Arch Virol (2008) 153:823–830 DOI 10.1007/s00705-008-0053-6
ORIGINAL ARTICLE
Phylogeny and molecular genetic parameters of different stages of hepatitis B virus infection in patients from the Brazilian Amazon Cı´ntia Mara de Oliveira Æ Izeni Pires Farias Æ Jose´ Carlos Ferraz da Fonseca Æ Leila Melo Brasil Æ Rita de Souza Æ Spartaco Astolfi-Filho
Received: 2 September 2007 / Accepted: 4 January 2008 / Published online: 21 February 2008 Ó Springer-Verlag 2008
Abstract A fragment of 600 bp of the gene which codes for the surface antigen of hepatitis B virus (HBV) was amplified and sequenced from patients who were born in five states of the Brazilian Amazon (Amazonas, Para´, Acre, Rondoˆnia and Tocantins). A total of 44 sequences were used for the estimation of molecular genetic parameters and phylogenetic analyses. Compared with patients who were asymptomatic, those who had acute hepatitis and chronic liver disease had higher levels of genetic variability and higher rates of nucleotide substitutions. The analysis of transition and transversion substitutions showed that transition-type substitutions predominated. In chronic liver disease carriers, transversion-type substitutions showed phylogenetic saturation. In general, all of the analyses carried out in this study showed an association between patterns of changes in molecular genetic parameters and the stage of disease progression. Phylogenetic analysis using the HKY85 model of evolution identified 41 individuals as genotype
C. M. de Oliveira S. Astolfi-Filho Centro de Apoio Multidisciplinar, Instituto de Cieˆncias Biolo´gicas, Universidade Federal do Amazonas, Manaus, AM, Brazil I. P. Farias (&) Laborato´rio de Evoluc¸a˜o e Gene´tica Animal, Instituto de Cieˆncias Biolo´gicas, Universidade Federal do Amazonas, Manaus, AM, Brazil e-mail:
[email protected] J. C. F. da Fonseca L. M. Brasil R. de Souza Gereˆncia de Virologia, Fundac¸a˜o de Medicina Tropical, Manaus, AM, Brazil
A, suggesting its predominance in the Amazon region, one individual as genotype C, and one individual closely related to genotypes E and F.
Introduction Hepatitis B virus (HBV) is a significant agent causing one of the most important health problems in the world. HBV belongs to the family Hepadnaviridae, genus Orthohepadnavirus. The virus has a diameter of 42 nm and a circular and extremely compact genome. The viral DNA is partially double-stranded, with approximately 3.2 Kb [4]. Four open reading frames (ORF) are encoded by the genome-preS/S, preC/C, P and X. The S gene consists of three proteins (large L, medium M and small S). The S protein, which codes for the surface antigen HBsAg, is the most abundant protein on the surface of the virus and contains 226 amino acids [4, 8]. The first classifications of HBV strains were based on the subtype of the surface HBsAg antigen. Based on this system, new serum types were called ayw1, ayw2, ayw3, ayw4, ayr, adw2, adw4-, adrq+ and adrq-, according to the antigenic determinants and subdeterminants of HBsAg [3]. The presence of these subtypes varies according to geographic location. In Brazil, subtypes adw1, adw2, adw3 and adw4 are the most common [23]. Hepatitis B virus can also be classified into genotypes, with eight genomic groups described up to now (A–H) [25, 32]. These genotypes were defined based on the analysis of intra- and inter-group divergence of the nucleotide sequences of the complete viral genome, which ranges from 8 to 17% [26]. Identification of the different HBV genotypes is obtained from the sequence of the surface
123
824
gene (S) [24] or from that of genes S and C [5]. The worldwide diversity of HBV genotypes is very distinct; for a recent overview see Norder et al. [25]. Besides genotype and sub-genotype classification, the analysis of nucleotide sequences of the HBV genome enables one to correlate the clinical significance between genotypes and serum markers [18, 20, 24, 32]. Genotype B is frequently associated with the absence of the HBeAg marker; genotypes A and C are usually found in HBeAg+ individuals, and genotype C is frequently associated with chronic hepatitis, cirrhosis and hepatocellular carcinoma caused by HBV [14]. In the present study, molecular analyses of 44 partial nucleotide sequences of the surface HBV gene of asymptomatic HBsAg carriers (HBsAg+; HBeAg negative and asymptomatic), acute hepatitis B patients (anti-HBc IgM+) and chronic HBV carriers (anti-HBe or anti-HBcTotal+) were used to estimate the genetic divergence and genetic variability of the HBV strains obtained from patients who were born in the Brazilian Amazon region. Phylogenetic analyses were also carried out incorporating homologous sequences of genotypes A-H obtained from the GenBank database.
