Physical mapping of the elephant X chromosome - Springer Link

Chromosome Research (2009) 17:917–926 DOI 10.1007/s10577-009-9079-1

Physical mapping of the elephant X chromosome: conservation of gene order over 105 million years Claudia Leticia Rodríguez Delgado & Paul D. Waters & Clément Gilbert & Terence J. Robinson & Jennifer A. Marshall Graves

Received: 2 July 2009 / Accepted: 1 September 2009 / Published online: 30 September 2009 # Springer Science + Business Media B.V. 2009

Abstract All therian mammals (eutherians and marsupials) have an XX female/XY male sex chromosome system or some variant of it. The X and Y evolved from a homologous pair of autosomes over the 166 million years since therian mammals diverged from monotremes. Comparing the sex chromosomes of eutherians and marsupials defined an ancient X conserved region that is shared between species of these mammalian clades. However, the eutherian X (and the Y) was augmented by a recent addition

Responsible Editor: Fengtang Yang. C. L. Rodríguez Delgado : P. D. Waters (*) : J. A. M. Graves Comparative Genomics Group, Research School of Biology, The Australian National University, GPO Box 475, ACT 2601 Canberra, Australia e-mail: [email protected]

(XAR) that is autosomal in marsupials. XAR is part of the X in primates, rodents, and artiodactyls (which belong to the eutherian clade Boreoeutheria), but it is uncertain whether XAR is part of the X chromosome in more distantly related eutherian mammals. Here we report on the gene content and order on the X of the elephant (Loxodonta africana)—a representative of Afrotheria, a basal endemic clade of African mammals—and compare these findings to those of other documented eutherian species. A total of 17 genes were mapped to the elephant X chromosome. Our results support the hypothesis that the eutherian X and Y chromosomes were augmented by the addition of autosomal material prior to eutherian radiation. Not only does the elephant X bear the same suite of genes as other eutherian X chromosomes, but gene order appears to have been maintained across 105 million years of evolution, perhaps reflecting strong constraints posed by the eutherian X inactivation system.

C. L. Rodríguez Delgado Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca Morelos 62210, México

Keywords sex chromosome evolution . afrotheria . X chromosome . X added region

C. Gilbert : T. J. Robinson Evolutionary Genomics Group, Department of Zoology, University of Stellenbosch, Private Bag X1, Matieland 7602, South Africa

Abbreviations XCR X conserved region XAR X added region YCR Y conserved region YAR Y added region MYA Million years ago PAR Pseudoautosomal region PAB PAR boundary

C. Gilbert Department of Biology, University of Texas at Arlington, P.O. Box 19498, Arlington, TX 76019, USA

918

TDF XCI FISH BAC CHORI VMRC

C.L. Rodríguez Delgado et al.

Testis determining factor X chromosome inactivation Fluorescence in situ hybridization Bacterial artificial chromosome Children's Hospital Oakland Research Institute Virginia Mason Research Center

Introduction Ohno (1967) proposed that the Z and W chromosomes of different snake groups represented evolution of sex chromosomes from a pair of autosomes via degradation of the female-specific W. This hypothesis was subsequently extended to the therian mammals (eutherians and marsupials) that have an XX female/ XY male sex chromosome system, in which the maledominant SRY gene on the Y determines male development. It is now widely accepted that the therian sex chromosomes similarly evolved from a pair of autosomes, via a process of Y degradation after it acquired a testis determining factor (TDF; Charlesworth 1991), probably the SRY gene. Genes conferring a male advantage accumulated near the new TDF, and recombination between the proto X and Y was suppressed, resulting in rapid degradation of the Y. Consequently, all that remains of once extensive homology between the proto-sex chromosomes are 20 X–Y shared genes (Skaletsky et al. 2003) and a small region of homology known as the pseudoautosomal region (PAR), which mediates pairing via an obligatory recombination event at male meiosis. Much has been learned about mammal sex chromosome evolution from comparisons of the X and Y between the three major extant mammal groups: Eutheria (“placental” mammals), Metatheria (marsupials), and Prototheria (monotremes). Eutherians diverged from marsupials ~148 MYA, whereas therians and monotremes diverged approximately ~166 MYA (Fig. 1) (Bininda-Emonds et al. 2007). The recent demonstration that the homolog of the therian X is an autosome in monotremes (Veyrunes et al. 2008; Rens et al. 2007) implies that the proto X and Y arose in a common ancestor to therian mammals after their divergence from monotremes (~166 MYA), but before the marsupial–eutherian divergence (~148 MYA).

