgenera (Fig. 2). Criteria used to distinguish these subgeneric taxa are almost exclusively floral: shape and margins of the petals, shape of the lip, etc. (Luer, 1986a). It is clear from the above that reliance on trivial characters that often are subjectively emphasized over others has led to gross taxonomic inflation, which obscures and even contradicts much closer relationships in Pleurothallis s.s. The polyphyly of Pleurothallis is further reflected in the Stelis subclade of clade E, in which seven subgenera of Pleurothallis (Dracontia, Elongatia, Mystax Luer, Effusia, Physosiphon (Lindl.) Luer, Physothallis (Garay) Luer, Crocodeilanthe) and Salpistele lutea form a grade in the complete ITS tree to a monophyletic Stelis s.s. (Fig. 2). Sister to the subclade are P. segoviensis (subgenus Unciferia) and the monospecific genus Condylago Luer. In the combined tree (Fig. 7), P. segoviensis is still sister to that subclade in a weakly supported alliance with P. amparoana. Stelis s.s. is distinguished florally by (1) equal to subequal, variously connate or almost free sepals; (2) small, transversely elongated, fleshy petals more or less thickened on the margins; (3) a concave, fleshy, three-sided lip; and (4) a short, broad column with or without a column foot but with an apical anther and often bilobed stigma (Garay, 1979; Luer, 1986a). Stelis ciliaris, which Garay (1979) segregated with 32 other species as the genus Apatostelis Garay on the basis of having only one stigma lobe instead of two, is here embedded among other Stelis species. There is thus no support for recognition of Apatostelis. Perhaps more important, this result diminishes the reliability of number of stigma lobes as a taxonomic character at the genus level. Sister to Stelis s.s. (Figs. 2, 4–7) is P. velaticaulis of P. subgenus Crocodeilanthe. Species in this subgenus as well as subgenus Pseudostelis, removed from Crocodeilanthe by Luer (1999), are vegetatively similar to Stelis and also have an apical anther, connate lateral sepals, and concave lip. Pleurothallis neoharlingii (subgenus Physothallis), sister to Stelis–P. velaticaulis, also bears a resemblance to sect. Nexipous (Garay) Luer of Stelis with its lateral sepals more connate to the dorsal sepal than to each other. Next in the grade (Fig. 2) are P. tubata and P. tacanensis of subgenus Physosiphon, characterized by a tubular calyx and a vegetative morphology indistinguishable from most species of Stelis, the former species originally described as Stelis tubata Lodd. The remaining members of the grade in Fig. 2, representing four other subgenera of Pleurothallis s.l., exhibit low levels of divergence. It seems likely that in the evolution of this clade, vegetative morphology remained essentially unchanged, but there was progressive connation of sepals (often with trichomes) and thickening of all floral parts, culminating with the highly reduced but fleshy petals and lip of Stelis s.s. Condylago, a monospecific genus that Luer (1986a, 1987) likened to P. flexuosa of subgenus Effusia (Luer, 2000b), differs only from that subgenus by having a sensitive lip, which arose independently in other clades (see below). In light of the low levels of divergence, the vegetative similarities and floral homoplasy, and moderate (81%) support in the combined tree for an expanded, phylogenetic concept of Stelis, there is little justification for continuing to recognize Salpistele, Condylago, and the several subgenera of Pleurothallis as anything but species of Stelis,