Materials and methods Patients Serum samples obtained from 44 HBV patients were used, of which 18 were asymptomatic HBsAg carriers (Asym), 12 had acute hepatitis (Acut), and 14 were chronic hepatic patients (Chro). These groups were defined according to the following criteria: Asymptomatic HBsAg carriers Lack of symptoms; serological presence of HbsAg for a period longer than 6 months; serological absence of HBeAg or anti-HBe; normal levels of transaminases for a period of 6 months. The timing (age) of how long ago the patients were infected was unknown considering the asymptomatic aspects of the disease. Acute hepatitis B patients Presence of symptoms; high levels of alanine and aspartate aminotransferase (ALT and AST); serological presence of HBsAg and anti-HBc IgM. Patients diagnosed as acute were within the first 6 months of showing disease symptoms.
123
Arch Virol (2008) 153:823–830
Chronic hepatitis B patients Presence of symptoms; serological presence of HBsAg, HBeAg and anti-HBe; aminotransferases altered; liver biopsies showing presence of inflammatory and necropsy processes. Based on medical records, chronic patients had been showing disease symptoms for over 6 months. Samples were collected from 1999 to 2000 at Fundac¸a˜o de Medicina Tropical do Amazonas (FMTAM), after obtaining written permission from patients. Patients were of both sexes, were all born in the Brazilian Amazon region with relatives also born in the Brazilian Amazon, had positive HBsAg, anti-HBc IgM, anti-HBe or anti-HBcTotal markers, and were negative for other hepatic viruses such as HCV and HDV. Extraction of HBV DNA Viral nucleic acids were extracted using a modified version of the method described by Karasawa et al. [15]. Two hundred fifty microliters of plasma was added to 71 lL of a solution containing 50 lL of proteinase K (10 mg/mL), 3.0 lL of Tris–HCl (1M), 3.0 lL of EDTA (0.5 M), and 15 lL of 10% SDS. Samples were incubated for 1 h at 42°C. The lysed material was then extracted once using phenol and twice using hydrated chloroform (1:1). The DNA was precipitated with 100% ethanol, and the pellet was dissolved in 20 lL of Buffer R (5 mM Tris, 0.1 mM EDTA) and stored at -20°C. PCR amplification The surface gene S was amplified using primers PS1 (50 CCATATTCTTGGGAACAAGA 0 3), P1 (50 TGCCTC TCACATCTCGTCAA 0 3) and S2 (50 GGGTTTAAATGT ATACCCAAAGA 0 3), as reported by Moraes et al. [21] according to the following nested PCR steps: First amplification (PCR) Forty-seven microliters of mix and 3 lL of DNA solution were added to each microtube. The mix contained 109 PCR buffer at pH 8.5, dNTP mix (2.5 mM each), MgCl2 (25 mM), 3.0 pmol/lL of each of the PS1 and S2 primers, Taq DNA polymerase (0.8 U/lL) and Milli-Q water. After adding the mix, samples were subjected to PCR amplification in a Perkin–Elmer 9600 thermocycler with the following steps: 92°C for 2 min for initial denaturing, and 35 cycles at 92°C for 1 min, 55°C for 1 min and 72°C for 2 min, followed by a final elongation at 72°C for 5 min.
