proteins which include the structurally related midkine pro- teins and appear to function during brain development (for a review see Ref. 14). The mitogenic ...
THEJOURNAL OF BIOLOGICAL CHEMISTRY
Q 1992 by The American Society for Biochemistry and
Vol. 261, No. 36,Issue of December 25, pp. 26889-25897 1992 Printed in d..S.A.
Molecular Biology, Inc.
Pleiotrophin Stimulates Fibroblasts and Endothelial and Epithelial Cells and Is Expressed in Human Cancer* (Received for publication, July 14, 1992)
Wenjing Fang$, Nicola Hartman&, David T. Chow$, Anna Tate Riegel$$,and Anton Wellstein$#ll From the $V. T. Lombardi Cancer Center and the §Department of Pharmacology, Georgetown Uniuersity, Washington, D. C. 20007
Previously we reported the purificationof the hep- described by numerous laboratories under different names arin-binding growth factor pleiotrophin (PTN) from such as“heparin-affin regulatory protein(HARP)” (4, 5), supernatants of thehumanbreastcancer cell line heparin-binding neurotrophic factor (HBNF) (6,7)or p18 (8) MDA-MB-231. To investigate further the biological from bovine brain, heparin-binding growth associated moleactivities of PTN and its potential role in cancer, we cule (HB-GAM) from perinatal rat brain (9-11), heparincloned a PTN cDNA and expressed the gene in a human binding growth factor 8 ( E ) , osteoblast-specific factor from kidney and in a human adrenal carcinoma cell line mouse brain (13), and pleiotrophin (PTN)’ from human pla(SW-13).The supernatants harvested from cells trans- centa or rat brain (11).Due to its numerous biological activifected with PTN contained a heparin-binding specific ties, we have decided to use the latter name for this growth protein of anapparentmolecularmassof 18 kDa. factor. PTN belongs to a novel family of heparin-binding Thesesupernatantsstimulatedtheproliferationof endothelial cells as well as the anchorage-independent proteins which include the structurally related midkine progrowth ofSW-13 cells and of normal rat kidney fibro-teins and appearto function during brain development (for a blasts. Furthermore, SW-13 cells transfected with review see Ref. 14). Themitogenic activity of PTN, however, is still controversial (14). Several laboratories have described PTNacquiredautonomousgrowthin soft agarand were tumorigenic in athymic nude mice. In contrast to mitogenic activity of PTN purified from different sources for endothelial cells (4, 5, 7) and fibroblasts (6, 7, 11, 12). We these results with PTNfromhuman cells, PTNobtained from insect cells (Sf9)using recombinant bacu- reported that a purified preparation of PTN stimulates colony lovirus as a vector was biologically inactive. We de- formation in soft agar of the epithelial cell line SW-13, and tected high levels of PTN mRNA in 16 of 27 primary we identified PTN in this preparation by protein sequencing human breast cancer samples (62%)as well as in 8 of (3). However, other investigators have disputed an intrinsic 8 carcinogen-induced rat mammary tumors. Further- growth factor activity of PTN and have attributed theactivimore, 9 of 34 human tumorcell lines of differentorigin ties to FGFs or other growth factors contaminating the reshowed detectable PTN mRNA. We conclude that PTN spective preparations (15-17). may function as a tumor growth and angiogenesis facOur present study addresses this controversy by expressing tor in addition to its role during embryonic develop- the wild-type PTN cDNA under the control of a strongCMV ment. promoter in two human cell lines. A PTN point mutant with aprematuretranslationstop codon served asa negative control in these experiments. Weshow that supernatants from cells transfected with the wild-type construct but not Polypeptide growth factors have been shown to play impor- the point mutantcontain an 18-kDa heparin-binding protein tant physiological roles in the timely development of tissues that is immunoreactive and stimulates endothelial and SWduring embryonal and neonatal growth, and their expression 13 epithelial cells as well as fibroblasts. Furthermore, after is tightly regulated. On the other hand, polypeptide growth expression of wild-type PTN, SW-13 cells acquired autonofactor gene expression is deregulated in tumor cell lines as mous growth in soft agar and grew into tumors in athymic well as insolid tumors, and theactivity of polypeptide growth nude mice. This provides additional independent evidence factors appears to contribute significantly to autocrine and that the PTN gene product can act as a growth factor in paracrine stimuli (for a review see Refs. 1and 2). tumors. Furthermore, in agreement with a recent report from Previously we have reported the purification of an 18-kDa otherauthors(16), we were unable to obtain PTN in a heparin-binding growth factor from the conditioned medium biologically active form from insect cells which overproduced of a human breast cancer cell line MDA-MB-231 (3). The the protein after infection with PTN-recombinant baculoviNH2-terminal sequence of this factor did not bear homology rUS. to any known heparin-binding FGFs but was homologous to The potential significance of PTN for tumor growth is a developmentally regulated protein which has recently been addressed in further experiments studying expression of this gene in primary tumors and in tumor cell lines. About one* This work was supported in part by National Cancer Institute Grant UO1 CA51908 and by a grant from the Deutsche Forschungs- fourth of a series of established human tumorcell lines showed gemeinschaft (Germany) (to A. W. and N. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisernent” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ll To whom correspondence should be addressed Georgetown University, Lombardi Cancer Research Center, 3800 Reservoir Rd. NW, Washington, D. C. 20007. Tel.: 202-687-3672;Fax: 202-687-7505.
