Platination of telomeric DNA by cisplatin disrupts recognition by TRF2 ...

J Biol Inorg Chem (2010) 15:641–654 DOI 10.1007/s00775-010-0631-4

ORIGINAL PAPER

Platination of telomeric DNA by cisplatin disrupts recognition by TRF2 and TRF1 Isabelle Ourliac-Garnier • Anaı¨s Poulet • Razan Charif • Simon Amiard • Fre´de´rique Magdinier • Keyvan Rezaı¨ • Eric Gilson • Marie-Jose`phe Giraud-Panis Sophie Bombard

•

Received: 4 September 2009 / Accepted: 27 January 2010 / Published online: 27 February 2010 Ó SBIC 2010

Abstract Telomeres, the nucleoprotein complexes located at the ends of chromosomes, are involved in chromosome protection and genome stability. Telomeric repeat binding factor 1 (TRF1) and telomeric repeat binding factor 2 (TRF2) are the two telomeric proteins that bind to

Electronic supplementary material The online version of this article (doi:10.1007/s00775-010-0631-4) contains supplementary material, which is available to authorized users. I. Ourliac-Garnier R. Charif S. Bombard (&) Laboratoire de Chimie et Biochimie Pharmacologiques et Toxicologiques, CNRS-UMR8601, Universite´ Paris Descartes, 45 rue des Saints-Pe`res, 75006 Paris, France e-mail: [email protected] Present Address: I. Ourliac-Garnier Telomeres and Cancer Laboratory, UMR3244, Institut Curie, 26 rue d’Ulm, 75248 Paris, France A. Poulet S. Amiard M.-J. Giraud-Panis Universite´ de Lyon, LJC, USR3010 CNRS, Ecole Normale Supe´rieure de Lyon, 46 alleé d’Italie, 69364 Lyon Cedex, France A. Poulet F. Magdinier E. Gilson M.-J. Giraud-Panis Universite´ de Lyon, LBMC, UMR5239 CNRS, Ecole Normale Supe´rieure de Lyon, 46 alleé d’Italie, 69364 Lyon Cedex, France R. Charif S. Bombard Laboratoire d’homeóstasie cellulaire et cancer, INSERM-UMR-S 1007, Universite´ Paris Descartes, 45 rue des Saints-Pe`res, 75006 Paris, France K. Rezaı¨ Department of Pharmacology Oncology, Centre Rene´ Huguenin, Saint-Cloud, France

duplex telomeric DNA through interactions between their C-terminal domain and several guanines of the telomeric tract. Since the antitumour drug cisplatin binds preferentially to two adjacent guanines, we have investigated whether cisplatin adducts could affect the binding of TRF1 and TRF2 to telomeric DNA and the property of TRF2 to stimulate telomeric invasion, a process that is thought to participate in the formation of the t-loop. We show that the binding of TRF1 and TRF2 to telomeric sequences selectively modified by one GG chelate of cisplatin is markedly affected by cisplatin but that the effect is more drastic for TRF2 than for TRF1 (3–5-fold more sensitivity for TRF2 than for TRF1). We also report that platinum adducts cause a decrease in TRF2-dependent stimulation of telomeric invasion in vitro. Finally, in accordance with in vitro data, analysis of telomeric composition after cisplatin treatment reveals that 60% of TRF2 dissociate from telomeres. Keywords Telomeres TRF1 TRF2 Cisplatin Antitumour

Introduction Telomeres are nucleoprotein complexes located at the ends of chromosomes. In vertebrates, they consist of tandem repeats of a G-rich motif, TTAGGG and associated proteins. The G-rich strand protrudes at the 30 extremity as a single-strand G-overhang that serves as a substrate for telomerase elongation [1]. Telomeres are organized structures that are essential for chromosome stability and for protection from degradation and DNA repair activities. In human telomeres, three different proteins bind specifically to TTAGGG repeats: telomeric repeat binding factor 1 (TRF1) and telomeric repeat binding factor 2 (TRF2) bind

123

642

to duplex telomeric DNA [2–4] and POT1 binds to the G-overhang [5]. These three proteins, along with TIN2, TPP1 and RAP1, form the shelterin or telosome complex which is involved in the protection of the telomeres and plays an important role in telomere regulation by controlling telomere length, recombination and DNA damage checkpoint activation [6–10]. TRF1 negatively regulates telomere length in cis by controlling the access of telomerase factors to the G-overhang [11–13]. Moreover, depletion of TRF1 causes embryonic lethality [14] and chromosome instability [15]. TRF2 regulates telomere protection [13, 16–19]. TRF2depleted telomeres appear deprotected and can undergo end-to-end fusion, a process leading to chromosome abnormalities [20] whereas overexpression of TRF2 induces a dramatic decrease in telomere length, leading to the senescence of cells [13, 21]. Moreover, TRF2 is overexpressed in a number of human carcinomas, suggesting a role for this protein in tumorigenesis or in the maintenance of the tumorigenic state [22–25]. Finally, TRF2 is implicated in the formation of the t-loop, a higher-order structure, the formation of which is thought to involve invasion of the G-overhang into the double-stranded DNA and which could participate in its protection [26, 27]. Although they have different functions on telomeres, TRF1 and TRF2 share a similar organization in three functional domains: an N-terminal acidic (TRF1) or basic (TRF2) domain, a central TRF-specific homodimerization domain and a C-terminal DNA-binding domain that shows sequence homology to each of the three tandem repeats of the c-Myb DNA-binding domain [28]. They bind to DNA as homodimers, although TRF2 has been shown to multimerize as well, and they recognize the same TAGGGTT sequence by means of their c-Myb-like domains [27–31]. NMR spectroscopy and X-ray crystallography of the c-Myb structures of both proteins bound to a telomeric sequence show that TRF1 and TFR2 make essentially the same contacts with telomeric DNA, notably involving some N7 positions of guanines [32–35]. It has been proposed that TRF2 could be a target for anticancer drug therapy since it is overexpressed in some tumour cells [36] and its removal from telomeres results in loss of the G-overhang, leading to drastic chromosomal defects (fusions, anaphase bridges) [16, 20, 37], and affects cell growth (senescence or apoptosis) [38]. The antitumour drug cisplatin (cis-[PtCl2(NH3)2]), which is used in the treatment of several types of cancer, reacts with cellular DNA, preferentially at the N7 positions of guanine bases, leading to 60–65% of chelates between adjacent guanines [39]. It is accepted that the cytotoxicity of cisplatin is attributed to the formation of the major GG adduct because the tumour response correlates to levels of GG adducts [40, 41]. Therefore, owing to the presence of

123

J Biol Inorg Chem (2010) 15:641–654

triple runs of guanines, telomeric DNA is thought to be a preferential target for cisplatin [42] but the effect of cisplatin on telomeres has not been well clarified yet [43–45]. The conclusions are controversial [46] since cisplatin could target double-stranded telomeric DNA, single-stranded telomeric DNA, folded or not in G-quadruplex structures [36, 47] or telomerase [48]. This report describes the effect of platination of doublestranded telomeric DNA at defined GGG sites on the DNA binding properties of TRF1 and TRF2. It shows that the presence of one chelate of cisplatin in telomeric sequences causes a marked decrease in TRF2 affinity and that steric hindrance plays a major role in this decrease. Moreover, TRF2 is surprisingly more sensitive to DNA platination than TRF1, since platination of telomeric DNA only slightly decreases the affinity of TRF1. The consequences of DNA platination on telomeric single-strand invasion were also investigated and revealed that cisplatin has a dual effect on telomeric invasion. Cisplatin inhibits the stimulation of invasion that is caused by TRF2 through its deleterious effect on TRF2 binding to DNA and increases protein-independent invasion by destabilizing the double helix. To investigate the effect of cisplatin on telomeres, the amount of TRF2 bound to telomeric sequences was evaluated after treatment of HT1080 cells: a decrease of 40% was observed. All these results suggest that platination of telomeric sequences by cisplatin in cancerous cells could impact on TRF2 binding and TRF2-mediated telomeric invasion and consequently could affect the integrity of telomeres.