Comparisons between marsupial and eutherian sex chromosomes revealed differences in size, morphology, and gene content (Mikkelsen et al. 2007; Deakin et al. 2008). The marsupial X chromosome is homologous to human Xq and proximal Xp, indicating that this region was part of the sex chromosomes before marsupials diverged from eutherians, defining an X conserved region (XCR). However, the rest of human Xp shares homology with at least one marsupial autosome. These blocks of orthology are also separate in monotremes (Veyrunes et al. 2008) and birds (Schmid et al. 2000), suggesting that they were added to the sex chromosomes of eutherian mammals after their divergence from marsupials (148 MYA), defining an X added region (XAR) (Graves 1995). To more clearly define when this addition took place, it is necessary to compare the X chromosomes of different lineages of eutherian mammals. Molecular phylogenetic analyses classified eutherians into four superordinal clades (Waddell et al. 1999; Murphy et al. 2001), two of which, the Supraprimates (primarily represented by rodents and primates) and Laurasiatheria (including bats, carnivores and ungulates) that collectively comprise Boreoeutheria, are thought to have diverged ~91 MYA. There is uncertainty about the positions of Afrotheria (mammals with an African origin) and Xenathra (South American mammals) relative to the remaining supraordinal eutherian clades, generally referred to as the Atlantogenata. Afrotheria was originally suggested to represent the first divergence from other eutherian mammals 105 MYA (Murphy et al. 2001); however, more recent evidence has placed Xenathra and Afrotheria as sister taxa that diverged from each other after the breakup of Gondwana (Hallstrom et al. 2007; Murphy et al. 2007b; Wildman et al. 2007; Waters et al. 2007a) (Fig. 1). There is now indication that the divergence of Afrotheria, Xenarthra, and Boreoeutheria was nearly simultaneous and could represent a soft polytomy (Nishihara et al. 2009; Churakov et al. 2009). Under any of these hypotheses, Afrotheria represent eutherian mammals most distantly related to humans. The gene content of the X chromosome is extremely well conserved between different eutherian mammals, as first predicted by Ohno (1967) who argued that rearrangement of the X with autosomes would disrupt the chromosome-wide X inactivation system. There is an almost identical set of genes on the X of many boreoeutherian species, including

Physical mapping of the elephant X chromosome

919

Fig. 1 Phylogeny showing mammalian relationships and the estimated time of divergence (dates from BinindaEmonds et al. 2007)

human, mouse, dog and cow. This conservation includes genes within both the human XCR and XAR (Raudsepp et al. 2004; Quilter et al. 2002; Murphy et al. 2007a), implying that the XAR was added to the ancient sex chromosomes prior to boreoeutherian radiation ~91 MYA. Reciprocal chromosome painting between elephant, aardvark, and human (Yang et al. 2003) indicates that afrotherian X chromosomes also contain an XAR, but this has yet to be confirmed by gene mapping. Gene order is also highly conserved in boreoeutherian species, with the spectacular exception of rodents (Amar et al. 1988; Waterston et al. 2002; Sandstedt and Tucker 2004), which appear to have undergone changes in gene order. When the X chromosomes of horse, pig, cat and cattle are compared, gene order is almost identical. This implies that the X, unlike the autosomes, has been exempt from internal rearrangements, and might reflect the strictures of the whole X inactivation system. In the absence of gene mapping, however, it is not certain that the X chromosome in afrotherians also maintains this gene order. An answer to this question would provide clues to the evolution of X chromosome inactivation (XCI). Apart from chromosome painting, all that is known about the sex chromosomes of basal eutherians is that the X and Y of Cape rock elephant shrew (an afrotherian) share a PAR, which pairs and recombines at male meiosis. Also, in female cells of afrotherian mammals, the X chromosome displays features of human and mouse X chromosome inactivation (asynchronous replication of the two X chromosomes in female cells, Barr body formation, and L1 accumulation; Waters et al. 2007b). In this study, we use the African savannah elephant (Loxodonta africana; 2n= 56) as our afrotherian

model to map 17 human X chromosome genes. Determining gene content of the elephant X chromosome enabled us to track the evolution of the eutherian X chromosome, and to examine the conservation of gene order. Here we report that the X chromosomes of elephant and human have identical gene contents and gene order, implying conservation between eutherian mammal species separated by 105 million years of evolution.