The abbreviations used are: PTN, pleiotrophin; CM, conditioned media; CMV, cytomegalovirus; FBHE, fetal bovine heart endothelial cells; FGF, fibroblast growth factor; HUVEC, human umbilical vein endothelial cells; NRK, normal rat kidney; FBS, fetal bovine serum; ORF, open reading frame; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; BES, N,N-bis(2-hydroxyethyl)-2aminoethanesulfonic acid; bp, base pair(s); kb, kilobase(s).
25889
25890
Expressionand Function Pleiotrophin
expression of PTN as assessed by RNase protection assays. Most significantly, more than half of a set of 27 primary human breast cancer samples contained high levels of P T N mRNA. Finally,carcinogen-induced ratmammarytumors also scored positive for P T N mRNA. We conclude thattheproteinproduct of this developmentally active gene seems to play a significant role in the progression of human tumors. Based on its mitogenic activities it most likely functions asa tumor angiogenesis factor.
and 0.5 mlof 2 X BES andincubated for 20 min at room temperature. The calcium phosphate DNA solution (1 ml) was then added to cells in 9 ml of growth medium and incubated for 24 h at 35 "C under 2.7% COZ. The cells were rinsed twice with growth medium, refed with growth medium, and incubated for 24 h at 37 "C under 5% COz. Stable transfectants were selected by culturing cells in the presence of G418 (250 pg/ml; GIBCO/BRL). Clonal cell lines were obtained by serial dilution. Cells were diluted to approximately one ce11/100 p1 of media and plated at 100pl into 96-well plates. After 2 weeks, the wells showing growth of an individual clone were harvested and propagated. Overexpression of Secreted PTN inSf9Insect CellsUsing the Baculouirus System-PTN was overexpressed using a recently develMATERIALS AND METHODS oped co-transfection system of a replication-deficient baculovirus in Cell Lines and Tissues-BT-474, BT-579, Hs-578T, MCF-7, MDA- combination with a plasmid containing complementing genes (PharMB-134, MDA-MB-231, MDA-MB-361, MDA-MB-435, MDA-MB- mingen, San Diego, CA) and the PTN insert under the polyhedrin 453, MDA-MB-468, SK-BR-3, T47D, ZR-75-1 (human breast canpromoter. The PTN insert from the pRc/CMV described above was cer), DU-145, LNCaP, PC-3 (human prostate cancer),A-549 (human subcloned into pVL1393 (Pharmingen). pVL1393 contains the neclung cancer),OVCAR-3, PA-I (humanovarian cancer), A-204 (human essary genes to rescue the replication-deficient baculovirus in insect rhabdomyosarcoma), A-431 (human epidermoid carcinoma), HL-60 cells. Plasmid and baculovirus DNA wereco-transfected into Sf9 cells (human promyelocytic leukemia), SW-13 (human adrenal cancer), (ATCC) kept at 27 "C in Sf-900 media (GIBCO/BRL). After generHGT-1, KATOIII (human stomach cancer), 293 (human embryonal ating recombinant virus with the PTN-gene insert and infection of kidney), FBHE (fetal bovine heart endothelium), NRK (normal rat Sf9 cells, approximately 10 mgof recombinant PTN were obtained kidney fibroblasts clone 49F) were obtained from the American Type from cell supernatants asassessed after NHz-terminal sequencing of Culture Collection (Rockville, MD). The following cell lines or sub- an aliquot of this preparation (see "Results"). lines were kindly made available by colleagues at the Lombardi Assays for PTN Secreted from PTN-expressing Cells-Media conCancer center: MCF/LY2 (human breast cancer) by Dr. M. E. Lipp- ditioned by different transfected cells were collected and loaded onto man (18), LnCaP/H26 (human prostate cancer) by Dr. E. P. Gel- heparin-Sepharose columns (PharmaciaLKB Biotechnology Inc.) mann,and OVCAR-2,OVCAR-4,A2780,A1827 (human ovarian pre-equilibrated with phosphate-buffered saline. The columns were cancer) by Dr. I. Ding. T47Dco cells were a gift of Dr. D. P. Edwards then washed with this buffer, and bound proteins were eluted either (University of Denver, Denver, CO). All of the above cell lines were with a step-gradient of 0.4, 0.9, and 2.0 M NaCl in 10 mM Tris buffer cultured in improved minimum essential