Materials and methods Chemicals Oligonucleotides were synthesized and purified by Eurogentec, desalted on a Sephadex G25 column and stored at -20 °C as a 1 mM aqueous solution. 24T: TTAGGG TTAGGG TTAGGG TTAGGG 24T NS: GGATGG TAGGTG TGTGAG ATGGTT C24: CCCTAA CCCTAA CCCTAA CCCTAA C24 NS: AACCAT CTCACA CACCTA CCATCC 24TI: TTAGGG TTAGN7GG TTAGN7GG TTAGN7GG 24TII: TTAGN7GG TTAGGG TTAGN7GG TTAGN7GG 24TII-G1: TTAGN7GG TTAN7GGG TTAGN7GG TT AGN7GG 24TII-G2: TTAGN7GG TTAGN7GG TTAGN7GG TT AGN7GG 24TII-G3: TTAGN7GG TTAGGN7G TTAGN7GG TT AGN7GG 24TIII: TTAGN7GG TTAGN7GG TTAGGG TTAGN7 GG


24TIV: TTAGN7GG TTAGN7GG TTAGN7GG TTA GGG 54T: ATCGTC CTAGCA AGGTTA GGGTTA GGG TTA GGGTTA GGGGGC TGCTAC CGGCAC 54T NS: ATCGTC CTAGCA ACCGGA TGGTAG GTGTGT GAGATG GTTGGC TGCTAC CGGCAC C54: GTGCCG GTAGCA GCCCCC TAACCC TAACCC TAACCC TAACCT TGCTAG GACGAT C54 NS: GTGCCG GTAGCA GCCAAC CATCTC ACACAC CTACCA TCCGGT TGCTAG GACGAT 54TI: ATCGTC CTAGCA AGGTTA GGGTTA GN7GGTTA GN7GGTTA GN7GGGGC TGCTAC CGG CAC 54TII: ATCGTC CTAGCA AGGTTA GN7GGTTA GGGTTA GN7GGTTA GN7GGGGC TGCTAC CGGCAC 54TIII: ATCGTC CTAGCA AGGTTA GN7GGTTA N7 G GGTTA GGGTTA GN7GGGGC TGCTAC CGGCAC 54TIV: ATCGTC CTAGCA AGGTTA GN7GGTTA N7 G GGTTA GN7GGTTA GGGGGC TGCTAC CGGCAC T4A1: ATC GTC CTA GCA AGG pT4A2: pGGC TGC TAC CGG CAC cis-[Pt(NH3)2(H2O)2](NO3)2 was prepared as previously described [49] by dissolving a suspension of cis-[Pt(NO3)2 (NH3)2] in water overnight. cis-[Pt(NO3)2(NH3)2] was synthesized by reacting 1.98 equiv of AgNO3 (Merck) with cis-[PtCl2(NH3)2] (Johnson-Matthey) for 24 h at room temperature. After filtration of AgCl, the solution was concentrated using H2SO4 under low pressure until crystallization occurred [49]. [Pt(NH3)3(H2O)]2? was prepared from [Pt(NH3)3(H2O)](NO3)2 as previously described [50]. Proteins TRF1 and TRF2 were obtained as published [27]. All proteins were fused to an N-terminal tag containing six histidines. 50 -end-labeling The oligonucleotides were 50 -end-labelled using a polynucleotide kinase (USB, Pharmacia Biotech) and [c32P]ATP (GE Healthcare). The reaction products were purified by electrophoresis on 20% denaturing gel and desalted on a Sephadex G25 column. Platination Oligonucleotides (100 lM; 24TI, 24TII, 24TIII and 24TIV) were mixed with 1.2 equiv of their complementary strand (C24) in 100 mM NaClO4 for 5 min at 90 °C and were cooled to room temperature for 2 h to induce the formation of double-stranded oligonucleotides (24dsTI, 24dsTII, 24dsTIII and 24dsTIV). They were then incubated

643

with 100 lM cis-[Pt(NH3)2(H2O)2]2? for 16 h at 37 °C. 24dsTII was also incubated with 100 lM [Pt(NH3)3 (H2O)]2? for 2 h at 37 °C. After ethanol precipitation, different products of platination were separated by electrophoresis on a 20% polyacrylamide denaturing gel and located by UV shadowing. They were eluted from the gel and ethanol-precipitated. For each platinated oligonucleotide (24TI-Pt, 24TII-Pt, 24TIII-Pt and 24TIV-Pt) platinum binding sites were assessed by dimethyl sulfate (DMS)/ piperidine treatment after 50 -end-labeling of the sequences, as previously described [51] (Figs. S1, S2). The 24TX-Pt (X is I, II, III or IV) platinated oligonucleotides were again analysed after ligation at their 50 and 30 extremities, with two 15-bp oligonucleotides, giving 54TX-Pt (Fig. S2). For 24TII-Pt(NH3)3 platinum binding sites were determined by exonuclease digestion, as previously described [51] (Fig. S3). Moreover, the platinated products were analysed by matrix-assisted laser desorption ionization mass spectrometry with a linear time-of-flight analyser matrix using 2,4,6-trihydroxyacetophenone. As a reference, the mass of the non-platinated sequence 24TX is 7,571. A mass of 7,801 was obtained for each 24TX-Pt platinated oligonucleotide, indicating that each platinated product bears only one cisplatin complex (Fig. S4). Ligation Non-platinated and platinated 24mer oligonucleotides (24T, 24TI, 24TII, 24TIII, 24TIV, 24TI-Pt, 24TII-Pt, 24TIII-Pt and 24TIV-Pt) were 50 -phosphorylated using a polynucleotide kinase (USB, Pharmacia Biotech). Oligonucleotides (2 nmol) were incubated for 45 min at 37 °C with 4 nmol of ATP, 0.01 pmol of [c32P]ATP (GE Healthcare) and 0.059 U of polynucleotide kinase in 12 lL of tris(hydroxymethyl)aminomethane (Tris)–acetate buffer. Phosphorylated oligonucleotides were desalted on a Sephadex G25 column and ligated with T4A1 and pT4A2 in the presence of C54 using a Quick Ligation kit from New England BioLabs. The oligonucleotides were purified by electrophoresis on a 15% denaturing gel, eluted from the gel and desalted on a Sephadex G25 column. For each platinated oligonucleotide (54TI-Pt, 54TII-Pt, 54TIII-Pt and 54TIV-Pt) platinum binding sites were assessed by DMS/piperidine treatment as previously described [51] to check that no deplatination had occurred during the ligation reaction (Fig. S2). Binding of TRF1 and TRF2 Increasing concentrations of TRF1 and TRF2 were incubated for 25 min at 4 °C with 2 nM radiolabelled doublestranded 24dsT and 54dsT oligonucleotides, respectively,