Materials and methods BAC library screening Elephant specific overgo primers were designed for X genes (Table 1) using trace archive sequence as input to OligoSpawn (Zheng et al. 2006). Overgo probes were used because of their high specificity and decreased background hybridization. Specificity of the overgo probes was checked by searching the elephant trace archive using BLASTN. Selected overgos were radioactively labeled with 32 P-dATP and 32 P-dCTP and hybridized to male elephant BAC library (VMRC-15) filters (BAC PAC Resources, CHORI) in pools of ten according to methods described in Deakin et al. (2007). After hybridization and washes, filters were exposed to X-ray film for 1 week at −80°C. Dot blots were made by growing positive clones overnight at 37°C on Hybond N+ (GE Healthcare) filters placed on agar plates containing 12 μg/ml chloramphenicol. The colonies were then lysed, denatured, neutralized, washed, and fixed to the filters according to the manufacturer’s instructions. The overgo probes were individually hybridized to the

920 Table 1 Overgos used for VMRC-15 library screening to test positive BACs

C.L. Rodríguez Delgado et al. Gene name

Forward overgo 5′–3′

Reverse overgo 5′–3′

XG

ccaccagctacttcacctacaacc

aagcagtttctcctccggttgtag

AMELX

tagacacaaatcactgtgcacttg

act ttcaggaatgacacaagtgca

EIF1AX

acacaatatcaaaattagtataaa

gtagcatgtggctatttttatact

ZFX

tctgtagaagcatggttagggcag

tcataaagaagttggcctgcccta

GK

cttcaaggcgtttgatgttgtgtg

gatgatgtccctttgccacacaac

USP9X

gaaaattatctgggcatcaggatg

tagctgtaatgccccacatcctga

UBA1

aatggcgaagaacggtagtgaagc

gccctcatctatgtctgcttcact

KDM5C

ccccttggtttggatattgggttg

ttctactgcagcacagcaacccaa

HUWE1

ttactaggcaagcccaaagccttc

catccaggaatgctctgaaggctt

AR

atgggcttgactttcccagaaagg

tgcaagtgcccaagatcctttctg

ATRX

tggtacagaagcttcatgacttcc

tctgaggactgtgccaggaagtca

PLP1

tgaggacggcaaagttgtaagtgc

caccttcatgattgctgcacttac

RBMX

aactctgccattgctggccataac

agaggagcaaatccctgttatggc

SOX3

gcaagaccaagactctgctcaaga

agcgagtacttgtccttcttgagc

FMR1

tccaatctgtcgcaactgctcatc

ggagagattacaaattgatgagca

dot blots using the same protocol as for library screening. DNA from positive BAC clones was prepared using the Wizard® Plus SV Minipreps DNA Purification System (Promega), with an adjusted protocol (Waters et al. 2008). Fluorescence in situ hybridization Elephant fibroblasts cell lines were established from elephant ear clips and metaphase chromosomes were set up according to standard protocols (Waters et al. 2008). One microgram of BAC DNA was labeled in a nick translation reaction with digoxigenin-11-dUTP, biotin16-dUTP (Roche Diagnostics, Basel, Switzerland), SpectrumOrange dUTP, or SpectrumGreen dUTP (Enzo Diagnostics, NY, USA). After nick translation, fragment sizes were checked on a 1.0% agarose gel. For each slide, 300 ng of labeled BAC DNA was co-precipitated with 1 μg of sonicated genomic elephant DNA. The pellet was resuspended in 10 μl of hybridization buffer (50% v/v deionized formamide, 10% w/v dextran sulfate, 2× SSC, 1× Denhardt’s solution, and 40 mmol/l sodium phosphate solution) after precipitation. Probes were denatured at 70°C for 10 min, quenched on ice for 2 min and pre-annealed at 37°C for 20–40 min. Slides were dehydrated in 70%, 90%, and 100% ethanol (1 min each), and then denatured at 70°C for 20–25 s in 70% formamide/2× SSC, quenched