2306

AMERICAN JOURNAL

the sister genus to Pleurothallis s.s. These taxonomic transfers will be made elsewhere. Clade F—The disparate membership of this strongly supported clade (excluding Andinia) in the combined analysis (Fig. 7) underscores the problems associated with excessive reliance on floral features for delimitation of taxonomic categories. Scaphosepalum shares several synapomorphies and indels with Platystele, as unexpected a pairing as Lepanthes– Zootrophion. Scaphosepalum flowers are nonresupinate with an undivided stigma and prominent osmophores on lateral and/ or dorsal sepals (Pridgeon and Stern, 1985; Luer, 1988), whereas Platystele flowers are resupinate with a bilobed stigma and generalized osmophores. Apart from general differences in size of the plants (species of the latter are among the smallest Neotropical orchids), the two genera are almost identical vegetatively: (1) stem with an annulus shorter than the leaf and enclosed by two or three imbricating sheaths and (2) leaf thinly to thickly coriaceous, obovate, the apex notched with a mucro or apiculum in the sinus (Luer, 1988, 1990). Sister to the Scaphosepalum–Platystele subclade with 94% support (Fig. 7) is a subclade comprising species of Pleurothallis subgenus Specklinia (sects. Hymenodanthe Barb.Rodr., Tribuloides Luer, Muscariae Luer), P. subgenus Empusella, P. subgenus Pseudoctomeria, and Acostaea. Once again the low levels of sequence divergence (Fig. 2) indicate that many of the current intrageneric concepts of Pleurothallis are trivial, and all taxa in this subclade could be accommodated in the resurrected genus Specklinia Lindl. (lectotype Epidendrum lanceola Sw., included here). That Acostaea, which like Condylago has a sensitive lip (but a different mechanism), is embedded among species of subgenus Specklinia sister to Pleurothallis costaricensis once again reveals problems with a priori, subjective weighting of the sensitive lip in generic circumscription. Dryadella is sister to both of these subclades (Fig. 7), and Andinia, segregated on the basis of these studies from Salpistele Dressler (Luer, 2000b), is supported (84%) as sister to all the rest in clade F. Clade G—Sister to the Clade H is the small clade comprising Luerella and Pleurothallis peperomioides. Although resolved in the large ITS tree (Fig. 3), there is ,50% bootstrap support for a relationship between them. However, there is 100% support for a sister relationship between them in the trnL-F analysis (Fig. 6) and 92% in the combined tree (Fig. 7). Vegetatively, P. peperomioides differs from Luerella in having a creeping habit and small, round leaves. There are differences in lip and petal morphology and in the degree of sepal connation. Furthermore, the stem of Luerella has an annulus (Stern, Pridgeon, and Luer, 1985), whereas that of P. peperomioides is said to lack one (Luer, 1986c). The latter is one of nine species attributed to sect. Phloeophilae Luer of subgenus Acianthera (Luer, 1986c). Another in this section is P. raduliglossa, which in this study fell within Acianthera (Fig. 1) rather than with P. peperomioides, indicating that the section is not monophyletic. Ophidion could be a member of this group, but the combined tree resolves it as a member of clade E without bootstrap support .50%. Its floral and vegetative morphology compare well with the other members of clade G, so perhaps the ITS result (Fig. 3) that places it with these will end up being accurate. Overall none of the data collected resolve its position with any confidence.

OF

BOTANY

[Vol. 88

Clade H—This clade comprises four monophyletic genera— Dracula, Masdevallia, Porroglossum, Trisetella—and Masdevallia erinacea. Dracula xenos, which is sister to M. picturata in the ITS trees, is potentially a natural hybrid between M. picturata and an unspecified Dracula, as it has a Masdevallia habit but the distinctive lip of Dracula composed of a hypochile and an epichile with radiating lamellae. Artificial hybrids between the two genera inherit the Dracula lip and fit this interpretation (C. Head, J & L Orchids, Easton, Connecticut, USA, personal communication). The lack of ITS sequence heterogeneity for D. xenos may mean that through gene conversion the maternal ITS pattern has been retained, which would explain why the same position for D. xenos appears in plastid DNA results. The other interpretation is that it indeed is a species of Masdevallia that independently developed the Dracula-type lip; given the high homoplasy observed in orchid floral morphology, especially in this subtribe, this is a viable hypothesis. Although there is a low level of molecular divergence among the species of Masdevallia, we are not proposing further changes to the finely split subgeneric classification of Luer (1986b, 2000b). Erection of such a complicated subgeneric classification appears to us as unnecessary and unlikely to reflect evolutionary patterns, leading us to question as well its accuracy and therefore the utility of such a complex infrageneric scheme. However, there is no justification for the erection of the monospecific genus Jostia (Luer, 2000b) to accommodate M. teaguei solely on the basis of its sensitive lip, a feature that has arisen independently as many as four times in clades E, F, and H (Fig. 7). Much the same holds true for the infrageneric scheme of Dracula, well represented in this study. Masdevallia erinacea is one of five species in subgenus Masdevallia sect. Pygmaeae (Luer, 1986b) distinguished from other species of Masdevallia by possessing carinate and echinate or papillose ovaries. In the large ITS study (Fig. 3) here, M. erinacea is sister to Dracula–Masdevallia–Porroglossum; it and its relatives warrant generic status if Masdevallia is to remain monophyletic. Conclusions—This is the first extensive molecular phylogenetic study of subtribe Pleurothallidinae. In this analysis, we have been able to assess generic circumscriptions with hundreds of characters and produce trees for which internal support can be assessed rather than relying on a few characters selected a priori for reasons that are subjective and inconsistent. Just as important, we can now reorganize the highly polyphyletic taxa under the umbrella of Pleurothallis and bring order to an artificial megagenus and a subtribe that have confounded taxonomists since the time of Lindley. The minimal divergence among the various subgenera, sections, and even series of Pleurothallis, Masdevallia, and Dracula blurs the distinctions among them and makes them useful as categories only for identification purposes, which should not be misinterpreted as reflecting biological relationships. In a companion paper submitted for publication elsewhere we make the nomenclatural changes supported by these studies. LITERATURE CITED ACKERMAN, J. D. 1995. An orchid flora of Puerto Rico and the Virgin Islands. New York Botanical Garden, Bronx, New York, USA. BAKER, R. K. 1972. Foliar anatomy of the Laeliinae (Orchidaceae). Ph.D. dissertation, Washington University, St. Louis, Missouri, USA. BAKKER, F. T., A. CULHAM, R. GOMEZ-MARTINEZ, J. CARVALHO, J. COMP-