123

644

in 10 lL of 20 mM N-(2-hydroxyethyl)piperazineN0 -ethanesulfonic acid (HEPES) pH 7.9, 150 mM KCl, 0.125 mM EDTA, 1 mM dithiothreitol (DTT), 0.125 mg/ mL acetylated bovine serum albumin (BSA). Ficoll was added to a final concentration of 2.5% (w/v) and the samples were loaded on a 1% agarose gel in 0.59 Tris– borate–EDTA (TBE) for TRF2 and by electrophoresis on a 6% polyacrylamide gel in 0.59 TBE for TRF1. Migration was carried out at 150 V in 0.59 TBE at 4 °C for 25 min (TRF2) or 45 min (TRF1). The gels were dried (45 min at 80 °C) and exposed to a Storm imager screen. Images were analysed using the ImageQuant software program. Competition assays for TRF2 Non-platinated (24T, 24TI, 24TII, 24TIII and 24TIV) and platinated (24TI-Pt, 24TII-Pt, 24TIII-Pt and 24TIV-Pt) oligonucleotides were desalted on a Sephadex G25 column and hybridized with their complementary strand (C24) at 100 lM in 50 mM NaCl. Double-stranded oligonucleotides (24dsT, 24dsTI, 24dsTII, 24dsTIII, 24dsTIV, 24dsTI-Pt, 24dsTII-Pt, 24dsTIII-Pt, 24dsTIV-Pt) were used as competitors. TRF2 (25 nM) was incubated for 25 min at 4 °C in 10 lL of 20 mM HEPES pH 7.9, 150 mM KCl, 0.125 mM EDTA, 1 mM DTT, 0.125 mg/mL acetylated BSA with 2 nM radiolabelled 24dsT oligonucleotide and with 0– 3,000 nM competitor [27]. Ficoll was added to a final concentration of 2.5% (w/v) and the samples were loaded on a 1% agarose gel in 0.59 TBE. Migration, gel drying and analysis were performed as described already. The results were plotted as ratios between the fraction of 24dsT bound to TRF2 in the absence of the competitor and the fraction of 24dsT bound to TRF2 in the presence of the competitor (f0/ f) as a function of the competitor concentration. IC50 values were determined or estimated from the slopes f0/f as a function of the competitor concentration for f0/f = 2. Competition assays for TRF1 Non-platinated (54T, 54TI, 54TII and 54TIII) and platinated (54TI-Pt, 54TII-Pt, 54TIII-Pt and 54TIV-Pt) oligonucleotides were desalted on a Sephadex G25 column and hybridized with their complementary strand (C54) at 100 lM in 50 mM NaCl. Double-stranded oligonucleotides (54dsT, 54dsTI, 54dsTII, 54dsTIII, 54dsTIV, 54dsTIPt, 54dsTII-Pt, 54dsTIII-Pt and 54dsTIV-Pt) were used as competitors and stored in 20 mM HEPES pH 7.9, 150 mM KCl, 0.125 mM EDTA, 1 mM DTT, 0.125 mg/mL acetylated BSA. TRF1 (150 nM) was incubated for 25 min at 4 °C in 10 lL of 20 mM HEPES pH 7.9, 150 mM KCl, 0.125 mM EDTA, 1 mM DTT, 0.125 mg/mL acetylated BSA with 2 nM radiolabelled 54dsT oligonucleotide and with 0–1,000 nM competitor [27]. Ficoll was added to a

123


final concentration of 2.5% (w/v) and the samples were loaded on a 6% polyacrylamide electrophoresis gel (0.59 TBE and 29:1 acrylamide/bisacrylamide). Migration was carried out at 150 V in 0.59 TBE at 4 °C for 45 min. Gels were dried (1 h at 80 °C) and exposed to a Storm imager screen. Images were analysed using the ImageQuant software program. The results (f0/f) were plotted as a function of the competitor concentration as indicated for TRF2. Platination of telomeric plasmid and invasion assay A pUC18-based plasmid containing 650 bp of telomeric repeats was incubated with cisplatin at a drug-to-nucleotide ratio (rf) varying from 0.003 to 0.03 in 0.5 mM phosphate buffer pH 6.4 and 1.65 mM NaCl at 37 °C overnight. The different preparations of plasmid were then purified on Sephadex G25 to remove the excess of platinum. DNA was quantified by UV–vis absorption and the platinum content was determined by atomic spectroscopy to get the ratio of bound drug to nucleotide (rb) as described in [42] using a validated flameless atomic absorption spectrometry method over the concentration range 10–500 ng/mL [52]. The number of platinum chelates bound to the 650-bp telomere insert in the 3,200-bp pUC18 was then calculated from the rb value, considering that telomere repeats contain 2.67-fold more GG target sites (16.7%) than random DNA (6.25%), as already demonstrated for a 800-bp telomere insert in pS73 plasmid [42]. Invasion assays were performed as follows. Plasmid (200 ng) was incubated with increasing amounts of TRF2 protein in a final volume of 10 lL in 50 mM HEPES (pH 8), 0.1 mg/mL BSA, 1 mM DTT, 100 mM NaCl and 2% (v/v) glycerol for 10 min at 20 °C. We added the radiolabelled single-stranded DNA containing 15 T2AG3 repeats flanked by five bases of random sequence (13.5 nM), and after 15 min of incubation the reaction was stopped by addition of sodium dodecyl sulfate (1% final w/v) and 6 lg of proteinase K. After 30 min at 20 °C, Ficoll was added (3% final w/v) and the samples were loaded on a 1% agarose gel in 19 TBE. Migrations were carried out at 4.5 V/cm in 19 TBE for 2 h. The stimulation of strand invasion was calculated as the ratio between the intensity of the radioactive band corresponding to the invaded plasmid species obtained in the control lane (unplatinated or platinated plasmid in the absence of protein) and the intensity of the same band in the sample lanes (invasion stimulation). Analysis of the plasmid after platination by migration on agarose gel (Fig. S8) revealed that the cisplatin treatment affected the topological state of the plasmid. Indeed, the amount of nicked plasmid (marked as a nicked circle in Fig. S8) was markedly increased after treatment (compare lane 2 with lanes 3–13 in Fig. S8). Because telomeric invasion can only be observed on supercoiled plasmid [27], comparison between samples requires


one to take into account the variations in the amount of supercoiled DNA they contain. Therefore, the values of the intensities obtained for the invaded plasmid have to be corrected for the differences in the quantities of supercoiled plasmid in the samples. Consequently, we calculated a correction factor corresponding to the ratio between the amount of nicked and supercoiled species in each sample obtained by quantification of the corresponding bands on the gel presented in Fig. S7. This correction factor was applied to the intensity measured for the invaded plasmid in Fig. 6a, and the corresponding stimulation of invasion shown in Fig. 6b takes into account this correction. Experiments were repeated three times to obtain the standard error deviation. Cells and culture conditions The human fibrosarcoma cell line HT1080, in which telomeres were deprotected using telomestatin, a telomeric G-quadruplex ligand [53], was obtained from the ATCC. Cells were grown in Dulbecco’s modified Eagle’s medium with 0.1 mg/mL of streptomycin and 100 U of penicillin and 10% fetal bovine serum (Gibco). Cells were incubated with 1 lM cisplatin (Sigma) for 4 days, inducing 50% of cellular growth inhibition. Telomere chromatin immunoprecipitation assay for detection of TRF2 binding Chromatin immunoprecipitation (ChIP) was carried out using a ChIP assay kit, following the protocol described by the manufacturer (Upstate). After sonication, 30 lL was conserved to quantify the amount of telomeric sequences before immunoprecipitation (INPUT). After precipitation with either 4 lg of the anti-TRF2 polyclonal antibody, IMG148A (IMGENEX), or 4 lg of the anti-histone H3 (anti-H3) antibody (Abcam), 150 ng of the precipitants was blotted onto a Hybond-XL membrane (Amersham). One hundred and fifty, 50 and 20 ng of the INPUT sample were also blotted to evaluate the sensitivity of the signal. Anti-H3 antibodies were used as a positive control for the ChIP experiments. The telomeric sequence was detected using a 800-bp telomere repeat (TTAGGG) 32P-labelled probe obtained after digestion of the pUC Telo2 plasmid [27] by EcoRI and BamHI and radiolabelled by random priming using dCTP [a32P], TAGGGTTA/TAACCCTA (Eurogentec) as primers and Klenow polymerase (Fermentas). The Alu sequences were detected using a 32P-labelled Alu probe that was obtained after the digestion of the pTopo Alu-AII plasmid [obtained after amplification of human genomic DNA with tgaaaccccgtctctactaaaaa and gtctcgctctgtcgccca primers, then cloned in pGEM-T vector (Promega)] by EcoRI and radiolabelled by random priming using dCTP [a32P], the hexanucleotide mix (Roche) as primers and