in 70% cold ethanol and dehydrated as before. Probes were hybridized to the slides overnight at 37°C. Slides were washed for 2 min in 0.4× SSC, 0.3% Tween 20 at 60°C, and then for 1 min in 2× SSC, 0.1% Tween 20 at room temperature. Slides hybridized with probes labeled with Spectrum Orange/ Green were allowed to dry and mounted with 15µl of Vectashield (Vector Laboratories Inc.) supplemented with 1.5µg/ml of DAPI. After washing, slides hybridized with probes labeled with biotin-16dUTP were treated with blocking solution (5% BSA, 0.1% Tween 20, 4× SSC) at room temperature for 15 min and incubated with 1% avidin–FITC (Vector Laboratories) diluted in blocking solution at 37°C for 45 min, and then washed three times for 5 min in 2× SSC. The signal was amplified by a further 45-min incubation at 37°C with biotinylated antiavidin (Vector Laboratories), washed as before, and a final incubation with avidin–FITC, with the described washes. Slides hybridized with digoxygenin-11-dUTP were blocked as described above and incubated at 37°C for 45 min with sheep anti-digoxygenin-Cy3 (Roche Diagnostics). Slides were dried and mounted with 15µl of Vectashield/ DAPI. Images were captured on a SPOT RT Monochrome CCD (charge-coupled device) camera (Diagnostic Instruments Inc., Sterling Heights, MI, USA) and analyzed in IP lab (Scanalytics Inc., Fairfax, VA, USA).


Results To determine gene content and order on the elephant X chromosome, we isolated and mapped the elephant orthologs of 17 markers along the human X, including 11 from the XCR conserved on the marsupial X and six from the XAR (which are autosomal in marsupials). Eleven of these genes have a functional homolog on the Y chromosome in at least one mammal species. The elephant genome has been sequenced to a 6× coverage, so we performed a nucleotide blast search of the elephant genome sequence (available at http://www. broad.mit.edu/ftp/pub/assemblies/mammals/elephant/) using cDNA sequences of 15 genes distributed along the human X (Table 2). Homologous sequences were used to design species-specific overgo probes (Table 1), which we used to screen the VMRC-15 male elephant BAC library. We obtained 41 positive clones. After dot blot analysis (which has never resulted in the identification of false positive BACs in our lab in the past; Deakin et al. 2008), we identified 28 clones, collectively containing all 15 genes of interest. For genes with more than one positive clone, BAC quality was assessed on an agarose gel and only one was selected for mapping.

921

Two previously sequenced elephant BACs that contained G6PD (accession # AC185202) and XIAP (accession # AC161725) were also included, making a total of 17 genes mapped to the elephant genome. BAC clones were hybridized to male elephant mitotic metaphase chromosomes by DNA FISH to determine gene location (Fig. 2). All 17 genes, including XAR as well as XCR genes, mapped to the elephant X chromosome. We used two-color FISH to confirm gene order and to generate a map of the elephant X (Fig. 3), which we compared to the X of other eutherian mammals. We found that gene order on the elephant X was the same as for the human X. The only difference was that the centromere on the elephant X appears to be shifted compared to the human X, with proximal human Xp gene located on proximal Xq in elephant (Fig. 3). The elephant X map was also compared to the physical map of the marsupial X chromosome. Gene order on the marsupial X is scrambled relative to the eutherian X. In tammar wallaby, G6PD maps to the proximal Xq, whereas ATRX, PLP1, KDM5C and UBA1 and HUWE1 are located on distal Xq (Deakin et al. 2008).