Arch Virol (2008) 153:823–830
Second amplification (semi-nested PCR) The mix of the second amplification was prepared in the same way as the first one, adding 1 lL of the product obtained from the first round of PCR and the P1 and S2 primers. Amplification was carried out using the same program as for the first amplification.
825
F (X69798, adw4), G (AF160501) and H (AB059660). Non-human sequences of orangutans were used as an outgroup (AF193863, AF193864). Analyses were carried out using the programs MrBayes v.3 [13]. Bayesian support values are calculated automatically during tree reconstruction. One million replicates were used with no burn-in trees discarded for calculation of support values.
DNA sequencing Results The DYEnamicTM ET terminator kit for MegaBACE (GE Healthcare) was used for sequencing PCR products following manufacturer’s instructions. The volume of each reaction was 20 lL with the following components: 1.0 lL of oligonucleotide P1 (5.0 pmol/lL), 3.0 lL of Milli-Q water, 8.0 lL of sequencing solution and 8.0 lL of purified DNA. The sequencing reaction mix was cycled in a MJ Research PTC-200 thermocycler using the following program: 95°C for 20 s for denaturing, 50°C for 15 s for annealing and 60°C for 1 min for extension for a total of 25 cycles. Sequencing was carried out in an automatic MegaBACE 1000 automatic sequencer (GE Healthcare). Data analysis Revision of the nucleotide sequences was carried out using the BioEdit program version 5.0.6 [10]. Sequences were then submitted to the BLAST program in order to check their similarity to other HBV strains deposited in the GenBank. Rates of molecular patterns were obtained using parameters such as the transition (ts) and transversion (tv) rates, the average nucleotide changes per site, and the value of the gamma parameter. Phylogenetic analyses were carried out using the Bayesian Likelihood (BL) and Minimum Evolution (ME) methods. The gamma corrected HKY85 model of molecular evolution [9, 12, 34] was suggested as the most appropriate model by the software ModelTest 3.0 [30]. Program DAMBE [33] was used to plot the saturation graphs. For each group analyzed, the number of transitions and transversions was plotted against total sequence divergence for all pairwise comparisons of data using the program DAMBE [33]. The program DAMBE does not implement the HKY85 model, therefore we used the equivalent F84 model of molecular evolution [7]. The genotypes were assigned to known groups using phylogenetic inference with known genotypes corresponding to the eight HBV genotypes identified in humans and deposited in the GenBank: genotypes A (subgenotype A1 = AF418674, AF297621; subgenotype A2 = AB064314, AF297619), B (D00330 and D00331, both adw2), C (D00630, M38636 and D12980, all adr), D (U55228, U55224 and X59795, all ayw2), E (X75657 and X75664),
Molecular genetic parameters The final alignment of the S region (HBsAg) consisted of a 600-bp fragment. The DNA sequences obtained in this study were deposited in the GenBank under the accession numbers EU264113–EU264156. No insertions or deletions were observed in any of the nucleotide sequences. Table 1 presents the maximum, mean and minimum values of uncorrected ‘‘p’’ distances for each within- and betweengroup comparison. In the intra-group analyses, there was a correlated increase in the variance of rates of molecular changes with progression of the infection (Table 1). We tested if differences in molecular changes found within each group were significantly deferent using ANOVA and pairwise t-tests. There was a significant difference in rates of molecular changes among groups (F307,2 = 21.09, P \ 0.001). Chronic and acute patients had significantly higher rates of molecular genetic changes compared to
Table 1 Genetic distance (uncorrected ‘‘p’’ distance) among and within HBV groups Inactive carriers
Acute carriers
Chronic carriers
Genetic distance (uncorrected ‘‘p’’ distance) within groups Average = 0.95%
Average = 1.47%
Average = 1.84%