645

Klenow polymerase (Fermentas). The membranes were first hybridized with the telomere probe, and the amount of radioactivity was quantified using the Storm imager and the ImageQuant software program. The membranes were dehybridized in boiling water containing 1% sodium dodecyl sulfate. They were then hybridized with the Alu probe and the amount of radioactivity was quantified using the Storm imager and the ImageQuant software program. Fold enrichment of the immunoprecipitated fraction compared with INPUT DNA was calculated as the ratio between telomeric DNA signals after precipitation and telomeric DNA signals in the total INPUT DNA for the same amount of blotted DNA (150 ng). The values were normalized to the Alu signal in the immunoprecipitated and INPUT fractions for each condition using the (telomere IP/telomere INPUT)/ (Alu IP/Alu INPUT) formula. The percentage of TRF2 bound to telomeres was given as a function of amount TRF2 bound in treated cells to the amount of TRF2 bound in untreated cells.

Results Selective platination of 24T and 54T To determine the influence of cisplatin GG chelates on the binding of TRF1 and TRF2, we used a DNA probe containing four TTAGGG repeats (24T) that we platinated selectively at one of the four G1G2G3 triplets. As random platination of the probe led to a mixture of platinated species that cannot be separated by high-performance liquid chromatography or gel electrophoresis (data not shown), we achieved selective platination by modifying all the unwanted sites, replacing the central G2 guanine by a N7-deazaguanine (N7-deazaG). Cisplatin cannot bind to modified G2 bases; therefore, the formation of the G1G2 and G2G3 chelates on the corresponding modified triplet is impeded. Once platinated, the probes were purified by gel electrophoresis and their platinum binding sites were identified (Figs. S1, S2). The N7-deazaG-modified sequences were named 24TI, 24TII, 24TIII and 24TIV; the roman numerals indicate the position of the non-modified and consequently platinable triplet. Their corresponding cisplatin chelates were named 24TI-Pt, 24TII-Pt, 24TIII-Pt and 24TIV-Pt, respectively (Fig. 1). Platination could involve two different sets of guanines within a triplet (G1G2 or G2G3), giving two types of chelate that were found in equal proportions for each probe from DMS/piperidine cleavage (Figs. S1, S2). Binding of TRF2 to unplatinated probes The unmodified 24dsT probe was readily recognized by TRF2 (the TRF2 concentration for half binding of the

123

646


Fig. 1 Probes and competitors

TTAG1G2G3 AATC C C

Non-telomeric flanking sequences

Telomeric repeat Unmodified probes I

II

III

I

IV

II

24dsT N7

III

IV

54dsT

G-modified competitors TTAG1N7G2G3 AATC C C N7

I

II

III

G2-modified telomeric repeat I

IV

II

24dsTI I

II

III

III

IV

24dsTIII IV

I

24dsTII

II

III

IV

24dsTIV

Cisplatin-modified telomeric repeats Pt

Pt

Pt

TTAG1G2G3 and TTAG1G2G3

Pt

Pt

TTAG1G2G3 and TTAG1G2G3 and TTAG1G2G3

Pt

Pt

Cisplatin and N7G-modified telomeric repeats Pt TTAG1G2N7G3 Pt

probe was 15 nM), giving a complex on agarose gel that was very similar to the one obtained previously using a longer, 54-bp probe containing the same number of telomeric repeats [27]. The effect of the N7-deazaG modifications was investigated by competition assays using 24dsT as the labelled probe and increasing concentration of unlabelled competitor (Figs. 2, S3, Table 1). The results are presented as plots of the ratio between the fraction of the radiolabelled 24dsT bound in the absence of the competitor to that bound in the presence of the competitor (f0/f), as a function of the competitor concentration (Fig. 2d) [54]. An IC50 value (concentration of competitor for f0/ f = 2) was calculated and the decrease in TRF2 affinity was evaluated by calculating the ratio (RN7IC50) between the IC50 obtained for the modified and the non-modified 24dsT probe. A decrease in TRF2 affinity is observed for every N7-deazaG-modified sequence (Table 1), indicating that replacement of the central guanine of the triplet by N7deazaG affects TRF2 binding. This result is in accordance

123

Pt TTAN7G1G2G3 Pt

with the published structural data for the binding of the Myb-like domain of TRF2 to telomeric DNA showing that the recognition of the central guanine of the triplet is an important feature of TRF2 binding [55, 56]. However, all repeats are not equivalent since this decrease in affinity was less pronounced when the modifications included the fourth triplet (as in 24dsTI, 24dsTII and 24dsTIII, for which RN7IC50 ranged from 16 to 21) than when the first three repeats were modified (as in 24dsTIV, with RN7IC50 of 57). This suggests a lower involvement of the fourth triplet in the overall binding of the protein, a result that was expected since this fourth repeat corresponds to an incomplete binding site for the Myb-like DNA binding domain. We could also determine which guanine was important for the binding of TRF2 within a triplet. For this purpose, we used the 24dsTII competitor sequence and added another N7-deazaG located at the first (24dsTII-G1), the second (24dsTII-G2) or the third (24dsTII-G3) position in the second triplet. The results of the competition assays


647

A

TRF2 bound DNA

*

24dsT I

II

III

free DNA

IV

0

I

II

III

II

III

25

C

* 4

6

10 15

24dsTII I

IV

0

nM

30

IV

24dsT I

20

24dsT

B

*

3 10 15

20 40 100 200

nM

II

III

IV

24dsT I

II

III

IV

0

4

6

10 20 100 150 200 250

nM

D I

II

III

IV

I

II

III

IV

I

II

III

IV

I

II

III

IV

I

II

III

IV

Fig. 2 Decrease of the binding affinity of telomeric repeat binding factor 2 (TRF2) for the telomeric 24dsT probes containing three N7deazaguanines (N7-deazaG). Electrophoretic mobility shift assay of TRF2 binding to the 24dsT unmodified probe containing four telomeric repeats using 2nM radiolabelled 24dsT. The protein concentrations used were 3, 10, 15, 20, 25, 30, 60 and 100 nM (a). For the competition experiments, TRF2 (25 nM) was incubated with radiolabelled 24dsT (2 nM) and increasing concentrations of

unlabelled 24dsT (b) and 24dsTII (c). The results of the competition experiments with 24dsTI, 24dsTIII and 24dsTIV are shown in Fig. S3. The results are plotted as the ratio between the fraction of 24dsT bound to TRF2 in the absence of the competitor and the fraction of 24dsT bound to TRF2 in the presence of the competitor (f0/f) as a function of the competitor concentration (d). Error bars represent the standard deviation

indicate that the first two guanines of the triplet play an important role in the binding of TRF2. Indeed, their replacement decreased the affinity of TRF2 for 24dsTII (RN7IC50 of 24 and 32, respectively). In contrast, the presence of a N7-deazaG in the third position of the repeat had no effect (Fig. S5, Table 1).