Table 2 Human X gene selected for mapping in elephant Locus symbol

Elephant scaffold

XG

51574

Human location 2.7

Basis for mappinga

Tammar wallaby location

Spans human PAB

–

AMELX

471

11.1

Demarcates putative ancestral PAB

5q

EIF1AX

30166

19.9

X/Y shared in placentals

5p

ZFX

6147

23.9


5p

GK

26677

30.5

Location on the human X

–

USP9X

17432

40.7


5p

UBA1

45463

46.8

X/Y shared in marsupials

Xq

KDM5C

34084

53

X/Y shared in therians

Xq

HUWE1

56328

53.6


Xq

AR

4813

66.6


Xq

ATRX

8757

76.7


Xq

PLP1

19003

102.8


Xq

XIAP

–

122.8


–

RBMX

9952

135.5

X/Y shared in therians

Xq

SOX3

111757

139.3

SRY evolved from SOX3

Xq

FMR1

10062

146.7


Xq

G6PD

37247

153.3


Xq

PAB pseudoautosomal boundary a

Reasons why genes were selected for mapping in elephant. Genes were chosen so that they were evenly distributed along the human X

922


Fig. 2 Two-color FISH showing the location of eight markers on the elephant X chromosome. a AMELX (red) on Xp distal to ZFX (green). b G6PD (red) on Xq distal to XIAP (green). c UBA1 (red) close to the centromere proximal to KDM5C (green) on Xq. d HUWE1 (red) on proximal Xq and XG (green) on distal Xp and Yp. Bars equal 10μm

Eleven of the 17 X genes studied (XG, AMELX, ZFX, EIF1AX, USP9X, UBA1, KDM5C, HUWE1, ATRX, RBMX, and SOX3) have a functional Y homolog in at least one therian species (see Waters et al. 2007c for review of X genes with Y partners). None of these probes produced a Y signal in elephant, except for XG, which spans the pseudoautosomal region boundary on distal Xp in humans. This probe hybridized to both the elephant X and the Y chromosome (Fig. 2d), suggesting that it could be a pseudoautosomal gene in elephant.

Discussion Comparative mapping has changed our perception of the origin and differentiation of mammalian sex

chromosomes, and has raised some important questions. The recent discovery that genes on the human X and Y are all autosomal in the platypus, as well as in birds and reptiles, gives a starting date for mammal X–Y chromosome differentiation of 166 million years ago. Mapping in marsupials showed that X and Y chromosomes of the eutherian mammals studied consist of a conserved region (XCR) that is on the X in marsupials, and a recently added region (XAR) that is autosomal in marsupials. This was demonstrated first for human and mouse, which belong to the same superordinal eutherian clade (Supraprimates), but is true also of the other Boreoeutherian mammals studied thus far, including carnivores (cats and dogs; Murphy et al. 2007a) and perissodactyls (horses; Raudsepp et al. 2004).


923

Fig. 3 Physical map of the elephant X chromosome compared with the sex chromosomes of tammar wallaby and human. The XCR is colored in blue, the XAR in red, and the heterochromatic region in gray. Genes are displayed as bands on the chromosomes. There was a centromere repositioning event between the human and elephant X chromosomes, leaving gene order unchanged; the elephant position may have been ancestral, since it separates the XCR and XAR genes. The location of XIAP is proximal to FMR1 and G6PD, but unknown with respect to RBMX and SOX3. The wallaby X is rearranged compared to the eutherian mammal X chromosome

The X chromosome of the eutherian mammals studied is strikingly conserved, not only in gene content but also in gene order in species as distantly related as humans, cats, and horses (Raudsepp et al. 2004; Quilter et al. 2002; Murphy et al. 2007a; Ihara et al. 2004), although rodents are a notable exception in requiring at least 15 inversions from the human– rodent ancestor to the organization we observe today. The exceptional conservation of X gene content and gene order contrasts with that of autosomes (Murphy et al. 2007a). This is consistent with Ohno’s original suggestion (Ohno 1967) that conservation reflects constraints posed by a co-ordinately controlled X inactivation system, which we now know is governed in cis by the XIST gene in eutherian mammals. In contrast, although X chromosome gene content is conserved between the two marsupials for which genomic data are available (the distantly related

opossum and tammar wallaby), gene order is very scrambled; it is also scrambled with respect to the conserved eutherian X (Deakin et al. 2008) and the orthologous chromosome 6 in platypus (Veyrunes et al. 2008). This has been thought to reflect the absence of a chromosome-wide inactivation system in marsupials, which lack XIST (Duret et al. 2006; Hore et al. 2007). Most studies of sex chromosomes have used as exemplar species human and mouse, both of which belong to the same superordinal eutherian clade (Supraprimates); however, good maps of the X are now also available for carnivores (cats and dogs; Murphy et al. 2007a) and perissodactyls (horses; Raudsepp et al. 2004). Unfortunately, little detailed information on gene content and order is available for the sex chromosomes of basal eutherian mammals (Afrotheria and Xenarthra). Reciprocal chromosome