SD = 0.56%
SD = 0.88%
SD = 1.63%
Variance = 0.003%
Variance = 0.008%
Variance = 0.026%
Maximum = 2.2% Minimum = 0
Maximum = 3.5% Minimum = 0
Maximum = 5.8% Minimum = 0
Inactive 9 Acute
Inactive 9 Chronic
Acute 9 Chronic
Genetic distance (uncorrected ‘‘p’’ distance) among groups Average = 0.8%
Average = 0.9%
Average = 1.1%
SD = 0.79%
SD = 1.05%
SD = 1.21%
Variance = 0.006%
Variance = 0.011%
Variance = 0.014%
Maximum = 3.5%
Maximum = 5.1%
Maximum = 5.7%
Minimum = 0
Minimum = 0
Minimum = 0
Uncorrected ‘‘p’’ distance is the uncorrected number of changes between two sequences SD Standard deviation, p number of nucleotide changes/total sequence length
123
826
Arch Virol (2008) 153:823–830
asymptomatic carriers (P \ 0.001, P \ 0.001, respectively), but rates of molecular changes between chronic and acute patients did not differ (P = 0.099). Of the 600 bp analyzed, 59 sites were variable. No difference was observed in the nucleotide composition within or between groups, with a tendency towards cytosine (28%) and thymine (32%), while adenine and guanine each had 20% frequency of occurrence. Base composition was homogeneous in all groups of sequences (v2 = 7.99; df = 132; P [ 0.05). Table 2 presents a summary of the main molecular parameters observed in the different groups studied. In asymptomatic carriers, the transition/ transversion (ts/tv) ratio was 2.38; the average nucleotide changes per site was 0.060 and a = 0.016. In acute hepatitis carriers, the ts/tv ratio was 1.82, the average nucleotide changes per site was 0.07 and a = 0.10. The group of patients with chronic hepatitis had the smallest ts/tv ratio (1.35), the greatest average nucleotide changes per site (0.112), and the largest gamma parameter value (a = 0.83). The a parameter measures how evenly the observed nucleotide changes are distributed in the segment of DNA analyzed [9]. In general, a = 0.5, 1.0 and 2.0 may represent strong, intermediate, and weak heterogeneity of substitutions among sites, respectively. Of the 200 amino acids coded by the 600 bp, there were 42 amino acid changes. A progressive increase in the number of substitutions of amino acids of the synonymous and non-synonymous types in the viral sequences was also observed, starting from the asymptomatic, acute and chronic carrier stages (Table 2), respectively. All mutations were randomly distributed among the sites of the S gene and could not be related to any of the stages of the disease.
The saturation graphs (number of nucleotide substitutions, transition and tranversions, versus the uncorrected p distance) in each group and as a whole (Fig. 1) indicated that nucleotide substitutions were mainly of the transition type. No saturation was observed in asymptomatic and acute carriers; however, chronic carriers clearly showed a very unusual saturation at transversions after 4% of sequence divergence. The estimated ts/tv ratio also decreased as a result of the faster accumulation of transversion substitutions from asymptomatic to chronic carriers (Table 2). Phylogenetic analysis A Bayesian inference phylogenetic tree (Fig. 2) was obtained using the 44 sequences of this study and an additional 16 sequences corresponding to the 8 HBV genotypes obtained from the GenBank. Based on the phylogenetic analysis, it was not possible to trace any relationship between the sequences and the clinical condition, age, or sex of the patients. A total of 41 of the 44 viral strains formed a clade with the genotype A group without clustering subgenotypes A1 and A2. Neither of these two subgenotypes was related to the different stages of the disease. The other strains formed a clade with genotype C subtype adr (Chro 100) group, genotype D subtype ayw (Acut113) group, and strain Chro10 was closely related to the genotype F and H clades. We were not able to characterize which of our samples belonged to subgenotypes A1 or A2, since the sequence fragment did not included regions in the S gene that differentiate these subgenotypes [25].