24dsTIV-Pt) as competitors. The results, presented in Figs. 3, S3 and Table 1, clearly indicate that the presence of cisplatin induces a dramatic 20-fold decrease in the affinity of TRF2 for 24dsTI-Pt, 24dsTII-Pt and 24dsTIII-Pt and a tenfold decrease for 24dsTIV-Pt. We can observe that the effect of platination is less drastic when the fourth repeat is platinated than when the other repeats are platinated, indicating that, similarly to what we obtained with N7-deazaG modifications, platination of the fourth telomeric repeat had a lower impact on TRF2 binding. Cisplatin has two major effects on DNA that could affect protein recognition: the chelation of the N7 of two guanines by the adduct that could cause steric hindrance and/or a bending of the DNA towards the major groove [39, 57]. The use of a monofunctional platinum complex, [Pt(NH3)3(H2O)]2?, that does not bend

Binding of TRF2 to 24dsT bearing one GG chelate of cisplatin or one adduct of triamine platin As previously, the relative affinity of TRF2 for platinated sequences was evaluated by competition experiments using 24dsT as the radiolabelled probe and 24dsT species bearing a chelate of cisplatin located at the first, second, third or fourth triplet of guanines (24dsTI-Pt, 24dsTII-Pt, 24dsTIII-Pt and

123

648


Table 1 Affinity decrease of telomeric repeat binding factor 2 (TRF2) for 24dsT telomeric sequences containing three N7-deazaG (24dsTI, 24dsTII, 24dsTIII and 24dsTIV) and one cisplatin chelate (24dsTI-Pt, 24dsTII-Pt, 24dsTIII-Pt and 24dsTIV-Pt) or one [Pt(NH3)3]2? monoadduct [24dsTII-Pt(NH3)3] Sequence

IC50 (nM)

RN7IC50

24dsT

5

1

24dsTI

80

16

24dsTI-Pt 24dsTII 24dsTII-Pt

2,500

24dsTII-Pt(NH3)3

3,100

24dsTIII 24dsTIII-Pt 24dsTIV

103

1 [20

3,703 104

RPtIC50

21

1 [20 [20

21

1 [20

3,703 303

57

24dsTIV-Pt 24dsTII-G1

2,857 3,333

32a

24dsTII-G2

2,500

24a

24dsTII-G3

116

1 *10

1.1a

The values were determined from competition experiments using 24dsT as the probe (2 nM) and competitors (0–3,000 nM). The IC50 value was defined as the amount of competitor necessary to displace 50% of the radiolabelled probe (f0/f = 2). To evaluate the impact of N7-deazaguanine (N7-deazaG) substitutions on the binding of TRF2, we calculated the RN7IC50 ratio using the IC50 of the N7-deazaGmodified competitors and the IC50 of the unmodified 24dsT substrate.To evaluate separately the impact of the chelate of cisplatin on the binding of TRF2, the RPtIC50 ratio was calculated using the IC50 of platinated competitors and the IC50 of the corresponding N7-deazaG-modified species. Since the displacement of TRF2 from 24dsT by the platinated sequences was weak for 24dsTI-Pt, 24dsTII-Pt and 24dsTIII-Pt (maximum 50%), an exact value for RPtIC50 could not be calculated. Therefore, for these three sequences, RPtIC50 was approximated as more than 20 a

To evaluate the impact of an additional N7-deazaG in the second triplet of guanines on the binding of TRF2, we calculated the RIC50 ratio using the IC50 of the N7-deazaG-modified competitors of 24dsTII and the IC50 of 24dsTII

the DNA but has the same bulkiness as cisplatin allowed us to test the importance of DNA bending in the effect of cisplatin on TRF2 DNA binding. The 24dsTII sequence was treated with [Pt(NH3)3(H2O)]2?, giving a mixture of platinum monoadducts bound to one of the guanines of the second triplet (G1, G2 or G3) (Fig. S6). The results of the competition experiments presented in Fig. 3 and Table 1 show no obvious difference between a cisplatin chelate and a platinum monoadduct. Overall, these data show that platination of telomeric DNA causes a marked decrease in TRF2 affinity and that steric hindrance plays a major role in this decrease.

to evaluate if chelates of cisplatin could also interfere with TRF1 binding. Surprisingly, we could not observe the formation of stable complexes between TRF1 and the 24dsT probe, showing again the difference in behaviour of these proteins. To perform the competition experiments, we added 15 bp of non-telomeric DNA on either side of the telomeric 24-bp tract as in [27]. The resulting DNA, named 54dsT, was well recognized by TRF1 (Fig. 4). As 24dsT, 54dsT was modified by incorporation of a N7-deazaG at the G2 position of several triplets, giving the 54TI, 54TII, 54TIII and 54TIV species (Fig. 1), and these modified probes were used in competition experiments with TRF1 (Figs. 4, S7, Table 2). In accordance with the results obtained for TRF2, N7-deazaG modifications have a higher inhibitory effect on TRF1 binding when they concern the first three triplets (RN7IC50 increases from around 12 to 41). The four modified 54dsT probes, selectively platinated at each telomeric repeat (54TI-Pt, 54TII-Pt, 54TIII-Pt and 54TIV-Pt) were used in competition assays as described earlier (Figs. 5, S7, Table 2). The results indicate that the presence of a chelate of cisplatin only slightly (by a factor of about 5) decreases the affinity of TRF1 and does not modify the affinity when the platinum chelate is located on the fourth telomeric repeat. Binding of TRF2 to 54dsT containing one GG chelate of cisplatin The results presented already suggest that TRF2 is more sensitive to DNA platination than TRF1. To ascertain this as a fact, we completed this study by assessing the effect of N7-deazaG modification and platination on TRF2 binding using the longer 54dsT N7-deazaG and platinated competitors. Indeed, since the platinated adducts affect the stability of DNA duplexes, decreasing their melting temperature, because of the bend and the unwinding induced by the cisplatin chelate [58], platination would be expected to induce a greater distortion of DNA in 24dsT than in 54dsT, which could influence the binding of the telomeric proteins. As seen for platinated 24dsT, we observed again a dramatic decrease in TRF2 binding (by a factor of more than 20) in the presence of one chelate of cisplatin located at one triplet of the telomeric sequence of 54dsT (data not shown). In conclusion, the binding of TRF2 to telomeric sequences is largely inhibited by platination, whatever the length of the substrate used for the binding experiments. Effect of platination on telomeric invasion

Binding of TRF1 to unplatinated probes and to 54dsT containing one GG chelate of cisplatin Because of their different roles in telomere maintenance, and their unique effect on DNA [27], it seemed important

123

It is known that TRF2 can catalyse in vitro the folding of telomeric DNA in a lassolike structure called the t-loop, a conformation that is thought to explain at least some of the protective functions of TRF2 [26]. The most accepted


