Plecoptera, Capniidae

Zootaxa 3808 (1): 001–091 www.mapress.com /zootaxa / Copyright © 2014 Magnolia Press

Monograph

ISSN 1175-5326 (print edition)

ZOOTAXA

ISSN 1175-5334 (online edition)

http://dx.doi.org/10.11646/zootaxa.3808.1.1 http://zoobank.org/urn:lsid:zoobank.org:pub:E4C0E93F-DBAB-4788-A8F7-C03E2C6F0306

ZOOTAXA 3808

Two new species of Zwicknia Murányi, with molecular data on the phylogenetic position of the genus (Plecoptera, Capniidae) LOUIS BOUMANS1 & DÁVID MURÁNYI 2 1

National Centre for Biosystematics, Natural History Museum, University of Oslo, P.O. Box 1172 Blindern, NO-0318 Oslo, Norway. E-mail: [email protected] 2 Department of Zoology, Hungarian Natural History Museum, Baross u. 13, H-1088 Budapest, Hungary. E-mail: [email protected]

Magnolia Press Auckland, New Zealand

Accepted by B. Kondratieff: 14 Mar. 2014; published: 29 May 2014

LOUIS BOUMANS & DÁVID MURÁNYI Two new species of Zwicknia Murányi, with molecular data on the phylogenetic position of the genus (Plecoptera, Capniidae) (Zootaxa 3808)

91 pp.; 30 cm. 29 May 2014 ISBN 978-1-77557-403-3 (paperback) ISBN 978-1-77557-404-0 (Online edition)

FIRST PUBLISHED IN 2014 BY Magnolia Press P.O. Box 41-383 Auckland 1346 New Zealand e-mail: [email protected] http://www.mapress.com/zootaxa/

© 2014 Magnolia Press All rights reserved. No part of this publication may be reproduced, stored, transmitted or disseminated, in any form, or by any means, without prior written permission from the publisher, to whom all requests to reproduce copyright material should be directed in writing. This authorization does not extend to any other kind of copying, by any means, in any form, and for any purpose other than private research use. ISSN 1175-5326

(Print edition)

ISSN 1175-5334

(Online edition)

2 · Zootaxa 3808 (1) © 2014 Magnolia Press

BOUMANS & MURÁNYI

Table of contents Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Material and methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Results and discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Zwicknia westermanni Boumans & Murányi, sp. n. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Zwicknia komica Murányi & Boumans, sp. n. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11 Molecular analyses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 Conclusion and outlook . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 Appendix 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21 Supplement 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22 Supplement 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 Supplement 3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52 Supplement 4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67

Abstract Analyses of the nuclear DNA marker 28S confirm the distinctness of the recently erected stonefly genus Zwicknia Murányi 2014, which encompasses the species until recently referred to as ‘Capnia bifrons.’ Two new species are described and illustrated with line drawings: Z. westermanni Boumans & Murányi, sp. n. from Germany and France, and Z. komica Murányi & Boumans, sp. n. from the Komi Republic in northwestern Russia. The intersexual communication of the former species is described in detail. A phylogenetic analysis of 87 sequences of the mitochondrial marker cytochrome c oxidase I (COI) representing the six described European species of Zwicknia and outgroup taxa reveals large genetic distances within the species Z. rupprechti and Z. bifrons, while the haploclade including all specimens of the latter species also includes Z. acuta and Z. westermanni. The mitochondrial phylogeny is assumed not to represent the species phylogeny. In contrast, a phylogeny of the nuclear markers 28S and ITS reveals that Z. rupprechti and Z. westermanni are more closely related to each other than either is to Z. bifrons. This finding is in line with the drumming patterns of the former two species being relatively similar. Key words: Plecoptera, Capniidae, Zwicknia, Capnia, Europe, new species, COI, 28S, ITS

Introduction ‘Capnia bifrons’ (Newman, 1838) has for some decades been suspected to refer to a species complex rather than a single species. In particular, Rupprecht (1982; 1997) already distinguished five types of mating signals for various European populations. Recently, Murányi et al. (2014) erected the genus Zwicknia Murányi, 2014 to encompass the species previously referred to as C. bifrons as well as the central Palaearctic species belonging to the C. bifrons species group sensu Zhiltzova (2001). Murányi et al. (2014) distinguish and describe four species until then subsumed under ‘Capnia bifrons’: Zwicknia bifrons (Newman, 1838), originally described from Scotland, widespread in Europe, type species; Z. acuta Murányi & Orci, widespread in central and eastern Europe; Z. kovacsi Murányi & Gamboa from the Eastern Carpathians and Z. rupprechti Murányi, Orci & Gamboa, widespread in central and southeastern Europe. Here, we describe two additional species of Zwicknia on the basis of male genital morphology and molecular markers: Z. komica sp.n. and Z. westermanni sp. n.. For the latter species, we also provide additional details on its intersexual communication signals, which were illustrated and succinctly described as the form ‘Cappan’ by Rupprecht (1997). Sequences of the mitochondrial gene cytochrome c oxidase I (COI) of these species are analysed together with new sequences of Z. bifrons and Z. rupprechti from western and northern Europe and the data from southeastern Europe published in Murányi et al. (2014). As a first contribution towards the phylogeny of the genus, we present an analysis of nuclear DNA sequences of the large subunit ribosomal RNA (28S) and internal transcribed spacer (ITS) of four Zwicknia species, with an interpretation of the evolution of drumming characters. In addition, we analyse 28S sequences of Zwicknia species together with other West Palaearctic and Nearctic Capniidae to evaluate the position of the genus relative to Capnia s.s. and within the family. TWO NEW ZWICKNIA