December 2001] TON,

PRIDGEON


R. DAWTREY, AND M. GIBBY. 2000. Patterns of nucleotide substitution in angiosperm cpDNA trnL (UAA)-trnF (GAA) regions. Molecular Biology and Evolution 17: 1146–1155. BALDWIN, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the Compositae. Molecular Phylogenetics and Evolution 1: 3–16. BATEMAN, R. M., A. M. PRIDGEON, AND M. W. CHASE. 1997. Phylogenetics of subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 2. Infrageneric relationships and reclassification to achieve monophyly of Orchis sensu stricto. Lindleyana 12: 113–141. BRIEGER, F. G. 1977. O valor taxonoˆmico do nu´mero de polıńeas de outros caracteres, com refereˆncia especial a`s Pleurothallidinae (Orchidaceae). Trabalhos do XXVI Congresso Nacional de Botaˆnica, 33–46. Academica Brasiliera de Cieˆncias, Rio de Janeiro, Brazil. BRUMMITT, R. K., AND C. E. POWELL. 1992. Authors of plant names. Royal Botanic Gardens, Kew, UK. CAMERON, K. M., AND M. W. CHASE. 1999. Phylogenetic relationships of Pogoniinae (Vanilloideae, Orchidaceae): an herbaceous example of the eastern North America–eastern Asia phytogeographic disjunction. Journal of Plant Research 112: 317–329. CAMERON, K. M., M. W. CHASE, W. M. WHITTEN, P. J. KORES, D. C. JARRELL, V. A. ALBERT, T. YUKAWA, H. G. HILLS, AND D. H. GOLDMAN. 1999. A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of Botany 86: 208–224. CHASE, M. W., K. M. CAMERON, H. G. HILLS, AND D. JARRELL. 1994. DNA sequences and phylogenetics of the Orchidaceae and other lilioid monocots. In A. M. Pridgeon [ed.], Proceedings of the 14th World Orchid Conference, 61–73. HMSO (Her Majesty’s Stationery Office), Edinburgh, UK. CHASE, M. W., AND H. G. HILLS. 1992. Orchid phylogeny, flower sexuality, and fragrance-seeking. BioScience 42: 43–49. COX, A. V., A. M. PRIDGEON, V. A. ALBERT, AND M. W. CHASE. 1997. Phylogenetics of the slipper orchids (Cypripedioideae, Orchidaceae): nuclear rDNA ITS sequences. Plant Systematics and Evolution 208: 197– 223. DOUZERY, E. J. P., A. M. PRIDGEON, P. KORES, H. P. LINDER, H. KURZWEIL, AND M. W. CHASE. 1999. Molecular phylogenetics of Diseae (Orchidaceae): a contribution from nuclear ribosomal ITS sequences. American Journal of Botany 86: 887–899. DOYLE, J. J., AND J. L. DOYLE. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. DRESSLER, R. L. 1981. The orchids: natural history and classification. Harvard University Press, Cambridge, Massachusetts, USA. DRESSLER, R. L. 1993. Phylogeny and classification of the orchid family. Harvard University Press, Cambridge, Massachusetts, USA. FARRIS, J. 1969. A successive approximations approach to character weighting. Systematic Zoology 18: 374–385. FELSENSTEIN, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. FITCH, W. M. 1971. Toward defining the course of evolution: minimum change for a specific tree topology. Systematic Zoology 20: 406–416. FREUDENSTEIN, J., AND F. N. RASMUSSEN. 1999. What does morphology tell us about orchid relationships? A cladistic analysis. American Journal of Botany 86: 225–248. FREUDENSTEIN, J. V., D. M. SENYO, AND M. W. CHASE. 2000. Mitochondrial DNA and relationships in the Orchidaceae. In K. L. Wilson and D. A. Morrison [eds.], Monocots: systematics and evolution, 421–429. CSIRO Publishing, Collingwood, Victoria, Australia. GARAY, L. A. 1979. Systematics of the genus Stelis Sw. Botanical Museum Leaflets of Harvard University 27: 167–259. GENTRY, A. 1982. Neotropical floristic diversity: phytogeographical connections between Central and South America, Pleistocene climatic fluctuations, or an accident of the Andean orogeny? Annals of the Missouri Botanical Garden 69: 557–593. HILLIS, D. M. 1998. Taxonomic sampling, phylogenetic accuracy, and investigator bias. Systematic Biology 47: 3–8. JOHNSON, L. A., AND D. E. SOLTIS. 1995. Phylogenetic inference in Saxifragaceae sensu stricto and Gilia (Polemoniaceae) using matK sequences. Annals of the Missouri Botanical Garden 82: 149–175. JOHNSON, L. A., AND D. E. SOLTIS. 1998. Assessing congruence: empirical examples from molecular data. In D. E. Soltis, P. S. Soltis, and J. J. Doyle [eds.], Molecular systematics of plants II: DNA sequencing, 297– 343. Kluwer Academic, Boston, Massachusetts, USA.