medium or Dulbecco's mod- (pH 7.5) or in bulk with the 2.0 M NaCl step (3). ified essential medium (Biofluids Inc., Rockville, MD) with 10% fetal Immunoassay-Proteins present in 10O-pI aliquots were adsorbed bovine serum (FBS; Inovar Biochemicals Inc., Gaithersburg, MD). onto 96-well plates by overnight drying at 37 "C. The remaining free Human melanoma cell lines were a gift of Dr. M. Herlyn (Wistar binding sites in the wells were then blocked with 1%bovine serum Institute, PA)and were carried in keratinocyte growth media albumin dissolved in phosphate-buffered saline with 0.5% Tween 20 (GIBCO/BRL) with 10% FBS. Human umbilical vein endothelial (PBST) for 2 h at room temperature and washed three times with cells and melanocytes were purchased from Clonetics (San Diego, this buffer. After incubation with a rabbit antiserum against a peptide comprising the 10 NHz-terminal amino acids of mature, secreted CA). Tumor tissues were obtained from the National Disease Research PTN (NHz-GKKEKPEKEK; see Ref. 3) for 1 h at 4 "C, the plate Interchange (Philadelphia, PA) and from Dr. S. Paik (Tumor Bank waswashed again three times with PBST. The second antibody, of the Lombardi Cancer Center). Rat mammary carcinoma tissues peroxidase-labeled affinity-purified goat anti-rabbit IgG (Kirkegaard were kindly provided by Dr. M. Gottardis (Lombardi Cancer Center). & Perry Laboratories, Inc., Gaithersburg, MD) was added to the plate Tumor tissues were immediately snap-frozen in liquid nitrogen before at a dilution of 1/250 and incubated for 1 h at 4 "C. The plate was then washed four times with PBST and incubated with peroxibeing stored a t -70 "C. acid Generation of the P T N Expression Vector for Human Cell Linesdase substrate 2,2'-azino-bis(3-ethylbenz-thiazoline-6-sulfonic The PTN-gene was cloned from MDA-MB-231 human breast cancer (Sigma) for 5-30 min. Absorbance was then measured using a microcells from which the protein had been purified (3). Poly(A+) RNA plate reader (Dynatech Laboratories Inc., Chantilly, VA) at 405 nm. MetabolicLabeling-For in vivo metabolic radiolabeling, tranwas prepared from approximately 1 X 10' cells. After lysis of the cells siently transfected cells were washed once with cysteine-free growth in 5 M guanidinium isothiocyanate, 0.05 M Tris-C1 (pH 7.5), 5% pmercaptoethanol, 10 mM sodium EDTA, poly(A+) RNA was isolated medium (GIBCO/BRL) and then incubated with this medium and by oligo(dT) affinity chromatography (Invitrogen Corp., San Diego, 100 pCi/ml of [35S]cysteine.After 24 h the cell supernatants were CA). Poly(A+) RNAwas then reverse-transcribed to cDNA, and collected and immediately subjected to heparin-Sepharose chromasubsequently a specific fragment was amplified by the polymerase tography on a 0.4-ml column as described above. An aliquot of the 2 chain reaction (PCR) using the Gene AmpTM RNAreagants (Perkin- M NaCl eluates was analyzed by SDS-PAGE and autoradiography as Elmer Cetus). Sense and antisense primers corresponding to the 5'- described (3, 19). Growth Assays-Studies of anchorage-independent growth of NRK and 3'-untranslated regions of the human PTN transcript were synthesized (see Fig. lB), with additional HindIII and XbaI sites to fibroblasts and of SW-13 cells in soft agar were carried out as facilitate subsequent cloning of amplified PCR products. Three extra described (19). Briefly, 10,000cells in 0.35% agar (Bactoagar; GIBCO/ nucleotides (GGT) were included at both ends of the primers to BRL) were layered on top of 1 ml of a solidified 0.6% agar layer in a improve recognition of the cleavage sites by the restriction enzymes. 