Zootaxa 3808 (1) © 2014 Magnolia Press ·

3

Material and methods Collecting and rearing. Adult specimens were hand-collected in 96% ethanol. Nymphs of Z. westermanni sp. n. were collected with the kick sampling method from the Hohenförsiek and Hilsbach streams in the Hils massif in Lower Saxony, Germany. Live specimens were transported in water to the NHM in Oslo where they were reared in a refrigerated room at 10°C. The nymphs were kept individually in numbered steel mesh cages (tea infusers) so as to obtain unmated females. The cages were placed on trays with 1 cm water, and inspected daily. Cages with emerged stoneflies were transferred to trays with 2 mm water to prevent desiccation, and kept at 10°C. A small piece of apple and a twig covered with algae were given as food. Specimens were observed to graze algae and take up juice from the apple piece. Morphology and depositories. Terminalia of the specimens used for illustration were gently boiled in a solution of KOH. Illustrations were made with the aid of a drawing tube applied on a Nikon SMZ800 microscope. Terminology follows Murányi et al. (2014). Holotypes were deposited in the Natural History Museum, University of Oslo (NHMO, elsewhere referred to as ZMUN). Paratypes are in the NHMO and the Collection of Smaller Insect Orders, Department of Zoology, Hungarian Natural History Museum (HNHM). Additional material of Z. westermanni sp. n. is kept in the Gilles Vinçon Collection, Grenoble, France (CGV). Vibration recordings. For the recording of intersexual communication, we used a recording chamber consisting of a Ø 7 cm x 5 cm cardboard ice-cream cup, divided in two by a paper wall and covered by a small sheet of transparent acrylic window pane. Female and male were placed on opposite sides of the dividing wall. The chamber was positioned on top of a microphone designed for use in car phones. Recordings were made with a computer sound card and the software tool Audacity. Drumming characteristics were determined on the basis of three duets of three different pairs (six specimens) from the Hohenförsiek stream in the Hils Massif in Lower Saxony, Germany recorded at 20°C, 22°C and 24°C. From these duets, we analysed 12, 12 and 17 signal exchange sequences respectively, though a few signals that were unclear in the recording were excluded from the analyses. The software package SPSS v. 20 was used for descriptive statistics and graphs. Molecular methods. DNA extracts were obtained from specimens of the two new species of Zwicknia as well as Z. bifrons and Z. rupprechti, and the outgroup species C. s.s. atra Morton, 1896; C. s.s. nigra (Pictet, 1833); C. s.s. pygmaea (Zetterstedt, 1840); C. s.l. vidua Klapálek, 1904; Capnopsis schilleri (Rostock 1892) and Leuctra hippopus Kempny, 1899. DNA was isolated from heads as described in Boumans and Baumann (2012); empty head skeleton parts were preserved with the remainder of the specimen. A list of samples used in this study is given in Appendix 1, together with GenBank accession numbers for the markers COI, 28S and ITS. Mitochondrial COI was amplified with the primers LCO1490-L and HCO2198-L (Nelson et al., 2007) and sequenced in both directions. The D1–D2 region of the large-subunit (28S) rRNA gene was amplified with the primers Road1a and Road4b (Crandall et al., 2000; Whiting, 2002) and sequenced with Road4b alone or with both primers. The ITS region was amplified with primers ITS-1-SP18 and ITS-1-SP28 (McLain et al., 1995). These primers are located on 18S and 28S, respectively, and cover a region that includes ITS1, 5.8S and ITS2. The ITS region was sequenced with these two primers as well as with internal primers located on 5.8S, namely ITS1-PlecR1 (GAAACGTCGATGTTCATGTG, this study) and ITS3b-F (Roe & Sperling, 2007). 28S and COI were amplified as described in Boumans and Baumann (2012). The temperature regime for ITS amplification was as follows: initial denaturation at 95°C for 2', followed by a step-down regime of 5 cycles of denaturation at 95°C for 30", annealing at 55°C for 30" and extension at 72°C for 1', 5 cycles with annealing at 52°C and 35 cycles with annealing at 48°C, and a final extension step at 72°C for 5'. PCR products were purified using ExoSAP-IT (Stratagene). Part of the purified PCR products was sequenced using the ABI BigDye Terminator Cycle Sequencing Kits v3.1 (Applied Biosystems) following basically the manufacturer’s instructions. Cycle sequencing products were cleaned using Sephadex (GE Healthcare) and subsequently analyzed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems) at the Natural History Museum in Oslo. Another part of the amplicons was sequenced externally at the sequencing facilities ABI-lab of the University of Oslo or Macrogen Europe in Amsterdam. New sequences were submitted to NCBI Genbank and BOLD (Ratnasingham & Hebert, 2007). Phylogenetic analyses. We analysed three molecular datasets: Capniidae 28S, Zwicknia COI and Zwicknia 28S + ITS. These datasets overlap only partially in taxon sampling: the 28S and COI matrices include sequences