Table 2 Estimates of main molecular genetics parameters of the superficial HBV S gene Estimated genetic parameters
Inactive patients
Acute patients
Chronic patients
All groups
Ts/Tv rate (j)
2.38
1.82
1.35
9.67
Proportion of invariable sites (U)
0.83
0.78
0.75
0.68
Gamma shape (a)
0.02
0.10
0.83
0.85
Average number of changes per site
0.06
0.07
0.11
0. 22 0.937 ± 0.026
Gene diversity
0.941 ± 0.043
0.982 ± 0.046
0.942 ± 0.041
Total number of mutations (Eta)
20
27
35
48
Non-synonymous substitutions
10
12
14
27
Synonymous substitutions
10
15
21
21
Nucleotide diversity (per site)
0.0084 ± 0.0015
0.0119 ± 0.0032
0.0120 ± 0.0043
0.0119 ± 0.0065
Theta (per site) from (Eta)
0.01212
0.02004
0.02235
0.02480
Segregating sites (S)
19
23
34
44
The shape parameter a is the inverse of the squared coefficient of variation of the rates of change along a sequence; Gene diversity is equivalent to the expected heterozygosity for diploid data, and it is defined as the probability that two randomly chosen haplotype are different in the sample; Nucleotide diversity (per site) is the average number of nucleotide differences per site between any two DNA sequences chosen randomly from the sample population; Theta (per site) from Eta is an estimator of genetic variability (effective population size times the mutation rate), and is estimated from the infinite-site equilibrium relationship between the number of polymorphic sites (S), the sample size, and h; Segregating sites (S) is a site that is polymorphic in the data
123
Arch Virol (2008) 153:823–830
827
phylogenetic relationships, divergence, epidemiology and subtypes of HBV in humans and in other animals [6, 11, 15–18, 22, 25, 31]. In this study, nucleotide sequence data corresponding to a 600-bp fragment of the S gene of the HBV genome, which codes for the surface HBsAg antigen, isolated from patients in three stages of the disease— asymptomatic carriers, acute hepatitis carriers and chronic liver disease carriers—were used to infer molecular genetic parameters and phylogenetic relationships. Molecular genetic parameters and the stages of the disease
Fig. 1 Substitution pattern of transitions (Ts Cross) and transversions (Tv triangle) for each group of HBV patients (asymptomatic carriers, acute carriers, and chronic carriers). The number of transitions and transverstions is plotted against total sequence divergence (F84 distance) for all pairwise comparisons.
Discussion Studies based on nucleotide sequence or amino acid analyses of HBV have provided important information about
Studies of molecular genetic patterns of HBV at different stages of the disease are very important since they provide a better understanding of the different stages of disease progression as well as the evolutionary history of this organism during the infection and subsequent incubation period [2, 11]. In Fig. 1, which shows a graph of transitional and transversional changes plotted against the uncorrected ‘‘p’’ distance, it is clear that nucleotide substitutions of the transition type predominate, which is similar to what is observed in other organisms [19]. However, when the groups are analyzed separately, differences in the molecular genetic changes of the viral strains were noted, depending on the stage of the disease. In the strains of asymptomatic and acute carriers, the nucleotide substitution rates were mainly of the transition type and appear to be unsaturated; in the chronic liver disease carrier group there is a clear saturation of the substitution rate of the transversion type over the transition type. This saturation could be a reflection of higher mutation rates (transversion type) observed in this group. According to the literature, regions of the genome which code for proteins are highly protected against mutations [19]. However, among DNA viruses and retroviruses, synonymous and non-synonymous substitution rates can be quite high, especially in regions recognized as antigens, reaching 5 9 10-5 per site per year [27], with a ratio of 100:88 of synonymous and non-synonymous substitutions [11]. In our results, the ratio of synonymous and non-synonymous substitutions is consistent with the observations of Hannoun et al. [11]; it ranges from 100:100 in asymptomatic carriers through 100:80 in acute carriers to 100:67 in chronic carriers. Thus, while the total number of non-synonymous substitutions increases with the progression of the disease from 10 to 14, the relative frequency of number of sites with amino acid changes decreases with the progression of the disease, due to a disproportionately faster rate of accumulation of synonymous substitutions (Table 2). In general, all of the analyses carried out in this study showed an association between the pattern of changes in molecular genetic parameters and the stage of disease