35-mm dish. Material to be tested was filter-sterilized, and 100-pl The primers were 5"GGTTCTAGAT ATGTTCCACA GGTGA- aliquots from the heparin-Sepharose were added with the 800-p1 top CATC-3' (3"antisense) and 5"GGTAAGCTTA GAGGACGTTT layer unless indicated otherwise. Growth media with 10% FBS were CCAACTCAA-3' (5"sense). An Eppendorf Microcycler E was used included in both layers. Colonies more than 60 pm in diameter were for the PCR reaction (initially 2 min a t 95 "C, then 1 min at 95 "C counted after 2-3 weeks of incubation using an image analyzer. The mitogenic assays with endothelial cells used an approach and 1 min at 50 "C for 35 cycles, and finally 7 min at 60 "C for 1 cycle). The PCR product was purified using the ion exchange columns described previously by Klagsbrun et al. (20). In brief, 50-p1 aliquots and reagants provided by Qiagen (Qiagen Inc., Chatsworth, CAI. The of the eluates from heparin-Sepharose were added to about 5,000 product of the PCR reaction was digested with HindIII and XbaI and cells/well using 24-well plates. After 4 days of incubation, the cells cloned into thepRc/CMV expression vector (see Fig. U t ; Invitrogen). were detached and counted with a particle counter. Tumor Growth in Animals-Female athymic nude mice (NCr nu/ This plasmid preparation was amplified in bacteria (strain DH5a). Positive clones were picked and the inserts were sequenced by the nu; Harlan Sprague-Dawley, Indianapolis, IN) were injected into a dideoxy chain termination method (18) using Sequenase version 2.0 mammary fat pad with 2 X IO6cells and observed for at least 8 weeks for tumor formation. from United States Biochemical Corp. Detection of mRNA by Northern Blots-Total RNAs were isolated Transient and Stable Transfections of Human Cells-The transfecwith the RNAzol'" B method using commercially available reagants tions were carried out using the calcium phosphate precipitation/low COz method as described (19). Briefly, approximately 5 X lo5 cells/ and protocols (RNAzol'" B; Tel-Test Inc.; Friendswood, TX). 30 r g IO-cm plate were seeded and incubated overnight in growth medium. of total RNA wereseparated by electrophoresis in 1.6%formaldehydeThen plasmid DNA (25 pg) was mixed with 0.5 ml of 0.25 M CaCL agarose gel and then blotted onto nylon membranes (Schleicher and
Pleiotrophin Function and Expression Schuell). The blots were prehybridized in 6 X SSC (= 0.9 M NaC1, 0.09 M sodium citrate (pH 7.0)), 0.5% (w/v) SDS, 5 X Denhardt’s solution (= 0.1% (w/v) Ficoll, 0.1% (w/v) polyvinylpyrrolidine, 0.1% (w/v) bovine serum albumin) (GIBCO/BRL) for 4 h a t 68 “C and hybridized overnight a t 68 “C in hybridization solution (same composition as the prehybridizationsolution withaddition of 0.01 M EDTA (pH 8.0)) (GIBCO/BRL) containing a [a-32P]dCTP-labeled P T N cDNA probe. This probe was prepared by random primed DNA labeling (BoehringerMannheim). Afterhybridization, blots were washed once with 1 X SSC and 0.1% SDS for 20 min, once with 0.2 X SSC and 0.1% SDS for 20 min at room temperature, and once for 20 min at 68 “C. Blots were then autoradiographedusing intensifying screens a t -70 “C for 2 days. Detection of mRNA by RNase ProtectionAssays-An [a-32P]UTPlabeled antisense riboprobe was prepared by in vitro transcription with SP6 RNA polymerase from linearized pPTNwt plasmid. Of this 832-hp probe, a 551-bp fragment will be protected by PTN mRNA present in the samples. As a loading control a 310-bp probe for the human acidic ribosomal phosphoprotein PO (3684)was used. A 210bp protected fragment is expected from this probe. 30 pgof total RNA were hybridized with 50,000 dpm of probe overnight a t 50 “C. Samples were then digested with 40 pg/ml of RNase A (Boehringer Mannheim) for 30 min at 25 “C. The RNase digestion was terminated by adding 250 pg/ml of proteinase K (Boehringer Mannheim) and 0.5% SDS for 15min a t 37 “C. The samples were extracted with phenol/chloroform once and precipitated together with 10 fig of tRNA inethanol.Pellets were boiled in formamideloadingbuffer and separated on a 6% polyacrylamide sequencing gel. The gels were dried and exposed with intensifying screens at -70 “C for 2-4 days.
25891
CMV RMnOtOI
BGH PA
sv early
.
B ORF F T N ,
5’ t
t
hsp 70 (2551-2646)
PTN IL
PTN mu
\
t-
L7 (21.2%)
.
I
signal p e p t i d e
.
AGAGGACGTTTCCAACTCAAA4 ATG
CAG GCT Q R
~-
H - 3 2 ~ 3 1~ 3 0 CAG GCT Q A -
AGAGGACGTTTCCAACTCAMA ATG H
GCT GAA GCA ~ ~ A -3 -2 -1
-
secreted protein
...