924

painting between humans and afrotherian representatives (aardvark and elephant) revealed homology of X chromosomes, implying similar gene content. It also revealed several other large regions of homology between human and afrotherian autosomes (Yang et al. 2003). However, gene order is not conserved within these autosomal blocks of homology when compared between human, cat, and dog, whereas gene order is conserved on the X (Murphy et al. 2007a). Mapping the elephant X chromosome enabled us to test the hypotheses that: (1) the addition to the X and Y chromosomes occurred before eutherian radiation; and (2) gene order is conserved on the afrotherian X, which shares features of eutherian XCI (Waters et al. 2007b), including the XIST gene (Duret et al. 2006), and is therefore expected to undergo chromosomewide X inactivation. We found that all 11 genes from human XCR (Xq and proximal Xp) mapped to Xq of the elephant X, which clearly corresponds to elephant XCR (Fig. 3). Not only does the elephant X bear the same XCR genes as the human X but their location and order appear to be conserved with that of human. XCR genes that are clustered in other eutherian mammals (e.g., UBA1–KDM5C–HUWE1) are also clustered on the elephant X. In tammar wallaby and opossum (Monodelphis domestica), the same genes are located on the distal Xq (Deakin et al. 2008) and gene order appears conserved. The one difference in gene location and order on the elephant X is centromere position. Whereas the UBA1–KDM5C–HUWE1 cluster is located on proximal Xp in human and other eutherian mammals (horse, cat, dog), they lie on proximal Xq in elephant. Conservation of the order and orientation within the cluster suggests a centromere repositioning event, rather than a pericentric inversion (Fig. 3). We also found that the elephant orthologs of six genes from the human XAR all mapped to Xp in elephant (Fig. 3). The presence of six XAR genes on the elephant X (XG, AMELX, EIF1AX, ZFX, GK, and USP9X) confirms that the eutherian X (and Y) chromosomes were augmented by the addition of an autosomal region after divergence from marsupials (148 MYA), but prior to the eutherian radiation (105 MYA). The position of the elephant X centromere at the terminus of XCR suggests that this location might have been ancestral to eutherian mammals, and that the addition of XAR represented


a centric fusion. It would therefore be very interesting to compare X centromeric position in xenarthrans to determine whether they form a basal clade with afrotherians. Four of the six XAR genes chosen for study have Y homologs in humans and other eutherians. Given that AMELX, EIF1AX, ZFX, and USP9X have Y homologs in a range of other eutherian mammals, the inability to detect these in elephant suggests either that they have been lost from the Y in afrotherians, or (more likely) have differentiated beyond recognition of the X-specific BAC clones that were used as FISH probes. A signature of the independent recombinational isolation of XAR from YAR in different lineages is the different gene content of pseudoautosomal regions (PARs) in XY pairs from different species. PARs from boreoeutherians (human, mouse, cow, and horse, the only species studied in any depth) have been shown to differ in size and gene content. The PAR of afrotherian mammals has been identified using cytological evidence in Cape rock elephant shrew (Waters et al. 2007b), but its gene content is completely unknown. We therefore included the XG gene, which straddles the PAR boundary (PAB) in humans (Weller et al. 1995), and is pseudoautosomal in both horse and dog, and likely in cattle too (Raudsepp and Chowdhary 2008, Young et al. 2008; Van Laere et al. 2008). We found that, in elephant, XG gives signals on distal Yp as well as Xp (Fig. 3), providing further evidence for a PAR in this species, and for the first time identifying an afrotherian PAR gene. This gene must therefore have been part of the ancestral PAR prior to eutherian radiation. It was lost from the PAR in mouse, spans the human PAR boundary, and has been retained in at least the elephant, dog, and horse PAR. Of interest is that AMELX did not reveal a signal on the elephant Y, indicating that it is not a PAR gene in afrotherian mammals. It has been proposed that AMELX spans the ancestral eutherian PAB (Iwase et al. 2003), hence the location of the elephant PAB does not represent the ancestral eutherian state. Further details about the gene content of the afrotherian and xenarthran PAR will help reconstruct the events by which the ancestral eutherian PAR was differentiated in different lineages. Thus, we conclude that the entire elephant X appears to bear the same suite of genes, lying in the same order, as other eutherian X chromosomes, implying that gene content and order have been