123
828
Arch Virol (2008) 153:823–830
Fig. 2 Bayesian inference tree on HBV gene data obtained using the HKY85-C model of molecular evolution. Data are based on 44 individuals analyzed and include representative sequences from genotypes A–H obtained from GenBank (in bold). Numbers above branches are Bayesian support values. Only values above 50% are shown. The OTUS represents the group of each HBV patient, as follows: asymptomatic carriers (Asym), acute carriers (Acut), and chronic carriers (Chro)
progression (Table 2). In our study, we also noted that virulence time is important and probably directly related to rates of genetic variability observed in each group. Once HBV escapes the immune system, the observed rates of molecular changes increase. Clinically, these patients also enter the acute and chronic stages of the disease, and their viral load remains unchecked by their immune system. The analysis of genetic diversity showed that the sequences studied have very distinct levels of molecular genetic variability. Among the strains isolated from
123
asymptomatic carriers, the intra-group genetic divergence varied from 0 to 2.2% (mean = 0.95%). Among the strains isolated from acute hepatitis carriers and from chronic liver disease carriers, these values varied from 0 to 3.5% (mean = 1.47%) and from 0 to 5.8% (mean = 1.84%), respectively, clearly showing that the strains isolated from chronic liver disease carriers have a greater genetic divergence compared with the strains of other groups, although this difference is not significant when compared to acute carriers. This trend is also observed for other genetic
Arch Virol (2008) 153:823–830
parameters (Table 2). This profile is in agreement with the high replication rate that is characteristic of viruses [27] and the length of time the virus has to evolve within its host. Previous studies by Hannoun et al. [11] had focused on the evolution of HBV in HBeAg-positive, chronic HBV carriers who were mothers, and their children (infected vertically). They found no association between mutations and liver disease and suggested that the entire HBV genome of chronic HBV carriers is extremely stable in the early high-replicative phase, when the immune response is considered to be weak. However, a more recent study by Osiowy et al. [28], analyzing longitudinal HBV molecular genetic variability, used samples of antigen-negative asymptomatic carriers collected over a period of 25 years from the same patients (long-term serial samples) and showed a linear progression of changes over time, albeit not significant. The authors suggested that sequence divergence in HBV may occur more rapidly than previously estimated. Our study sampled many different patients from the three different stages of the disease. It is not a longitudinal or a vertical study, but a sampling that included three independent, different stages of the infection. Despite the fact that we sequenced only the first 600 bp of the S protein gene, the mutations were mainly single point mutations distributed over the entire sequence without an apparent concentration at certain regions. We believe that our data gives an accurate representation of the distribution of mutations within the S protein gene at different stages of disease development. Future studies of HBV molecular genetic variability should include HBsAg carriers, acute hepatitis and chronic hepatic patients sampled over time and throughout the progression of each stage of the disease. Molecular phylogeny The distribution of HBV genotype diversity is very different throughout the world, with some genotypes being distributed all over the world while others