GGG AAG AAA GAG AAA CCA G M K E K P E E G AK 1 2 3 4 5 6 7
GCT GAA GCA GGG AAG AAA GAG AAA CCA CAA A E GA K K E K P E
RESULTS
We previously purified an 18-kDa heparin-binding growth factor from the conditioned medium of an estrogen receptornegative human breastcancer cell line MDA-MB-231(3). The NH,-terminal sequence of the purified protein was homologous to that of PTN purified by others from normal tissues (see Introduction), and an mRNA coding for P T N was expressed in the MDA-MB-231 cells. This purified protein was growth stimulatory in soft agar forthe epithelialcell line SW13 as well as for normal rat kidney fibroblast (NRK). To studythe function of PTN and to provideevidence that growth stimulatory activities observed withour purified preparation were due to PTN, we decided to clone the cDNA for P T N from MDA-MB-231 cells, express the gene, and study the function of the recombinant product. We opted for expression in human cells, since PTN is secreted after cleavage of a 32-amino acid signalpeptide (3) and contains 10cysteine residues linked by disulfide bridges (8). Our earlier studies indicated that thesedisulfide links are required for biological activity since treatment with the reducing agent dithiothreitol destroys mitogenic activity of PTN (3). We alsoproduced P T N on a large scale in insect cells using baculovirus as a vector. However, PTN produced in insect cells was biologically inactive in the growth assays (see below).
PTN wf
K 8
PTN mu
--
AAA GAA AAA AAA GTG AAG AAG TCT GAC TGT
E 9
K 10
K
V
K
K
11
12
13
14
S 15 16
D
AAA CAA AAA AluL AGT G M GAA GTC TGA
K
E
K
K
C
E
E
V
C 11 CTG
-
--
-
ATG CTG GAT TAA MGATCTCACCTCTCCAACATA M L D U 136 135 136
--
-.
--
AAGATCTCACCTCTCCMCATA
. .
-
t
FIG. 1. Construct used in the transfection studies (A) and comparison of wild-type and mutant PTN inserts ( B ) .A , the plasmid map of the PTN cDNA construct used for transfection is shown. The original plasmid pRc/CMVwas obtained from Invitrogen (San Diego, CA). The construction is described under “Materials and Methods.” BGH PA, bovinegrowth hormone poly A site. B, the overall structure of the PTN cDNA is depicted at the top. The solid bar indicates the openreading frame ( O R F ) of PTN. Shaded bars in the 5’- and 3”untranslated regions of P T N indicate areas that are homologous to regions in the antisense strandsof the human cDNAs of hsp70 and L7, respectively (see “Results” for details). The start position of the primers used for PCR cDNA cloning is indicated by arrowheads, and the respective nucleotide sequence is given below. The position of the frame shift mutation in the ORF is symbolized by a vertical arrow, and therespective nucleotide and deduced amino acid sequence in the wild-type and mutant construct areshown. The full-length PTN cDNA andamino acidsequence are accessible through GenBank/EMBL with the accession numbers M57399 and P21246, respectively.
EMBL accession number X04677). Furthermore, a stretch of 277 nucleotides at thevery 3’ end of the PTNcDNA is 98.6% Constructs Used in the Expression Studies homologous to the antisense 5’ end of the human ribosomal For the studies on P T N function, we transfected into hu- protein L7 cDNA (GenBank/EMBL accession number X52967) (see Fig. 1B). Toavoid interference of high levels of man cell lines a P T N construct with a strong constitutive CMV promoter. Our earlier studies with SW-13 cells and the PTN gene expressionwith the expression of endogenous hsp70 or L7, we decided to includeonly the openreading K-FGF gene (19) and preliminary studies with the human kidney cells 293 had shown that this promoter supportshigh frame (ORF)of PTN in our expression vector. We used PCR levels of gene expression in these cell lines. We utilized the primers extending 22 nucleotides into the 5’- and 3“untranscommerciallyavailablepRc/CMVvector (Fig. 1A) which lated regions of PTN, respectively, to maintain the context of the PTNgene (see contains a CMV promoter upstreamof a multiple cloningsite of the natural translation initiation site and a transcription unit for the G-418 resistance gene for Fig. 1B). Additional Hind111 and XbaI sites were included at the ends of the primers to facilitate cloning of an amplified selection of stably transfected eukaryoticcells. A data base search with the PTN cDNA showed that a product. A specific DNA product was PCR-amplified after reverse stretch of the initial 97 nucleotides at the 5’ end of P T N is 90.7% homologous to the antisense strand of the 3’ end of transcription of poly(A+) RNA from MDA-MB-231 cells as humanheat shock protein 70 cDNA (hsp7O) (GenBank/ published previously (3). The resulting 569-bp product was
25892
Expressionand Function Pleiotrophin
clonedinto pRc/CMV (Fig. 1A). Sequencing of the PCR product after bacterial amplification selection and of different bacterial clones showed that one construct, pPTNwt, contained thewild-type cDNAwith the complete ORF. This ORF of pPTNwt contains 507 nucleotides and is identical to the reported human cDNA sequence of P T N (GenBank/EMBL accession number M57399). One of the bacterial clones picked contained a plasmid with a point mutation in the ORF of PTN. At position +130 (relative to the translation initiation site) an additional A was inserted (see Fig. 1B). This frame shift mutation results in a premature translation stop codon after aminoacid 15 of the mature protein. The protein product expected from this frame shift construct is the signal peptide and a 15-mer peptide comprising 11 residues from the NH2 terminus of the mature PTN protein. We used this mutant construct as ournegative control in further studies due to the fact that wild-type and mutant expression vectors only differ by a single nucleotide.