2307

KORES, P. J., K. M. CAMERON, M. MOLVRAY, AND M. W. CHASE. 1997. The phylogenetic relationships of Orchidoideae and Spiranthoideae (Orchidaceae) as inferred from rbcL plastid sequences. Lindleyana 12: 1–11. KORES, P. J., M. MOLVRAY, S. HOPPER, P. WESTON, A. BROWN, K. M. CAMERON, AND M. W. CHASE. In press. A molecular phylogeny of Diurideae (Orchidaceae) based on DNA sequence data. American Journal of Botany 88: 1903–1914. LINDLEY, J. 1859. Folia Orchidacea. J. Mathews, London, UK. LUER, C. A. 1986a. Icones Pleurothallidinarum I. Systematics of the Pleurothallidinae (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 15. LUER, C. A. 1986b. Icones Pleurothallidinarum II. Systematics of Masdevallia (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 16. LUER, C. A. 1986c. Icones Pleurothallidinarum III. Systematics of Pleurothallis (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 20. LUER, C. A. 1987. Icones Pleurothallidinarum IV. Systematics of Acostaea, Condylago, and Porroglossum (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 24. LUER, C. A. 1988. Icones Pleurothallidinarum V. Systematics of Dresslerella and Scaphosepalum (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 26. LUER, C. A. 1989. Icones Pleurothallidinarum VI. Systematics of Pleurothallis subgenus Ancipitia, subgenus Scopula, and Trisetella (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 31. LUER, C. A. 1990. Icones Pleurothallidinarum VII. Systematics of Platystele (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 38. LUER, C. A. 1991. Icones Pleurothallidinarum VIII. Systematics of Lepanthopsis, Octomeria subgenus Pleurothallopsis, Restrepiella, Restrepiopsis, Salpistele, and Teagueia (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 39. LUER, C. A. 1992. Icones Pleurothallidinarum IX. Systematics of Myoxanthus (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 44. LUER, C. A. 1993. Icones Pleurothallidinarum X. Systematics of Dracula (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 46. LUER, C. A. 1994. Icones Pleurothallidinarum XI. Systematics of Lepanthes subgenus Brachycladium and Pleurothallis subgenus Aenigma, subgenus Elongatia, subgenus Kraenzlinella (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 52. LUER, C. A. 1996. New species of Pleurothallis (Orchidaceae) from Ecuador. Lindleyana 11: 141–197. LUER, C. A. 1997. Icones Pleurothallidinarum XV. Systematics of Trichosalpinx (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 64. LUER, C. A. 1998a. Icones Pleurothallidinarum XVI. Systematics of Pleurothallis subgenera Crocodeilanthe, Rhynchopera, Talpinaria (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 65. LUER, C. A. 1998b. Icones Pleurothallidinarum XVII. Systematics of subgen. Pleurothallis sect. Abortivae, sect. Truncatae, sect. Pleurothallis, subsect. Acroniae, subsect. Pleurothallis, subgen. Dracontia, subgen. Unciferia (Orchidaceae). Monographs in Systematic Botany from the Missouri Botanical Garden, 72. LUER, C. A. 1999. Icones Pleurothallidinarum XVIII. Systematics of Pleurothallis subgen. Pleurothallis sect. Pleurothallis subsect. Antenniferae, subsect. Longiracemosae, subsect. Macrophyllae-Racemosae, subsect. Perplexae, subgen. Pseudostelis, subgen. Acuminatia. Monographs