BOUMANS & MURÁNYI

from external sources. The nuclear and COI sequences of Zwicknia were not analysed together because the nuclear and mitochondrial genomes turned out to have incongruent phylogenies (see below). Sequences were aligned in Geneious version 6.0.5 created by Biomatters (http://www.geneious.com). 28S data matrix: For the exploration of Capniidae relationships, our 28S sequences of Zwicknia and European Capnia s.l. species were aligned with sequences downloaded from NCBI GenBank representing Nearctic Capniidae, published by M.D. Terry and M.F. Whiting. The 28S gene phylogeny was reconstructed with Leuctra hippopus Kempny, 1899 as the outgroup. The Capniidae 28S matrix was first aligned without the outgroup (Supplement 1). Indel regions in this matrix were removed with the Indel region Module of the SeqFire application (Ajawatanawong et al., 2012), available from http://www.seqfire.org, with the default settings (‘partial treatment’ mode, Amino acid conservation threshold = 75, Amino acid substitution group = none, inter-indel space = 3). While designed for amino acid sequences, this application can also be used for DNA sequences. The initial 28S alignment of 37 Capniidae taxa was 769 bp long, but reduced to 594 bp after removal of indels and unalignable regions. The large length difference is mainly due to a 124 bp gap in the 28S sequence of Isocapnia hyalita Ricker, 1959 (Accession number EF622838). Even though this particular sequence from GenBank might be incomplete, we accepted the removal of this gap region as it contained little phylogenetic information in the other taxa. The reduced Capniidae matrix was subsequently aligned with the L. hippopus sequence, and fragments present in the former but not the latter were removed from the outgroup sequence (Supplement 2). In this manner, regions present in all Capniidae sequences but not in the outgroup were preserved. COI data matrix: For the reconstruction of the mitochondrial phylogeny of Zwicknia, we aligned our new COI sequences with 41 Zwicknia and 4 Capnia s.l. vidua sequences from south-central Europe published by Murányi et al. (2014) and 1 Zwicknia and 3 Capnia s.l. samples from the Barcoding Fauna Bavarica project (Hendrich et al., 2010). ITS + 28S data matrix: Since 28S alone was insufficiently variable to resolve the phylogeny at the genus level (see below), we combined our nuclear data matrix of Zwicknia and European Capnia s.l. with ITS sequences of the corresponding taxa. The alignment of Zwicknia 28S (ingroup only) has only one short indel. ITS regions, on the other hand, were found to be widely divergent among Zwicknia species and even among populations. The initial Zwicknia ITS alignment is characterised by 14 indels and 4–5 blocks of variable number dinucleotide repeats [AG]6–13, complicating both sequencing and alignment (Supplement 3). In order to obtain complete sequences for the entire ITS region, some consensus sequences had to be constructed from incomplete sequences originating from different conspecific specimens from the same locality. The sequence names in Fig. 25 refer to the specimens included in the consensus sequence. For some populations, only incomplete sequences were obtained. Eventually, fourteen Zwicknia ITS sequences were included in the analysis, and concatenated with corresponding 28S sequences (Supplement 4). The Indel region Module of SeqFire application was also used with the default settings to identify the regions that could not be reliably aligned in the 28S + ITS matrix. Since this program did not perform well with some incomplete sequences, it was used to mark the unalignable parts in a subset matrix of complete sequences. The indel marking was then copied to the alignment that included sequences with missing data, and the detected indel regions were deleted manually with Geneious. The initial 28S alignment of the fourteen Zwicknia taxa was 756 bp long, and reduced to 754 bp after removal of indels and unalignable regions; likewise, the ITS alignment, including 5.8S and adjacent portions of 18S and 28S, was reduced from 1222 bp to 941 bp. Subsequently, the resulting Zwicknia data matrix was aligned with sequences of C. vidua and C. nigra, and gaps resulting from alignment with the outgroup sequences were treated as missing data in all analyses. Supplement 4 contains the final ITS + 28S matrix. This approach was chosen to obtain the optimal phylogenetic resolution in the ingroup. However, it implies that the branch lengths connecting ingroup taxa are not on exactly the same scale as the branch lengths connecting the outgroup taxa. Tree reconstruction: Phylogenetic trees were constructed with distance (neighbour joining, NJ) and maximal parsimony (MP) methods implemented in PAUP*, and with Bayesian inference (BI) in MrBayes version 3.2 (Ronquist & Huelsenbeck, 2003). The ITS + 28S matrix was analysed with maximum parsimony and BI only, as it includes incomplete sequences. Distance measures for the neighbour joining method in PAUP* were based on the models selected with MrModeltest 2.2 (Nylander, 2004) for the respective data matrices (Table 1). We carried out heuristic searches under the optimality criteria distance and parsimony with tree bisection-reconnection branch swapping and 100 random addition sequence replicates. Bootstrapping (2000 replicates) was performed to obtain support values for branches.