24dsTII-Pt

A

II

III

II

III

IV

*

IV

0

20

Pt

I

24dsT I

24dsTII-Pt(NH3)3

B

Pt I

*

649

100 200 1000 2000 3000

nM

II

III

IV

24dsT I

II

III

IV

0

2

20

40 100 200 400 1000 2000 nM

C

Pt I

II

III

IV

I

II

III

IV

I

II

III

IV

I

II

III

IV

I

II

III

IV

Pt

Pt

Pt

Pt

Fig. 3 Decrease of the binding affinity of TRF2 for 24dsT telomeric sequences containing one chelate of cisplatin or one monoadduct of [Pt(NH3)3(H2O)]2?. For the competition experiments, TRF2 (25 nM) was incubated with radiolabelled 24dsT (2 nM) and increasing concentrations of unlabelled 24dsTII-Pt platinated by cisplatin (a) and 24dsTII-Pt platinated by [Pt(NH3)3(H2O)]2? (b). The results of

competition experiments with 24dsTI-Pt, 24dsTIII-Pt and 24dsTIV-Pt are shown in Fig. S3. The results are plotted as the ratio between the fraction of 24dsT bound to TRF2 in the absence of the competitor and the fraction of 24dsT bound to TRF2 in the presence of the competitor (f0/f) as a function of the competitor concentration (c). Error bars represent the standard deviation

mechanism for t-loop formation involves the invasion of the 30 G-rich tail of telomeres in the telomeric duplex upstream and it was shown recently that TRF2 could indeed stimulate this reaction through the wrapping of DNA and the generation of negative supercoils that potentiate the single-strand intake [27]. Because of their effect on TRF2 DNA binding and DNA structure, platinum chelates are expected to affect telomeric invasion. To investigate this hypothesis, we platinated a plasmid containing 650 bp of telomeric repeats with increasing amounts of cisplatin and analysed the effect of this platination on protein-free invasion and on TRF2dependent invasion. Invasion was analysed by monitoring the uptake of a radiolabelled telomeric single strand by the supercoiled telomeric DNA plasmid using agarose gel electrophoresis (experimental procedure, Fig. 6a). The results presented in Fig. 6b show that platinum chelates cause a marked increase in telomeric invasion. This effect can be explained by two properties of cisplatin adducts: (1) their capacity to unwind DNA and (2) the destabilization of double-stranded DNA [59].

Analysis of the effect of platination in the presence of TRF2 was performed on four plasmids that contained on average no, five, 12 and 34 chelates in their telomeric sequence (Fig. 6c, d). Analysing the data for the proteinfree or protein-containing samples allows comparison between the effect of cisplatin on TRF2-dependent stimulation and the combined effect of TRF2 and platination on telomeric invasion. In the absence of cisplatin chelates, TRF2 stimulates invasion by a factor of about 2.3. Adding cisplatin chelates decreases this TRF2dependent stimulation by about 10% (Fig. 6d, blue curve), most likely because of the inhibition of TRF2 binding. However, this decrease cannot compensate the large increase in invasion that is caused by the platinum adducts themselves. Therefore, the combined effect of TRF2 and cisplatin remains a stimulation of invasion of about 33% (Fig. 6d, red curve). This shows that cisplatin chelates have two antagonistic effects on telomeric invasion: (1) an inhibitory effect due to a weaker binding of TRF2; (2) a stimulatory effect due to the unwinding and melting of double-stranded DNA.

123

650


TRF1

A

bound DNA

54dsT

* I

II

III

free DNA

IV

0

3

10

I

II

III

II

III

60

300

*

IV

0

1

54dsTII I

II

III

IV

54dsT I

II

III

10 20 100 200 400 1000 nM

2

nM

C

IV

54dsT I

30

54dsT

B

*

20

IV

0

2

10

20 100 200 400 1000 nM

D

I

II

III

IV

I

II

III

IV

I

II

III

IV

I

II

III

IV

I

II

III

IV

Fig. 4 Decrease of the binding affinity of telomeric repeat binding factor 1 (TRF1) for 54dsT telomeric sequences containing three N7deazaG. Electrophoretic mobility shift assay of TRF1 binding to the 54dsT probe containing four telomeric repeats using 2 nM radiolabelled 54dsT. The protein concentrations used were 3, 10, 20, 30, 60 and 300 nM (a). For the competition experiments, TRF1 (150 nM) was incubated with radiolabelled 54dsT and increasing concentrations

of unlabelled 54dsT (b) and 54dsTII (c). The results of the competition experiments with 54dsTI, 54dsTIII and 54dsTIV are shown in Fig. S7. The results are plotted as the ratio between the fraction of 54dsT bound to TRF1 in the absence of the competitor and the fraction of 54dsT bound to TRF1 in the presence of the competitor (f0/f) as a function of the competitor concentration (d). Error bars represent the standard deviation

Cisplatin dissociates TRF2 from telomeres

specific for telomeric repeats (Fig. 7). These results demonstrate that the amount of TRF2 bound to telomeres decreases upon cisplatin treatment.

To investigate the impact of cisplatin on the binding of TRF2 to telomeres, we used ChIP. The chromatin of HT1080 cells treated or not treated with cisplatin for 4 days was immunoprecipitated with anti-TRF2 or anti-H3 as a control. After hybridization with a telomere-specific probe, the intensity of the signal was determined and normalized to the values obtained for Alu sequences used as a control. ChIP analysis with antibodies against TRF2 showed that TRF2 binding is decreased by 60% after 4 days of treatment of HT1080 cells with 1 lM cisplatin. Interestingly, the amount of histone H3 bound to chromatin is not affected, suggesting that the effect of cisplatin is

123

Discussion Since cisplatin binds preferentially to adjacent guanines, telomeric DNA could constitute a privileged target for this antitumoral drug [40, 42]. The aim of the work presented in this report was to determine if cisplatin adducts could affect the structure of telomeres and more specifically the functions of the two telomeric proteins (TRF1 and TRF2) which are known to interact with several guanines of the


651

Table 2 Relative affinity of telomeric repeat binding factor 1 (TRF1) for 54dsT telomeric sequences containing three N7-deazaG (54dsTI, 54dsTII, 54dsTIII and 54dsTIV) and one cisplatin chelate (54dsTI-Pt, 54dsTII-Pt, 54dsTIII-Pt and 54dsTIV-Pt) Sequence

IC50 (nM)

54dsT

10.6

1

54dsTI

112

11

54dsTI-Pt

555

54dsTII

129

54dsTII-Pt

769

54dsTIII

152.5

54dsTIII-Pt

1,000

54dsTIV

434

54dsTIV-Pt

357

RN7IC50

RPtIC50 1 1 \10

12

1 \10

14

1 \10

41

1 *1

The values were determined from competitions experiments using 54dsT as the probe (2 nM) and competitors (0–1,000 nM). IC50, RN7IC50 and RPtIC50 values were calculated as described in Table 1

54dsTII-Pt

A

Pt

I

*

telomeric tract [9]. Hence, we investigated the in vitro binding of TRF1 and TRF2 to telomeric sequences that had been selectively modified by one GG chelate of cisplatin. The TRF2 binding experiments were performed on two sequences differing in their length (24 and 54 bp) but containing four TTAGGG repeats. Both platinated sequences are poorly recognized by TRF2, showing that cisplatin chelates can inhibit TRF2 binding and confirming the specificity of TRF2 interaction for telomeric sequences. Closer examination of the effect of the position of the cisplatin adduct revealed that the fourth repeat plays a minor role in TRF2 binding, most probably because it corresponds to an incomplete binding site (TAGGGTT) for the DNA-binding Myb-like domain of the protein. Indeed, modifications by N7-deazaG or platination of the guanines within this fourth G-triplet only marginally affect the binding of TRF2.