in Systematic Botany from the Missouri Botanical Garden, 76. LUER, C. A. 2000a. Icones Pleurothallidinarum XIX. Systematics of Masdevallia Part One. Monographs in Systematic Botany from the Missouri Botanical Garden, 77. LUER, C. A. 2000b. Icones Pleurothallidinarum XX. Systematics of Jostia, Andinia, Barbosella, Barbrodia, and Pleurothallis subgen. Antilla, subgen. Effusia, subgen. Restrepioidia. Monographs in Systematic Botany from the Missouri Botanical Garden, 79. MADDISON, W. P., AND D. R. MADDISON. 1997. MacClade: analysis of phylogeny and character evolution, version 3.07. Sinauer, Sunderland, Massachusetts, USA.

2308

AMERICAN JOURNAL

NANDI, O., M. W. CHASE, AND P. K. ENDRESS. 1998. A combined cladistic analysis of angiosperms using rbcL and non-molecular data sets. Annals of the Missouri Botanical Garden 85: 137–212. NEYLAND, R., L. E. URBATSCH, AND A. M. PRIDGEON. 1995. A phylogenetic analysis of subtribe Pleurothallidinae (Orchidaceae). Botanical Journal of the Linnean Society 117: 13–28. NIR, M. A. 1997. The genera Dilomilis Raf. and Tomzanonia, gen. nov. Lindleyana 12: 180–187. OLMSTEAD, R. G., P. A. REEVES, AND A. C. YEN. 1998. Patterns of sequence evolution and implications for parsimony analysis of choroplast DNA. In D. E. Soltis, P. S. Soltis, and J. J. Doyle [eds.], Molecular systematics of plants II: DNA sequencing, 164–187. Kluwer Academic, Boston, Massachusetts, USA. PRIDGEON, A. M. 1982. Diagnostic anatomical characters in the Pleurothallidinae (Orchidaceae). American Journal of Botany 69: 921–938. PRIDGEON, A. M., R. M. BATEMAN, A. V. COX, J. R. HAPEMAN, AND M. W. CHASE. 1997. Phylogenetics of subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 1. Intergeneric relationships and polyphyly of Orchis sensu lato. Lindleyana 12: 89–109. PRIDGEON, A. M., AND M. W. CHASE. 1998. Phylogenetics of subtribe Catasetinae (Orchidaceae) from nuclear and chloroplast DNA sequences. In C. E. B. Pereira [ed.], Proceedings of the 15th World Orchid Conference, 275–281. Naturalia Publications, Turriers, France. PRIDGEON, A. M., AND W. L. STERN. 1982. Vegetative anatomy of Myoxanthus (Orchidaceae). Selbyana 7: 55–63. PRIDGEON, A. M., AND W. L. STERN. 1983. Ultrastructure of osmophores in Restrepia (Orchidaceae). American Journal of Botany 70: 1233–1243. PRIDGEON, A. M., AND W. L. STERN. 1985. Osmophores of Scaphosepalum (Orchidaceae). Botanical Gazette 146: 115–123. PRIDGEON, A. M., AND N. H. WILLIAMS. 1979. Anatomical aspects of Dresslerella. Selbyana 5: 120–134. QIU, Y.-L., J. LEE, F. BERNASCONI-QUADRONI, D. E. SOLTIS, P. S. SOLTIS, M. ZANIS, E. A. ZIMMER, Z. CHEN, V. SAVOLAINEN, AND M. W. CHASE. 1999. The earliest angiosperms: evidence from mitochondrial, plastid and nuclear genomes. Nature 402: 404–407. RUDALL, P. J., M. W. CHASE, D. F. CUTLER, J. RUSBY, AND A. Y. DE BRUIJN. 1998. Anatomical and molecular systematics of Asteliaceae and Hypoxidaceae. Botanical Journal of the Linnean Society 127: 1–42. RUDALL, P. J., K. L. STOBART, W.-P. HONG, J. G. CONRAN, C. A. FURNESS, G. C. KITE, AND M. W. CHASE. 2000. Consider the lilies: systematics of Liliales. In K. L. Wilson and D. A. Morrison [eds.], Monocots: systematics and evolution, 347–359. CSIRO Publishing, Collingwood, Victoria, Australia.