TWO NEW ZWICKNIA


5

For BI, the COI data were divided in a partition for the third codon position, and another for the first and second position. Due to the limited number of substitutions in the 28S data matrix, we refrained from portioning these sequences and defining separate evolution models for stem and loop regions. The ITS+28S matrix was divided into two partitions, one for the variable ITS1 and ITS2 regions, and one for the more conserved regions 18S, 5.8S and 28S. Evolution models for BI (Table 1) were selected according to the Akaike information criterion implemented in MrModelTest 2.2. TABLE 1. Evolution models used in Bayesian and distance-based phylogeny estimation. data set

model

gamma shape value

p invariable

analysis

28S Capniidae

GTR+I+G

0.8616

0.5617

distance

COI non-partitioned

GTR+I+G

2.9944

0.6810

distance

28S Capniidae

GTR+I+G

NA

NA

Bayesian

COI 1st and 2nd position

GTR+I

NA

NA

Bayesian

COI 3rd position

GTR+I+G

NA

NA

Bayesian

18S + 5.8S + 28S Zwicknia

GTR+I

NA

NA

Bayesian

ITS1 +ITS2 Zwicknia

GTR+G

NA

NA

Bayesian

For each data matrix, we ran two independent analyses, each consisting of four Markov chains that ran for 40 × 106 generations and were sampled every 1000 generations, with default priors and the option “prset ratepr” set as “variable”. After discarding the first 10 million generations as “burn in”, remaining trees from both analyses were combined and a 50% majority rule consensus tree was calculated. MrBayes output files and Tracer v1.5.0 (Drummond & Rambaut, 2007) were used to inspect trace plots and convergence diagnostics (average standard deviation of split frequencies < 0.01, effective sample size > 200) in order to ensure that the Markov chains had reached statistical stationarity and converged on the parameter estimates and tree topology after the burn-in phase that was set at 25%. In the case of the COI matrix, the independent runs did not converge on estimates of all model parameters. This was solved by lowering the temperature parameter from the default value to temp=0.10 so as to obtain a better mixing of the Markov chains. Calculations in MrModeltest, PAUP* and MrBayes were performed at the Bioportal computer facility at the University of Oslo, Norway (this service was later substituted with Lifeportal, www.lifeportal.uio.no). In the tree diagrams of Zwicknia mitochondrial and nuclear phylogeny, all non-Zwicknia taxa were designated as outgroup. Distance and parsimony diagrams were chosen to illustrate 28S and ITS+28S trees, respectively, as to show the number of base pair differences between taxa.

Results and discussion Zwicknia westermanni Boumans & Murányi, sp. n. (Figs. 1–5; Fig. 6; Figs. 14–19) Capnia bifrons (Newman, 1838) wing measurements and figure of brachypterous male habitus; abiotic habitat characteristics at type locality—Westermann 1993 (the micropterous population in this paper refers to Z. rupprechti) Capnia bifrons (Newman, 1838) ‘Cappan’ race sensu Rupprecht 1997—Rupprecht 1997: 96 fig. 4 (drumming signals). Capnia bifrons (Newman, 1838) brachypterous population—Haybach 2004 (material not studied, but brachypterous population is likely to belong to Z. westermanni; the micropterous population referred to is probably either Z. bifrons or Z. rupprechti.)

Morphological diagnosis. Male brachypterous, ventral vesicle half as wide as the subgenital plate (Fig. 4). Main epiproct sclerite (Ep-scl): narrow and pointed in dorsal view (Fig. 2), tip straight, moderately acute in lateral view (Figs. 3, 14, 16, 18); ventral membranous section ends before the base in lateral view, apical spines stout, distributed not only on membranous parts but a few also on the sclerite (Figs. 14, 16, 18). Process of male tergite 9: high, perpendicularly raised, less than twice as wide as main epiproct sclerite (Fig. 2, 5), trapezoid and with sides not or just slightly indenting in caudal view (Figs. 5, 15, 17, 19).