are more restricted [25]. Genotype A is frequently reported to be the most predominant among HBV carriers of northeastern Europe, North America, Central Africa and India; genotypes B and C are predominant in East Asia. Genotype D is found in all continents, with the highest occurrence in southern Europe and the Middle East. Genotype E is almost entirely restricted to West Africa, while genotype F is most predominant in Central and South America [21, 25]. Genotype G has been reported in a few cases in the USA, Mexico and Europe, and the recently described genotype H is found in Nicaragua, Mexico and California [1]. In the Brazilian Amazon, studies on the evolutionary relationships of HBV are non-existent and genotype distribution data are rare. Studies carried out on the Amerindian population of the Amazon region identified
829
genotype F as being predominant in these populations [20]. However, in Amazonas State in particular, no other study has been carried out to identify which HBV genotypes occur in the general population. In our study, genotype A was found in 41 of the 44 samples analyzed (Fig. 2). Samples Chro100 and Acut113 were identified as belonging to genotype C subtype adr and genotype D, respectively, while Chro10 was relatively divergent but most closely related to genotypes F and H. Strain Chro100 was isolated from an anti-HBe positive patient. Genotype C is predominant in East and Southeast Asia (Indonesia, China, Korea, Japan and Vietnam), which are areas with a high prevalence of HBV and where infected individuals present a long period of positive HBeAg or the presence of hepatic cirrhosis [29]. This genotype could have been introduced into the Amazonian population from the large Japanese communities in the Amazon and in Brazil in general. The genotype Chro10 is related to genotype F, which is predominant in the aboriginal populations of the Americas, and to the recently described genotype H from Nicaragua and Mexico [25]. This strain could potentially represent a novel New World genotype. However, additional studies are necessary. The presence of genotype D in the Amazon region is probably due to the migration of people from the south and southeastern regions of Brazil, areas were genotype D is reported to be the most frequent, to the Amazon [21]. Populations of southern and southeastern Brazil are predominantly of European origin, and genotype D is endemic to the Old World. Even though the number of samples analyzed in this study is not large, we believe it provides a general assessment of the HBV genotypic profile of the Amazonian region, and the observed genotypes (A, D and C) are in agreement with the genotype distribution of this virus in Brazil [21, 23]. Acknowledgments This work was supported by Universidade Federal do Amazonas. The authors are grateful to Fundac¸a˜o de Medicina Tropical do Amazonas for technical assistance, samples and collaborations. Permission to collect blood samples have been granted by Comiteˆ de E´tica em Pesquisa da Fundac¸a˜o de Medicina Tropical do Amazonas (FMTAM) (License No. 158/99). We thank Tomas Hrbek and two anonymous referees for comments and suggestions on the manuscript. This work forms a portion of C.M.C.O. Ph D thesis at the Biotechnology program of Universidade Federal do Amazonas.
References 1. Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO (2002) A new Amerindian genotype of hepatitis B virus revealed in Central America. J Gen Virol 83:2059–2073 2. Bowyer SM, Sim GM (2000) Relationships within and between genotypes of hepatitis B virus at points across the genome: footprints of recombination in certain isolates. J Gen Virol 81:379–392
123