maintained across 105 MY of evolution. Conservation of gene order on the eutherian X chromosome has been suggested to be the result of selection against rearrangements that might disrupt sensitive dosage compensation machinery. The extreme conservation observed between X chromosomes of species across all eutherian mammals suggests that the ancestral eutherian-like X chromosome inactivation system must have been established in XCR prior to eutherian radiation. Both XAR and YAR were probably mostly pseudoautosomal in the eutherian ancestor, and recombinational isolation of XAR from YAR occurred independently in different lineages. Gene order in XAR was then preserved as X chromosome inactivation leaked into, and was finally established in this newly added region as a consequence of Y genes loss. Acknowledgments CLRD would like to give special thanks to the Secretariat of Public Education Mexico, the Peace Scholarship Program Australia, and Miguel E. Rentería for making possible her study in Australia. Financial support from the South African National Research Foundation to TJR is gratefully acknowledged.

References Amar LC, Dandolo L, Hanauer A et al (1988) Conservation and reorganization of loci on the mammalian X chromosome: a molecular framework for the identification of homologous subchromosomal regions in man and mouse. Genomics 2:220–230 Bininda-Emonds OR, Cardillo M, Jones KE et al (2007) The delayed rise of present-day mammals. Nature 446:507– 512 Charlesworth B (1991) The evolution of sex chromosomes. Science 251:1030–1033 Churakov G, Kriegs JO, Baertsch R, Zemann A, Brosius J, Schmitz J (2009) Mosaic retroposon insertion patterns in placental mammals. Genome Res 19:868–875 Deakin JE, Siddle HV, Cross JG, Belov K, Graves JAM (2007) Class I genes have split from the MHC in the tammar wallaby. Cytogenet Genome Res 116:205–211 Deakin JE, Koina E, Waters PD et al (2008) Physical map of two tammar wallaby chromosomes: a strategy for mapping in non-model mammals. Chromosome Res 16:1159–1175 Duret L, Chureau C, Samain S, Weissenbach J, Avner P (2006) The Xist RNA gene evolved in eutherians by pseudogenization of a protein-coding gene. Science 312:1653–1655 Graves JAM (1995) The origin and function of the mammalian Y chromosome and Y-borne genes—an evolving understanding. Bioessays 17:311–320 Hallstrom BM, Kullberg M, Nilsson MA, Janke A (2007) Phylogenomic data analyses provide evidence that Xenarthra