BOUMANS & MURÁNYI

Type material. Holotype male: GERMANY: Lower Saxony, Hils Massif, Coppengrave, Duinger Wald, Hohenförsiek stream, N 5158.813' E 0941.732', 210 m, 05.03.2011, leg. L. Boumans & P.J. Nellestijn: 1 ♂ (NHMO: 10073107; used for molecular studies as No. 681). Note: all type specimens used for molecular studies have the head detached. Paratypes 5 males: GERMANY: Lower Saxony, Hils massif, Coppengrave, Duinger Wald, Hohenförsiek stream, N 5158.813’ E 0941.732’, 210 m, 05.03.2011, leg. L. Boumans & P.J. Nellestijn: 1 ♂ (HNHM: PLP4271; used for molecular studies as No.680, used for drawings Figs. 1–5, Figs. 14–15); 1 ♂ (HNHM: PLP4272; used for molecular studies as No .677, used for drawings Figs. 16–17); Idem, Hilsbach Stream, N 5158.769' E 942.642', 188 m, 26.02.2013, leg. L. Boumans & F. Westermann: 1 ♂ (NHMO: 10073047; used for molecular studies as No. 1876); FRANCE: Burgundy, Saône-et-Loire department, Curgy, Boisserand stream, N 46.99 E 04.38, 18.02.2010, leg. A. Ruffoni: 1 ♂ (HNHM: 4437; used for molecular studies as No.1868, used for drawings Figs. 18–19); 1 ♂ (NHMO: 10073059; used for molecular studies as No.1869). Other material - Records based on morphology: FRANCE: Provence-Alpes-Côte d’Azur, Var department, Pourrières, 12.02.1994, leg. G. Vinçon: 1 ♂ (HMHM: PLP4284); Provence-Alpes-Côte d’Azur, Bouches-du-Rhône Department, Aix-en-Provence, Sainte Victoire, Infernet, 12.02.1994, leg. G. Vinçon: 2 ♂ (HNHM: PLP4285); Provence-Alpes-Côte d’Azur, Var Department, La Garde-Freinet, Nible, N074 bridge, 02.01.2009, leg. M. Brulin: 4 ♂, 1 ♀ nymph (CGV); Provence-Alpes-Côte d’Azur, Var Department, Plan-de-la-Tour, Largoustaou, 205 m, 31.01.2009, leg. J. Le Doar: 1 ♂ (CGV). Description. Head, thorax, appendages and basal segments of the abdomen as is typical for the genus. Males brachypterous, females macropterous (Fig. 6). Body length: holotype 5.2 mm, male paratypes 5.0–6.0, female 7.5–8.0 mm; forewing length: holotype 2.3 mm, male paratypes 2.1–2.9 mm, female 8.0–9.0 mm. Male terminalia (Figs. 1–5, Figs. 14–19): Process of tergite 9 high, perpendicularly elevated, its apex is 0.95 and >0.99 respectively; MP and NJ bootstrap percentages are shown in this order separated by a slash. Bootstrap values 0.95 and >0.99 respectively; MP and NJ bootstrap percentages are shown in this order separated by a slash. Bootstrap values 0.95 and >0.99 respectively; MP bootstrap percentages >50 are shown.

assume that the mitochondrial phylogeny does not reflect the phylogeny of the Zwicknia species. Discrepancies may be the result of mtDNA introgression between sympatric species. Haplotypes shared by Z. bifrons and Z. acuta in Serbia (Fig. 24) indicate that gene flow between well-defined species has occurred in the recent past.