II

III

IV

54dsT I

II

III

IV

0

2

10

20 100 200 400 1000 nM

B

Pt I

II

III

IV

II

III

IV

Pt I

Pt I

II

III

IV

Pt I

Fig. 5 Decrease of the binding affinity of TRF1 for 54dsT telomeric sequences containing one chelate of cisplatin. For the competition experiments, TRF1 (150 nM) was incubated with radiolabelled 54dsT (2 nM) and increasing concentrations of unlabelled 54dsTII-Pt (a). The results of the competition experiments with 54dsTI-Pt, 54dsTIII-Pt and

II

III

IV

54dsTIV-Pt are shown in Fig. S7. The results are plotted as the ratio between the fraction of 54dsT bound to TRF1 in the absence of the competitor and the fraction of 54dsT bound to TRF1 in the presence of the competitor (f0/f) as a function of the competitor concentration (b). Error bars represent the standard deviation

123


B

cisplatin 0

0

*

1 2 3 4 5 6 7 8 9 10 11 12 13

*

Invasion Stimulation in the absence of TRF2

A

ss probe

652

2.2

Pt

*

1.8

*

vs

1.4 1.0 0

5

10 15 20 25 30 35

0

Pl pla atin sm ate id d

D

TRF2

0

*

1 2 3 4 5 6 7 8 9

*

Invasion Stimulation in thepresenceof TRF2

ss probe

C

U 1 µM TRF2 pl npla as tin mi a t ed d

Number of platinum chelates

Pt

*

3.1

*

vs

2.7 Pt

2.3

*

1.9 1.5

0

5

*

Pt

vs

10 15 20 25 30 35

Number of platinum chelates

Fig. 6 a Invasion assay performed with platinated substrates: lane 1 corresponds to a plasmid-free reaction, lane 2 corresponds to the untreated plasmid and lanes 3–13 correspond to treated plasmids with (lanes 4–13) or without (lane 3) cisplatin. The data in a were plotted as the ratio between the intensity of the plasmidic band in the treated samples and that in the untreated sample (invasion stimulation) as a function of the number of platinum chelates present on the telomeric tract of the plasmid (b). c Invasion assay showing the effect of TRF2 and cisplatin on telomeric invasion using the plasmid containing five platinum chelates on its telomeric tract: lane 1 corresponds to a plasmid-free reaction, lane 2 corresponds to the untreated plasmid, lane 3 corresponds to a reaction containing the untreated plasmid and 1 lM TRF2 and lanes 4–9 correspond to reactions performed with the

platinated plasmid in the absence (lane 4) or presence (lanes 5–9) of increasing amounts of TRF2. The same experiment was also performed with the plasmids containing 12 and 34 chelates on average on their telomeric tract (data not shown). The maximum effect was constantly obtained for a concentration of 300 nM TRF2. This concentration was therefore chosen to plot the stimulation of invasion due to TRF2 binding as a function of the number of chelates in the telomeric sequence (d). Taking either the platinated plasmids or the unplatinated plasmids as references allows one to quantify the effect of cisplatin chelates on TRF2-dependent invasion (blue curve) or the combined effect of cisplatin and TRF2 on telomeric invasion (red curve), respectively. ss single-stranded

Of note is that the effects observed are much more important than those caused by the oxidation in 8oxoG of two repeats in telomeric sequences (factor of 2 in decrease of affinity) [60]. The most probable explanation for such inhibition could reside in the disruption of essential contacts between the Myb-like domain of the protein and the telomeric repeat. Indeed, the N7 of the first two guanines of a telomeric repeat are involved in hydrogen bonds with amino acids [32, 55]. Thus, the G1G2 or G2G3 chelates should disrupt two or one hydrogen bonds, respectively. We confirmed this hypothesis by comparing the affinity of TRF2 for 24dsTII bearing at the second triplet a cisplatin chelate (24dsTII-Pt) or a [Pt(NH3)3]2? monoadduct (24dsTII-[Pt(NH3)3]) or an additional N7-deazaG on G1 or G2 (24dsTII-G1 and 24dsTII-G2). Since the decrease of TRF2 affinity was over a factor of 20 for all these telomeric sequences (Table 1), we concluded that the presence of the

platinum complex at the N7 is a major contributor in the inhibition of binding by disrupting hydrogen bonds between TRF2 and the telomeric sequence. Strikingly, we observed that a single GG cross-link of cisplatin located at one of the three binding sites decreased the affinity of TRF2 by a factor of over 20, whereas the affinity of TRF1 is only diminished by a factor of roughly 5. This result indicates that although the binding of both proteins is affected by cisplatin, the effect is markedly more drastic for TRF2 than for TRF1. This result was not expected since cisplatin should disrupt the same essential contacts between the N7 of the first two guanines of the telomeric repeat and the Myb-like domain of both proteins. One possible explanation for this discrepancy could come from differences in the binding flexibility of these proteins. Indeed, it has been shown that the TRF1 dimer is capable of interacting with telomeric sequences separated by a tract

123


653

Telomeric probe

A

Amount of blotted DNA

B

Alu probe

A

B

150ng INPUT

50ng 20ng

Anti-H3

150ng

Anti-TRF2

150ng

Anti-TRF2 % of TRF2 binding

150ng 100%

40%

Fig. 7 Chromatin immunoprecipitation of HT1080 cells treated by cisplatin (1 lM) for 4 days with anti-TRF2 antibody. Telomeric sequences were evidenced in a DNA fraction immunoprecipitated by an anti-TRF2 antibody using a 32P-radiolabelled 800-pb telomeric probe and a 32P-radiolabelled Alu sequence in untreated cells (a) and cisplatin-treated cells (b). An anti-histone H3 (anti-H3) antibody was used as a positive control. One hundred and fifty nanograms of DNA was blotted for each sample. The percentage represents the quantitative values of telomeric DNA signals in the samples originating

from cells with cisplatin treatment compared with those in the samples originating from the cells without any treatment. Quantitative values of telomeric DNA signals were calculated as the ratio between telomeric DNA signals for precipitation and telomeric DNA signals in the INPUT for the same amount of blotted DNA. These values were normalized by the amount of blotted DNA for each sample quantified by the non-specific Alu probe, following the formula (telomere IP/ telomere INPUT)/(Alu IP/Alu INPUT)

of random DNA [31]. In our platinated substrates, TRF1 could therefore go around a platinum chelate and interact with separated binding sites, with the consequence of a low sensitivity to platinum adducts. This property has never been investigated for TRF2. Such a distortion might be more difficult to achieve in the case of TRF2, hence a greater sensitivity to chelates. Further studies on the binding properties of the full-length TRF2 would be needed to confirm this hypothesis. Overall, our data show that the presence of platinum adducts on telomeric DNA causes an inhibition of the binding of the protein to its target. One consequence of this is a decrease in the effect of TRF2 on the process of telomeric invasion. Indeed, TRF2 binding to DNA has been shown to potentiate the uptake of single strand by a telomeric duplex, a phenomenon that is thought to participate in the formation of t-loops on telomeric DNA [27]. Our results are consistent with a decrease in TRF2dependent stimulation of invasion. However, this reduction seems to be a minor effect of cisplatin compared with the increase in invasion caused by the adduct itself. Indeed, the overall effect of platination is a significant increase in the invasion most probably due to the

unwinding and destabilizing effects of platinum adducts on duplex DNA. All these results, obtained in vitro, suggest that if cisplatin binds to telomeres, in vivo, it could lead to an inhibition of TRF2 binding, which is known to induce telomere uncapping and dysfunction. Only a few studies have dealt with this topic so far, with very divergent results [43–45]. Rather than telomere-related biological responses to the drug that may depend on cell type and conditions, we thought it more informative to look directly at the binding of the protein to telomeres. Although, one has also to keep in mind that TRF2 displacement from telomeres upon cisplatin treatment could be due to changes in telomeric state not directly linked to TRF2 and TRF1 dosage on telomeres, our results show a decrease of 60% in the amount of telomeric DNA associated with TFR2 pulled down from platinated cells using ChIP experiments. On the basis of the findings of our in vitro studies, platination of telomeric sequences could very well be one of the causes behind this observation, leading to the interesting proposal that some in vivo effects of cisplatin may be promoted by TRF2 and that platination of telomeric DNA may block TRF2 binding.

123

654 Acknowledgments This work was supported by the Association pour la Recherche sur le Cancer (ARC grant 4835) for the S.B. team and La Ligue Contre le Cancer, E´quipe Labeliseé for the E.G. team. We also thank COST D39-0004-06 for financial support.