P
-69 -46 -30 -21 -14 1 2
T
B
Demonstration of Secreted and Biologically Active P T N Protein in Transient Expression Experimentsin Human Cells In one series of experiments we transfected the human embryonal kidney cell line 293 with the wild-type (pPTNwt) L and mutant (pPTNmu) constructsdescribed above. CM from mu:= rl:0 500 transfected transiently transfected293 cellswere used forfurther analysis T of secreted protein products. After in vivo metabolic [35S] 400 - stimulated by CM cysteine labeling of transfected cells for 24 h, the cell supernatants were collected and passed through heparin-Sepharose columns. The eluted proteins from the columns were separated by SDS-PAGE (Fig. 2.4). A labeled protein migrating at about 18 kDa was the only species in this heparin affinitypurifiedmaterialthat is presentinsupernatantsfrom pPTNwt but notfrom pPTNmu-transfected cells. The appare n t molecular mass of this metabolically labeled protein was identical to thatof the PTNprotein originally purified from SW-I3 K R K FBHE HI’VEC cells colonies colonies supernatants of the MDA-MB-231 breast cancer cells (3). This protein was also recognized in a Western blot using a FIG.2. Transientexpressionexperiments with pPTNwt rabbit polyclonal antiserum against PTN (data not shown). and pPTNmu in human kidney (293) and SW-13 cells. A, SDSFurthermore, as shown in Fig. 2B, a high amount of P T N PAGE of i n oiuo [”Slcysteine-labeled conditioned media from wildimmunoreactivity was detected in the CMof pPTNwt-trans- type (lane 1 ) and mutant (lane 2 ) transiently transfected 293 cells. After a 24-h incubation, labeled media were loaded onto two separate fected 293 cells and no signal above background with CM heparin-Sepharose columns, unbound material was washed off, and from the pPTNmu controls. bound proteins were then eluted with 2 M NaCI. The eluted proteins Heparin affinity-purified CM collected from the transient were analyzed by a 15% SDS-PAGE (for details see “Materials and expressionexperimentwith 293 cellswas alsotested for Methods”). The autoradiogram was obtained after3 days of exposure. growth-stimulating activity in SW-13, NRK, and endothelial The arrolvhead indicates theonly detectable bandthat differs between lane 1 and 2. B, immunoassay for P T N of conditioned media from cells. Fig. 2C shows that the CM from pPTNwt relative to mutant and wild-type transfected 293 cells afterheparin affinity pPTNmu-transfected cells stimulated the colony formation chromatography as in A. A rabbit polyclonal antiserum against the of SW-13and of NRK cells insoftagaras well as the NHZ-terminal sequence of P T N was used. The control represents the proliferation of endothelial cells fromfetalbovineheart absorbance reading after incubation without any antigen(for further (FBHE) and human umbilical veins (HUVEC). Finally, we details see “Materials and Methods”). C, assay for growthstimulatory also tested whether SW-13 cells transiently transfected with activities of PTN. Conditioned media were collected from the tranpPTNwt would secreteautocrine-acting growth factor by siently pPTNwt- and pPTNmu-transfected293 cells and loaded onto columns as inA. The bound proteins were eluted plating them into soft agar. As shown in Fig.2C, a 4-fold heparin-Sepharose by 2 M NaCl and then assayedfor soft agar colony formation of SWhigher colony number in soft agar was observed from the 13 cells andnormalrat kidney fibroblasts ( N R K ) as well as for transient pPTNwt versus pPTNmu-transfected SW-13 cells. mitogenic activity on fetalbovine heart ( F B H E )and humanumbilical Obviously, the activity of the transiently secreted growth vein endothelial (HUVEC) cells. Spontaneous colony formation of cells insoftagar was assayed in factor is sufficient to induce a n autocrine growth stimulation transientlytransfectedSW-13 in thisassay. Taken together, these data indicate that biolog- addition (for detailssee “Materials and Methods”). ically active P T N is secreted into the media of human cells after transient pPTNwt transfection. transient overexpression. SW-13 cells were chosen for these studies, since they do not form colonies in soft agar unless P T N Expression and Biological Activity afterStable stimulated by added FGFs or P T N (3). Our earlier studies Transfection of Human Cells have also shown that expression of secreted K-FGF in these In a separate set of experiments we studied the effects of cells is sufficient to make them clonogenic in vitro and tustable PTN transfection to rule out potential artifacts of a morigenic in vivo (19). From the transient transfection stud-
h
T
Expressionand Function Pleiotrophin
25893