BOUMANS & MURÁNYI

Zwicknia bifrons and northwestern Z. rupprechti can be distinguished from each other by their ITS alleles (Fig. 25), but not by 28S alone (Fig. 23). For these two species, we find a high COI haplotype diversity corresponding to their wide geographical sampling (Table 3). Notwithstanding the very divergent haploclades, we consider the northern and southern populations of Z. rupprechti to be conspecific in view of their similarity in morphology and what is known about their drumming behaviour (Murányi et al., 2014). Additional research verifying the conspecificity of these clades is desirable, however. Zwicknia bifrons is distributed over no fewer than four divergent haploclades: Southern Spain, northern Italy, southeastern Europe (Bavaria + Hungary + Serbia), and northwestern Europe (northern Germany + Scotland + Norway). The northwestern and southeastern clades are reliably identified as Z. bifrons by their morphology and drumming behaviour (Murányi et al., 2014). Our specimens from southern Spain and northern Italy are a female and nymphs. The morphology, communication behaviour and species identity of these populations needs further study. The specimens from Italy are provisionally identified as Z. bifrons based on the known distribution (Murányi et al., 2014). First analyses of the male Call identify the population from the Sierra de Huétor as belonging to Z. bifrons (J.M. Tierno de Figueroa and J.M. Luzón-Ortega, personal communication). While the 28S + ITS data matrix has a more restricted taxon sampling, it does support a Z. bifrons clade that includes the genetically divergent specimen from the Baetic System in the southeast of the Iberian Peninsula (Fig. 25). The Sierras of southern Spain and particularly the Baetic System are areas of high endemicity that harbour lineages that have long been isolated from mainland Europe (e.g. Lozano et al., 2000; Saiz et al., 2013). Note in this respect also the divergent 28S alleles of Capnopsis schilleri (Rostock, 1892) from Norway and the Sierra de Huétor (Fig. 23). In this species, the uncorrected distance between the COI sequences of the Norwegian and Andalusian specimens (Accession numbers KF671117, KF809165) is no less than 11.1 %. More research is needed to establish whether the distinct lineages of Z. bifrons and C. schilleri should be considered conspecific with central European populations. The nuclear data show with strong statistical support that Z. rupprechti and Z. westermanni are more closely related to each other than either is to Z. bifrons (Fig. 25). This is at odds with the mitochondrial phylogeny, but it ties in with the species’ drumming behaviour. The two former species drum with a relatively high beat frequency and have long intervals between signal exchanges in duetting, whereas Z. bifrons has low beat frequency and a continuous exchange of Call and Answer signals in duets (Rupprecht, 1982).

Conclusion and outlook The 28S sequence data provide strong additional support for the distinctness and consistency of the genus Zwicknia. The description of two additional species contributes to the inventory of this West Palaearctic genus. The morphological and genetic distinctness of Z. westermanni confirm Westermann’s (1993) statement that the brachyptery of this species is genetically determined, as it is common to all identified populations. More molecular markers and a wider sampling of taxa are needed to reconstruct the phylogeny of the nuclear as well as the mitochondrial genome of the genus Zwicknia. For future molecular work on Capniidae and Zwicknia relationships we recommend the use of different nuclear markers, because in these taxa, 28S has few informative sites while ITS has many multi-allelic indels. The evolutionary history of the genus Zwicknia is of particular interest in view of the relatively complex and diverse species-specific systems of intersexual communication. A better understanding of the diversity in Zwicknia is also required for the assessment of species distribution and ecological relationships. Habitat preferences, for instance, may differ between congeneric species. Several authors mention ‘Capnia bifrons’ as being characteristic of summer-dry or intermittent water courses (Puig, 1984; Luzón-Ortega & Tierno de Figueroa, 2000; Westermann, 2003; Haybach 2004), while most already named species inhabit permanent, usually larger streams (Zhiltzova, 2003; Murányi et al., 2014). Exactly which Zwicknia species inhabit intermittent streams and which inhabit more permanent water needs to be reassessed.

TWO NEW ZWICKNIA


19

Acknowledgements Olga A. Loskutova, Syktyvkar, Russia, kindly collected Zwicknia specimens for us in the Komi Republic. Fulgor Westermann, Mainz, Germany, provided much practical help and valuable information during the fieldwork in the Hils area. Landskreis Hildesheim granted permission to collect aquatic insects in the protected area Duinger Wald. Alexandre Ruffoni, Lucy-le-Bois, Bourgogne, France, donated important samples from different sites in Burgundy and kindly gave permission to use his beautiful habitus picture of Z. westermanni. We thank Julio Luzón-Ortega and Manuel Tierno de Figueroa for contributing specimens and sharing their data on the drumming of Z. bifrons from Sierra de Huétor. In addition, the following persons kindly contributed specimens or helped in other ways to collect samples: Trond Bremnes, John Brittain, Klaus Enting, Robert Karlson, Bram Koese, Pieter Jan Nellestijn and Gilles Vinçon. Maribet Gamboa, Matsuyama, gave access to the southern European COI sequences before their publication. Lars Hendrich, Munich, gave permission to include unpublished sequences of the Fauna Bavarica DNA barcoding project. Hallvard Elven, Oslo, advised on the use and interpretation of the Tracer software. Gunnhild Marthinsen, Oslo, produced many of the DNA sequences analysed in this paper. Finally, we thank the three reviewers of Zootaxa for their feedback on our manuscript.