OF

BOTANY

[Vol. 88

RYAN, A., W. M. WHITTEN, M. A. T. JOHNSON, AND M. W. CHASE. 2000. A phylogenetic assessment of Lycaste and Anguloa (Orchidaceae: Maxillarieae). Lindleyana 15: 33–45. SAVOLAINEN, V., M. W. CHASE, S. B. HOOT, C. MORTON, D. E. SOLTIS, C. BAYER, M. F. FAY, A. Y. DE BRUIJN, S. SULLIVAN, AND Y.-L. QIU. 2000. Phylogenetics of flowering plants based on combined analysis of plastid atpB and rbcL gene sequences. Systematic Biology 49: 306–362. SEELANEN, T., A. SCHNABEL, AND J. F. WENDEL. 1997. Congruence and consensus in the cotton tribe (Malvaceae). Systematic Botany 22: 259–290. SOLTIS, P. S., D. E. SOLTIS, AND M. W. CHASE. 1999. Angiosperm phylogeny inferred from multiple genes as a tool for comparative biology. Nature 402: 402–404. STENZEL, H. In press. Sporoderm evolution in subtribe Pleurothallidinae Lindl. (Orchidaceae) and its systematic significance.Grana. STERN, W. L., A. M. PRIDGEON, AND C. A. LUER. 1985. Stem structure and its bearing on the systematics of Pleurothallidinae (Orchidaceae). Botanical Journal of the Linnean Society 91: 457–471. SUN, Y., D. Z. SKINNER, G. H. LIANG, AND S. H. HULBERT. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26–32. SWOFFORD, D. L. 2000. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4 beta 3a. Sinauer, Sunderland, Massachusetts, USA. TABERLET, P., L. GIELLY, G. PAUTOU, AND J. BOUVET. 1991. Universal primers for amplication of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. THOMPSON, J. D., D. G. HIGGINS, AND T. J. GIBSON. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position, specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. VAN DEN BERG, C. 2000. Molecular phylogenetics of tribe Epidendreae with emphasis on subtribe Laeliinae (Orchidaceae). Ph.D. dissertation, University of Reading, Reading, UK. VAN DEN BERG, C., W. E. HIGGINS, R. L. DRESSLER, W. M. WHITTEN, M. A. SOTO ARENAS, A. CULHAM, AND M. W. CHASE. 2000. A phylogenetic analysis of Laeliinae (Orchidaceae) based on sequence data from nuclear transcribed spacers (ITS) of ribosomal DNA. Lindleyana 15: 96–114. WHITTEN, W. M., N. H. WILLIAMS, AND M. W. CHASE. 2000. Subtribal and generic relationships of Maxillarieae (Orchidaceae) with emphasis on Stanhopeinae: combined molecular evidence. American Journal of Botany 87: 1842–1856. WIENS, J. J. 1998. Combining data sets with different phylogenetic histories. Systematic Biology 47: 568–581.