References 1. Autexier C, Lue NF (2006) Annu Rev Biochem 75:493–517 2. Chong L, van Steensel B, Broccoli D, Erdjument Bromage H, Hanish J, Tempst P, de Lange T (1995) Science 270:1663–1667 3. Bilaud T, Brun C, Ancelin K, Koering CE, Laroche T, Gilson E (1997) Nat Genet 17:236–239 4. Broccoli D, Smogorzewska A, Chong L, de Lange T (1997) Nat Genet 17:231–235 5. Baumann P, Cech TR (2001) Science 292:1171–1175 6. De Lange T (2005) Cold Spring Harb Symp Quant Biol 70:197– 204 7. Liu D, O’Connor MS, Qin J, Songyang Z (2004) J Biol Chem 279:51338–51342 8. Xin H, Liu D, Songyang Z (2008) Genome Biol 9:232 9. Smogorzewska A, de Lange T (2004) Annu Rev Biochem 73:177–208 10. Gilson E, Geli V (2007) Nat Rev Mol Cell Biol 8:825–838 11. van Steensel B, de Lange T (1997) Nature 385:740–743 12. Loayza D, De Lange T (2003) Nature 423:1013–1018 13. Ancelin K, Brunori M, Bauwens S, Koering CE, Brun C, Ricoul M, Pommier JP, Sabatier L, Gilson E (2002) Mol Cell Biol 22:3474–3487 14. Karlseder J, Kachatrian L, Takai H, Mercer K, Hingorani S, Jacks T, de Lange T (2003) Mol Cell Biol 23:6533–6541 15. Iwano T, Tachibana M, Reth M, Shinkai Y (2004) J Biol Chem 279:1442–1448 16. van Steensel B, Smogorzewska A, de Lange T (1998) Cell 92:401–413 17. Smogorzewska A, van Steensel B, Bianchi A, Oelmann S, Schaefer MR, Schnapp G, de Lange T (2000) Mol Cell Biol 20:1659–1668 18. Wang RC, Smogorzewska A, de Lange T (2004) Cell 119:355– 368 19. Munoz P, Blanco R, Blasco MA (2006) Cell Cycle 5:718–721 20. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T (1999) Science 283:1321–1325 21. Karlseder J, Smogorzewska A, de Lange T (2002) Science 295:2446–2449 22. Munoz P, Blanco R, Flores JM, Blasco MA (2005) Nat Genet 37:1063–1071 23. Nakanishi K, Kawai T, Kumaki F, Hiroi S, Mukai M, Ikeda E, Koering CE, Gilson E (2003) Clin Cancer Res 9:1105–1111 24. Blasco MA (2005) Nat Rev Genet 6:611–622 25. Brunori M, Mathieu N, Ricoul M, Bauwens S, Koering CE, Roborel de Climens A, Belleville A, Wang Q, Puisieux I, Decimo D, Puisieux A, Sabatier L, Gilson E (2006) Oncogene 25:990– 997 26. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, de Lange T (1999) Cell 97:503–514 27. Amiard S, Doudeau M, Pinte S, Poulet A, Lenain C, FaivreMoskalenko C, Angelov D, Hug N, Vindigni A, Bouvet P, Paoletti J, Gilson E, Giraud-Panis MJ (2007) Nat Struct Mol Biol 14:147–154 28. Bilaud T, Koering CE, Binet Brasselet E, Ancelin K, Pollice A, Gasser SM, Gilson E (1996) Nucleic Acids Res 24:1294–1303

123

J Biol Inorg Chem (2010) 15:641–654 29. Bianchi A, Smith S, Chong L, Elias P, de Lange T (1997) EMBO J 16:1785–1794 30. Konig P, Fairall L, Rhodes D (1998) Nucleic Acids Res 26:1731– 1740 31. Bianchi A, Stansel RM, Fairall L, Griffith JD, Rhodes D, de Lange T (1999) EMBO J 18:5735–5744 32. Court R, Chapman L, Fairall L, Rhodes D (2005) EMBO Rep 6:39–45 33. Nishikawa T, Nagadoi A, Yoshimura S, Aimoto S, Nishimura Y (1998) Structure 6:1057–1065 34. Nishikawa T, Okamura H, Nagadoi A, Konig P, Rhodes D, Nishimura Y (2001) Structure 9:1237–1251 35. Bilbille Y, Paquet F, Meudal H, Giraud-Panis MJ, Lancelot G (2006) C R Chim 9:452–458 36. Heringova P, Kasparkova J, Brabec V (2009) J Biol Inorg Chem 14:959–968 37. Tahara H, Shin-Ya K, Seimiya H, Yamada H, Tsuruo T, Ide T (2006) Oncogene 25:1955–1966 38. Biroccio A, Rizzo A, Elli R, Koering CE, Belleville A, Benassi B, Leonetti C, Stevens MF, D’Incalci M, Zupi G, Gilson E (2006) Eur J Cancer 42:1881–1888 39. Jamieson ER, Lippard SJ (1999) Chem Rev 99:2467–2498 40. Wang D, Lippard SJ (2005) Nat Rev Drug Discov 4:307–320 41. Brabec V, Kasparkova J (2005) Drug Resist Updat 8:131–146 42. Burstyn JN, Heiger-Bernays WJ, Cohen SM, Lippard SJ (2000) Nucleic Acids Res 28:4237–4243 43. Ishibashi T, Lippard SJ (1998) Proc Natl Acad Sci USA 95:4219– 4223 44. Zhang RG, Zhang RP, Wang XW, Xie H (2002) Cell Res 12:55– 62 45. Jeyapalan JC, Saretzki G, Leake A, Tilby MJ, von Zglinicki T (2006) Int J Cancer 118:2727–2734 46. Ourliac-Garnier I, Charif R, Bombard S (2009) In: Hadjiliadis N, Sletten E (eds) Metal complexes–DNA interactions. Wiley– Blackwell, Oxford, pp 209–234 47. Redon S, Bombard S, Elizondo-Riojas MA, Chottard JC (2003) Nucleic Acids Res 31:1605–1613 48. Colangelo D, Osella D (2005) Curr Med Chem 12:3091–3102 49. Gonnet F, Kocher F, Blais JC, Bolbach G, Tabet JC (1996) J Mass Spectrom 31:802–809 50. Reeder F, Kozelka J, Chottard JC (1996) Inorg Chem 35:1413– 1415 51. Ourliac-Garnier I, Elizondo-Riojas MA, Redon S, Farrell NP, Bombard S (2005) Biochemistry 44:10620–10634 52. LeRoy AF, Wehling ML, Sponseller HL, Friauf WS, Solomon RE, Dedrick RL, Litterst CL, Gram TE, Guarino AM, Becker DA (1977) Biochem Med 18:184–191 53. Gomez D, Wenner T, Brassart B, Douarre C, O’Donohue MF, El Khoury V, Shin-Ya K, Morjani H, Trentesaux C, Riou JF (2006) J Biol Chem 38721–38729 54. Fourrier L, Brooks P, Malinge JM (2003) J Biol Chem 278:21267–21275 55. Nishikawa T, Okamura H, Nagadoi A, Koig P, Rhodes D, Nishimura Y (2001) Nucleic Acids Res Suppl 273–274 56. Hanaoka S, Nagadoi A, Nishimura Y (2005) Protein Sci 14:119– 130 57. Takahara PM, Rosenzweig AC, Frederick CA, Lippard SJ (1995) Nature 377:649–652 58. Gonnet F, Reeder F, Kozelka J, Chottard JC (1996) Inorg Chem 35:1653–1658 59. Legendre F, Bas V, Kozelka J, Chottard JC (2000) Chem Eur J 6:2002–2010 60. Opresko PL, Fan J, Danzy S, Wilson DM 3rd, Bohr VA (2005) Nucleic Acids Res 33:1230–1239