925 and Afrotheria are sister groups. Mol Biol Evol 24:2059– 2068 Hore TA, Koina E, Wakefield MJ, Graves JAM (2007) The region homologous to the X-chromosome inactivation centre has been disrupted in marsupial and monotreme mammals. Chromosome Res 15:147–161 Ihara N, Takasuga A, Mizoshita K et al (2004) A comprehensive genetic map of the cattle genome based on 3802 microsatellites. Genome Res 14:1987–1998 Iwase M, Satta Y, Hirai Y, Hirai H, Imai H, Takahata N (2003) The amelogenin loci span an ancient pseudoautosomal boundary in diverse mammalian species. Proc Natl Acad Sci U S A 100:5258–5263 Mikkelsen TS, Ku M, Jaffe DB et al (2007) Genome-wide maps of chromatin state in pluripotent and lineagecommitted cells. Nature 448:553–560 Murphy WJ, Eizirik E, Johnson WE, Zhang YP, Ryder OA, O'Brien SJ (2001) Molecular phylogenetics and the origins of placental mammals. Nature 409:614–618 Murphy WJ, Davis B, David VA et al (2007a) A 1.5-Mbresolution radiation hybrid map of the cat genome and comparative analysis with the canine and human genomes. Genomics 89:189–196 Murphy WJ, Pringle TH, Crider TA, Springer MS, Miller W (2007b) Using genomic data to unravel the root of the placental mammal phylogeny. Genome Res 17:413–421 Nishihara H, Maruyama S, Okada N (2009) Retroposon analysis and recent geological data suggest nearsimultaneous divergence of the three superorders of mammals. Proc Natl Acad Sci U S A 106:5235–5240 Ohno S (1967) Sex chromosomes and sex-linked genes. Springer, New York Quilter CR, Blott SC, Mileham AJ, Affara NA, Sargent CA, Griffin DK (2002) A mapping and evolutionary study of porcine sex chromosome genes. Mamm Genome 13:588– 594 Raudsepp T, Chowdhary BP (2008) The horse pseudoautosomal region (PAR): characterization and comparison with the human, chimp and mouse PARs. Cytogenet Genome Res 121:102–109 Raudsepp T, Lee EJ, Kata SR et al (2004) Exceptional conservation of horse–human gene order on X chromosome revealed by high-resolution radiation hybrid mapping. Proc Natl Acad Sci U S A 101:2386–2391 Rens W, O'Brien P, Grützner F et al (2007) The multiple sex chromosomes of platypus and echidna are not completely identical and several share homology with the avian Z. Genome Res 8:R243 Sandstedt SA, Tucker PK (2004) Evolutionary strata on the mouse X chromosome correspond to strata on the human X chromosome. Genome Res 14:267–272 Schmid M, Nanda I, Guttenbach M et al (2000) First report on chicken genes and chromosomes 2000. Cytogenet Cell Genet 90:169–218 Skaletsky H, Kuroda-Kawaguchi T, Minx PJ et al (2003) The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423:825–837 Van Laere A, Coppieters W, Georges M (2008) Characterization of the bovine pseudoautosomal boundary: documenting the evolutionary history of mammalian sex chromosomes. Genome Res 19:1884–1895

926 Veyrunes F, Waters PD, Miethke P et al (2008) Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes. Genome Res 18:965–973 Waddell PJ, Okada N, Hasegawa M (1999) Towards resolving the interordinal relationships of placental mammals. Systematic Biology Syst Biol 48:1–5 Waters PD, Dobigny G, Waddell PJ, Robinson TJ (2007a) Evolutionary history of LINE-1 in the major clades of placental mammals. PLoS ONE 2:e158 Waters PD, Ruiz-Herrera A, Dobigny G, Garcia Caldes M, Robinson TJ (2007b) Sex chromosomes of basal placental mammals. Chromosoma 116:511–518 Waters PD, Wallis MC, Graves JAM (2007c) Mammalian sex—origin and evolution of the Y chromosome and SRY. Semin Cell Dev Biol 18:389–400 Waters PD, Graves JAM, Thompson K, Sankovic N, Ezaz T (2008) Identification of cryptic sex chromosomes and isolation of Xand Y-borne genes. Methods Mol Biol 422:239–251 Waterston RH, Lindblad-Toh K, Birney E et al (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420:520–562

C.L. Rodríguez Delgado et al. Weller PA, Critcher R, Goodfellow PN, German J, Ellis NA (1995) The human Y chromosome homologue of XG: transcription of a naturally truncated gene. Hum Mol Genet 4:859–868 Wildman DE, Uddin M, Opazo JC et al (2007) Genomics, biogeography, and the diversification of placental mammals. Proc Natl Acad Sci U S A 104:14395– 14400 Yang F, Alkalaeva EZ, Perelman PL et al (2003) Reciprocal chromosome painting among human, aardvark, and elephant (superorder Afrotheria) reveals the likely eutherian ancestral karyotype. Proc Natl Acad Sci U S A 100:1062– 1066 Young AC, Kirkness EF, Breen M (2008) Tackling the characterization of canine chromosomal breakpoints with an integrated in-situ/in-silico approach: the canine PAR and PAB. Chromosome Res 16:1193–1202 Zheng J, Svensson JT, Madishetty K, Close TJ, Jiang T, Lonardi S (2006) OligoSpawn: a software tool for the design of overgo probes from large unigene datasets. BMC Bioinformatics 7:7