ies, we selected pPTNwt and pPTNmu stable transfectant SW-13 cell lines using (3-418, and we obtained several cell lines of clonal origin in addition to the mass-transfected SW13 population. Northern Blot-From our construct we expected a 0.8-kb P T N transcript in the pPTN-transfected cells whichis clearly distinct from the constitutivelyexpressed P T N mRNA of 1.4 kb in untransfected PTN-positive cells. A Northern blot with RNA from the PTN-positive MDA-MB-231 breast cancer 18 s cells indeed shows this latter transcript(Fig. 3A, lane 1 ) and no transcript in the parent SW-13cells (lane 2). A high level of a 0.8-kb transcript hybridizing with the PTN probe was observed in the pPTNwt- and pPTNmu-transfected SW-13 cells (lanes3 and 4 ) , and nosignal was seen from SW-13 cells transfected with the vector alone without a P T N insert ( l a n e 5 ) . Obviously the transfected SW-13 cellsproduceahigh 1 2 3 4 s steady-state level of mRNA with both the mutant andwildtype PTN constructs, and the transfection itselfdoes not induce transcription of the endogenous gene. Growth in Soft Agar-Stably transfected SW-13 cells were placed in soft agar andFig. 3B illustratesthat cells harboring pPTNwt grow large colonies relative to the pPTNmu cells. Stable expression of P T N obviously leads to a phenotype of SW-13 cells that can grow anchorage-independently due to a n autocrine action of the growth factor. Heparinaffinitychromatography of conditioned media from the stable pPTNwt and pPTNmu-transfected SW-13 cells was carried out to compare the affinity profile with that of native P T N originally purified from supernatants of MDAMB-231 cells (3). We used the same step gradientof 0.4, 0.9, and 2 M NaClemployedpreviously to elute growth factor activity from the column. As can be seen from Fig. 3C, pPTNwt-transfected SW-13 cells release a heparin-binding growth factor into their media that is eluted by 0.9 M NaCl. This heparin affinityprofile is identicalto thatof the original P T N purified from MDA-MB-231 cells. It is clearly distinct from acidic FGF and basic FGF which require higher salt concentrations for their elution (3). Clonal Cell Lines-G-418 resistant clonal SW-13cell lines transfected with pPTNwt or pPTNmu were generated and expanded to assay for P T N gene expression,biological activity CMFL I 2 3 4 5 6 7 8 fractions of the secreted product, and for tumorigenicity in athymic nude mice. Fig. 4 shows a dose-response curve of conditioned FIG.3. Stable mass transfection of SW-13 cellswith media from three different clonal cell lines that express sim- pPTNwt and pPTNmu. A , Northern analysis of PTN expression ilar high levels of PTNwt or PTNmumRNA. As is apparent, using 3ZP-labeled PTN probe. Total RNA (30 pgllane) from parent only the pPTNwt expressing cells secrete soft agar growth- SW-13 cells (lane2 ) , SW-13 cells transfected with pPTNwt(lane3 ) , pPTNmu (lane4 ) , and the vector without a PTN insert (lane5 ) was stimulating activity for the parent SW-13 cells into their used. Total RNAfrom MDA-MB-231 human breast cancercells (lane media. These experiments with stable transfections lend ad- I ) is shown for comparison. The arrowheads indicate the1.4-kb P T N ditional support to thegrowth factor activity of P T N shown mRNA expressed constitutively (top) and the 0.8-kb transcript deabove in the transient transfectionstudies. (bottom).Further details rived from the transfected pPTN constructs Tumorigenicity of S W-13Cells Transfected with PTN Our earlier studiesshowed that expressionof an autocrineacting growth factor can make the nontumorigenic SW-13 cells grow into tumors in athymic nude mice (19, 21). Since SW-13 cells respond t o P T Nby forming colonies in soft agar (see above), we used PTN-transfected SW-13 cell lines to assessthepotential role of this growth factorfortumor development in vivo. Different clonal SW-13cell lines transfected with pPTNwt and pPTNmuwere injected subcutaneously into athymic nude mice. We chose clonal cell lines with different levels of P T N expression to test whether tumorigenicity is dependent on the level of P T N gene expression. P T N mRNA steady-state levels of the clonal cell lines were assessed by RNase protection assays. Four clones expressing PTNwt at different levels were chosen as positive controls,
are described under “Materials and Methods.” B, soft agar colonies growing from pPTNmu (left)- and pPTNwt (right)-transfected SW13 cells. The bar indicates a size of 100 pm. C, heparin affinity chromatography of conditioned media from pPTNwt (circles)- and pPTNmu(triangles)-transfectedSW-13 cells. Conditioned media (CM) were passed over heparin-Sepharose and bound proteins were eluted with a stepwise NaCl gradient. Aliquots of the fractions were then assayed for stimulatory activity on parent SW-13 cells in soft agar. FL,flow-through.