References Ajawatanawong, P., Atkinson, G.C., Watson-Haigh, N.S., MacKenzie, B. & Baldauf, S.L. (2012) SeqFIRE: a web application for automated extraction of indel regions and conserved blocks from protein multiple sequence alignments. Nucleic Acids Research, 40, W340–W347. http://dx.doi.org/10.1093/nar/gks561 Boumans, L. (2011) Databasing the stoneflies (Plecoptera) at the Natural History Museum in Oslo reveals new Norwegian province records. Norwegian Journal of Entomology, 58, 170–179. Boumans, L. & Baumann, R.W. (2012) Amphinemura palmeni is a valid Holarctic stonefly species (Plecoptera: Nemouridae). Zootaxa, 3537, 59–75. Crandall, K.A., Harris, D.J. & Fetzner Jr., J.W. (2000) The monophyletic origin of freshwater crayfish estimated from nuclear and mitochondrial DNA sequences. Proceedings of the Royal Society of London, Series B: Biological Sciences, 267, 1679–1686. http://dx.doi.org/10.1098/rspb.2000.1195 Haybach, A. (2004) Zur Kenntnis der Steinfliegenfauna (Insecta: Plecoptera) des Oberen Naheberglandes. Mainzer Naturwissenschaftliches Archiv, 42, 89–98. Hendrich, L., Balke, M., Haszprunar, G., Hausmann, A., Hebert, P. & Schmidt, S. (2010) Barcoding Fauna Bavarica – Capturing central European animal diversity. In: Nimis, P.L. & Vignes Lebbe, R. (Eds.), Proceedings of the Conference 'Tools for Identifying Biodiversity: Progress and Problems', Paris, September 20–22, 2010. Edizioni Università di Trieste, Trieste, pp. 347. Lillehammer, A. (1988) Stoneflies (Plecoptera) of Fennoscandia and Denmark. Brill, Leiden, 165 pp. Loskutova, O. (2003) Fauna of stoneflies (Plecoptera) of the European North-East Russia and its change under the influence of anthropogenic factors. In: Gaino, E. (Ed.), Research Update on Ephemeroptera & Plecoptera. Università di Perugia, Perugia, pp. 357–362. Lozano, F.D., Herbada, D.G., Rivero, L.M., Moreno, J. & Sainz-Ollero, H. (2000) Areas of high floristic endemism in Iberia and the Balearic Islands: an approach to biodiversity conservation using narrow endemics. Belgian Journal of Entomology, 2, 171–185. Luzón-Ortega, J.M. & Tierno de Figueroa, J.M. (2000) Primeras citas de Capnia bifrons (Newman, 1839) (Plecoptera, Capniidae) en el sur de la Península Ibérica. Boletín de la Asociación española de Entomología, 24, 218–219. McLain, D.K., Wesson, D.M., Oliver, J.H. & Collins, F.H. (1995) Variation in ribosomal DNA internal transcribed spacers 1 among eastern populations of Ixodes scapularis (Acari: Ixodidae). Journal of Medical Entomology, 32, 353–360. Murányi, D., Gamboa, M. & Orci, K.M. (2014) Zwicknia gen. n. for the Capnia bifrons species group, with descriptions of three new species based on morphology, drumming signals and molecular genetics, and a synopsis of the West Palaearctic and Nearctic genera of Capniidae (Plecoptera). Zootaxa, in press. Nelson, C.R. & Baumann, R.W. (1989) Systematics and distribution of the winter stonefly genus Capnia (Plecoptera: Capniidae) in North America. Western North American Naturalist, 49, 289–363. Nelson, L.A., Wallman, J.F. & Dowton, M. (2007) Using COI barcodes to identify forensically and medically important blowflies. Medical and Veterinary Entomology, 21, 44–52. http://dx.doi.org/10.1111/j.1365-2915.2007.00664.x Nylander, J.A.A. (2004) MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University. Puig, M. (1984) Distribution and ecology of the stoneflies (Plecoptera) in Catalonian rivers (NE-Spain). Annales de