830 3. Courouce´-Pauty AM, Plancon A, Soulier JP (1983) Distribution of HBsAg subtypes in the world. Vox Sang 44:197–211 4. Dane DS, Cameron CH, Briggs M (1970) Virus-like particles in serum of patients with Australia-antigen associated hepatitis. Lancet 1:695–698 5. Dumpis U, Holmes EC, Mendy M, Hill A, Thursz M, Hall A, Whittle H, Karayiannis P (2001) Transmission of hepatitis B virus infection in Gambia families revealed by phylogenetic analysis. J Hepatol 35:99–104 6. Fares M, Holmes E (2002) A revised evolutionary history of hepatitis B virus (HBV). J Mol Evol 54:807–814 7. Felsenstein J (2004) Inferring phylogenies. Sinauer Associates, Inc., Sunderland 8. Ganem D, Varmus HE (1987) The molecular biology of the hepatitis B viruses. Annu Rev Biochem 56:651–693 9. Gu X, Fu YX, Li WH (1995) Maximum likelihood estimation of the heterogeneity of substitution rate among nucleotide sites. Mol Biol Evol 12:546–557 10. Hall T (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 11. Hannoun C, Horal P, Lindh M (2000) Long-term mutation rates in the hepatitis B virus genome. J Gen Virol 81:75–83 12. Hasegawa M, Kishino H, Yano TA (1985) Dating of the human– ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol 22:160–174 13. Huelsenbeck JP, Ronquist FR (2001) MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754–755 14. Kao JH, Chen PJ, Lai MY, Chen DS (2002) Genotypes and clinical phenotypes of hepatitis B virus in patients with chronic hepatitis B virus infection. J Clin Microbiol 40:1207–1209 15. Karasawa T, Aizawa Y, Zeniya M, Kuramoto A, Shirasawa T, Toda G (1995) Genetic heterogeneity in the precore region of hepatitis B virus in hepatitis B e antigen-negative chronic hepatitis B patients: spontaneous seroconversion and interferoninduced seroconversion. J Med Virol 45:373–380 16. Kidd-Ljunggren K, Miyakawa Y, Kidd A (2002) Genetic variability in hepatitis B viruses. J Gen Virol 83:1267–1280 17. Kramvis A, Weitzmann L, Owiredu WKBA, Kew M (2002) Analysis of the complete genome of subgroup A0 hepatitis B virus isolates from South Africa. J Gen Virol 83:835–839 18. Lauder IJ, Lin HJ, Lau JYN, Siu TS, Lai CL (1993) The variability of the Hepatitis B virus genome: statistical analysis and biological implicationsNor. Mol Biol Evol 10:457–470 19. Li W-H (1997) Molecular evolution. Sinauer Associates, Sunderland 20. Mangnius LO, Norder H (1995) Subtypes, genotypes and molecular epidemiology of the hepatitis B virus as reflected by sequence variability of the S-gene. Intervirology 38:24–34
123
Arch Virol (2008) 153:823–830 21. Moraes MTB, Gomes SA, Niel C (1996) Sequence analysis of pre-S/S gene of hepatitis B virus strains of genotypes A, D, and F isolated in Brazil. Arch Virol 141:01–07 22. Nakano T, Ling L, Hu X, Mizokami M, Orito E, Shapiro C, Hadler S, Robertson B (2001) Characterization of hepatitis B virus genotype among Yucpa indians in Venezuela. J Gen Virol 82:359–365 23. Niel C, Moraes MTB, Gaspar AMC, Yoshida CFT, Gomes AS (1994) Genetic diversity of hepatitis B virus strains isolated in Rio de Janeiro, Brazil. J Med Virol 44:180–186 24. Norder H, Courouce AM, Magnius LO (1994) Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology 198:489–503 25. Norder H, Courouce´ A, Coursaget P, Echevarria JM, Lee S, Mushahwar IK, Robertson BH, Locarnini S, Magnius LO (2004) Genetic diversity of hepatitis B virus strains derived worldwide: genotypes, subgenotypes, and HBsAg subtypes. Intervirology 47:289–309 26. Okamoto H, Tsuda F, Sakugawa H, Sastrosoewignjo RI, Imai M, Miyakawa Y, Mayumi M (1988) Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes. J Gen Virol 69:2575–2583 27. Orito E, Mizokami M, Ina Y, Moriyama EN, Kameshima N, Yamamoto M, Gojobori T (1989) Host-independent evolution and a genetic classification of the hepadnavirus family based on nucleotide sequences. Proc Natl Acad Sci USA 86:7059–7062 28. Osiowy C, Giles E, Tanaka Y, Mizokami M, Minuk G (2006) Molecular evolution of hepatitis B virus over 25 years. J Virol 80:10307–10314 29. Pan CQ, Zhang JX (2005) Natural history and clinical consequences of hepatitis B virus infection. Int J Med Sci 2:36–40 30. Posada D, Crandall KA (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14:817–818 31. Starkman SE, MacDonald DM, Lewis JCM, Holmes EC, Simmonds P (2003) Geographic and species association of hepatitis B virus genotypes in non-human primates. Virology 314:381–393 32. Stuyver L, De Gendt S, Van Geyt C, Zoulim FZ, Fried M, Schinazi RF, Rossau R (2000) A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J Gen Virol 81:67–74 33. Xia X, Xie Z (2001) DAMBE: data analysis in molecular biology and evolution. J Hered 92:371–373 34. Yang Z (1993) Maximum-likelihood estimation of phylogeny from DNA sequences when substitution rates differ over sites. Mol Biol Evol 10:1396–1401