BOUMANS & MURÁNYI

Limnologie, 20, 75–79. http://dx.doi.org/10.1051/limn/1984024 Ratnasingham, S. & Hebert, P.D.N. (2007) BOLD: The Barcode of Life Data System (http://www. barcodinglife. org). Molecular Ecology Notes, 7, 355–364. Roe, A.D. & Sperling, F.A.H. (2007) Population structure and species boundary delimitation of cryptic Dioryctria moths: an integrative approach. Molecular Ecology, 16, 3617–3633. http://dx.doi.org/10.1111/j.1365-294x.2007.03412.x Rupprecht, R. (1982) Drumming signals of Danish Plecoptera. Aquatic Insects, 4, 93–103. http://dx.doi.org/10.1080/01650428209361089 Rupprecht, R. (1997) An attempt to explain different drumming signals within Capnia bifrons. In: Landolt, P. & Sartori, M. (Eds.), Ephemeroptera & Plecoptera: biology, ecology, systematics. MTL, Fribourg, pp. 93–98. Saiz, M., Carlos, J., Donato, M., Katinas, L., Crisci, J.V. & Posadas, P. (2013) New insights into the biogeography of southwestern Europe: spatial patterns from vascular plants using cluster analysis and parsimony. Journal of Biogeography, 40, 90–104. http://dx.doi.org/10.1111/j.1365-2699.2012.02774.x Westermann, F. (1990) Limnologische Untersuchungen der Makrobenthosfauna unversauerter und versauerter Bäche im Hils (Weser-Leine-Bergland, Südniedersachsen) [unpublished thesis]. II. Zoologisches Institut. Georg-August-Universität zu Göttingen, Göttingen. Westermann, F. (1993) Wing polymorphism in Capnia bifrons (Plecoptera: Capniidae). Aquatic Insects, 15, 135–140. http://dx.doi.org/10.1080/01650429309361510 Westermann, F. (2003) Capnia bifrons (Insecta, Plecoptera) als Leitart sommer-trockener Bäche in Rheinland-Pfalz. Lauterbornia, 44, 107–119. Whiting, M. (2002) Mecoptera is paraphyletic: multiple genes and phylogeny of Mecoptera and Siphonaptera. Zoologica Scripta, 31, 93–104. http://dx.doi.org/10.1046/j.0300-3256.2001.00095.x Zhiltzova, L.A. (2001) Plecoptera fauna of Capniidae of Russia and adjacent territories (within the limits of the former USSR). In: Dominguez, E. (Ed.), Trends in Research in Ephemeroptera and Plecoptera. Springer, pp. 423–429. http://dx.doi.org/10.1007/978-1-4615-1257-8_49 Zhiltzova, L.A. (2003) Stoneflies (Plecoptera), group Euholognatha. Fauna of Russia and neighboring countries. New Series 145. Vol. 1. St. Petersburg: Nauka Publishers, 538 pp. [in Russian]

APPENDIX 1. Specimens list. Supplement 1. Initial alignment of Capniidae 28S sequences. Supplement 2. Final alignment of Capniidae 28S sequences. After the indel regions were removed from the initial Capniidae alignment, the resulting matrix was aligned with outgroup Leuctra hippopus. Supplement 3. Initial alignment of Zwicknia ITS sequences. Supplement 4. Final alignment of Zwicknia ITS sequences. After the indel regions were removed from the initial Zwicknia alignment, the resulting matrix was aligned with outgroup sequences of Capnia s.s. nigra and Capnia s.l. vidua.

TWO NEW ZWICKNIA


21


BOUMANS & MURÁNYI

ƚĂǆŽŶ >ĞƵĐƚƌĂŚŝƉƉŽƉƵƐ ĂƉŶŽƉƐŝƐƐĐŚŝůůĞƌŝ ĂƉŶŽƉƐŝƐƐĐŚŝůůĞƌŝ ĂƉŶŝĂƐ͘ů͘ǀŝĚƵĂ ĂƉŶŝĂƐ͘Ɛ͘ĂƚƌĂ ĂƉŶŝĂƐ͘Ɛ͘ĂƚƌĂ ĂƉŶŝĂƐ͘Ɛ͘ĂƚƌĂ ĂƉŶŝĂƐ͘Ɛ͘ŶŝŐƌĂ ĂƉŶŝĂƐ͘Ɛ͘ƉǇŐŵĂĞĂ ĂƉŶŝĂƐ͘Ɛ͘ƉǇŐŵĂĞĂ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂďŝĨƌŽŶƐ ǁŝĐŬŶŝĂĐĨ͘ďŝĨƌŽŶƐ ǁŝĐŬŶŝĂĐĨ͘ďŝĨƌŽŶƐ ǁŝĐŬŶŝĂŬŽŵŝĐĂ ǁŝĐŬŶŝĂŬŽŵŝĐĂ ǁŝĐŬŶŝĂŬŽŵŝĐĂ ǁŝĐŬŶŝĂŬŽŵŝĐĂ ǁŝĐŬŶŝĂƌƵƉƉƌĞĐŚƚŝ ǁŝĐŬŶŝĂƌƵƉƉƌĞĐŚƚŝ ǁŝĐŬŶŝĂƌƵƉƉƌĞĐŚƚŝ ǁŝĐŬŶŝĂƌƵƉƉƌĞĐŚƚŝ ǁŝĐŬŶŝĂƌƵƉƉƌĞĐŚƚŝ

ĐŽƵŶƚƌǇ ĞůŐŝƵŵ EŽƌǁĂǇ ^ƉĂŝŶ 'ĞƌŵĂŶǇ EŽƌǁĂǇ EŽƌǁĂǇ EŽƌǁĂǇ ƵƐƚƌŝĂ EŽƌǁĂǇ EŽƌǁĂǇ 'ĞƌŵĂŶǇ 'ĞƌŵĂŶǇ 'ĞƌŵĂŶǇ 'ĞƌŵĂŶǇ 'ĞƌŵĂŶǇ EŽƌǁĂǇ EŽƌǁĂǇ EŽƌǁĂǇ EŽƌǁĂǇ ^ƉĂŝŶ hŶŝƚĞĚ