whereas a high pPTNmu expressor clonal cell line served as a negative control (see Table I). Tumor formation was checked on a weekly basis. After 8 weeks no tumors were observed in the animals injected with the high pPTNmu or with the low PTNwt expressing cells (Table I). Three of ten animalsinjected with the two medium PTNwt expressor cell lines, and all animals
25894
Pleiotrophin Function a n d Expression I
,
I
1
*
-
clone I mut
0 1 0
V
I
I
100
200
300
400
conditioned media (p1 )
500
shown). We obtained the NHderminalsequence of the first 11 amino acids of both species and found that they were identical to the NH2 terminusof the secreted form of P T N (NHz-GKKEKPEKKVK) (3). Obviously, theproteingets processed properly for secretion in thissystem. However, this purified preparation showed no growth stimulatory activity on SW-13 cells or on NRK cells in a range between 1 and 1,000 ng/ml. We suspect that posttranslational modifications, improper processing, or folding of P T N in the insect cell system led to this biologically inactive preparation (see also ‘‘Discussion”). It is worth pointing out that extremely high P T N concentrations of about 1 pg/ml from insect cells (16) and from a bacterialexpressionsystem (17) showed some neurite outgrowth and minor mitogenic activity, This activity could be due to tracesof active P T N present in these preparations from nonmammalianexpression systems.
FIG. 4. Bioassay of conditioned media from clonal SW-13 PTN mRNA in Tumor Cell Lines and TumorTissues cell lines transfected with pPTNwt and pPTNmu. Different stablytransfected amounts of conditionedmediaharvestedfrom PTN Expression in Cell Lines-Approximately one of four clonal SW-13 cell lines were tested for their soft agar colony-stimulating activity in parent SW-13 cells. Clone 1 mutant and clone 8 human tumor cell lines surveyed in our studies expressed the P T N gene as assessed by RNase protection assays(Fig. 5 and wild type were also used in tumorigenicity studies (see Table I). Table 11). Some correlativeevidence suggests that PTN gene expression couldplay a role in invasive and/or metastatic TABLEI Tumorigenicity studies in athymic nude mice wing clonal SW-13 cell behavior of the cell lines or of the original tumors they were obtained from. One example is the highly tumorigenic and lines transfected with pPTNwtand pFTNmu Five animals per group were injected with 2 X lo6cellsfsite. Tumors invasive breast cancer clonal cell lineT47Dcowhichdoes were measured 8 weeks after the injection of cells. The tumor size express PTN, whereas the less malignant T47D parent cell was calculated from the product of perpendicular diameters of the line does not. Another example are thetwo cell lines derived tumors (for further details see “Materialsand Methods”). from metastatic melanoma which did express PTN, whereas PTN mRNA level Number of tumors/ Size of cell lines derived from melanocytes and from primary melaCell line number of animals the tumors noma did not express PTN. On the other hand, expression of mm’ the PTN genedid notappearto be relatedtohormonal SW-l3/pPTNwt sensitivity of breast cancer cell lines, although the loss of 5/5 52 ? 16 Clone 8 High hormone sensitivity is usually associated with a more maligClone 6 18 215 Medium nant phenotype of breast cancer (23). Clinical studies will 24 115 Clone 4 Medium yield more conclusive evidenceas to whether PTN expression 015 Clone 5 Low in tumors is associated with a more malignant progression of SW-13fpPTNmu the respective disease. Clone 1 High 015 PTN Expression in Tumors-To address the issue of PTN expression and malignant progression, we have started to injected with the high PTNwt expressorcell line grew tumors. screen primary human breast cancer samples for P T N expresObviously, if P T N is expressed at sufficiently high levels in sion using RNase protection assays of freshly frozen tumor SW-13 cells, they gain the ability to grow colonies in soft agar tissues. We had access to tumor samples from 27 randomly and also become tumorigenic in athymic nudemice. selected breastcancerpatients. Seven of thesamplesare shown in Fig. 5 (lunes 4-10). As can be seen from the loading Expression of PTN in Insect Cells Using the Baculovirus control (36B4 mRNA),theamount of RNA used inthe System different reactions was equivalent. In this experiment, P T N To obtain large quantities of PTN, we decided to overex- mRNA was detected in three of the samples at a level comcell line press the gene in the eukaryotic Sf9 insect cells. We decided parable with thatof the MDA-MB-231 breast cancer against a prokaryotic expression system, since proteins have (cf. lane l l ) , whereas the other four breast cancer samples t o be extracted under harsh conditions and in our hands P T N were negative for PTN. In our total survey so far we found completely lost activity after treatment with organic solvents P T N mRNA expressed in 16 of 27 (62%) of the breast cancer like acetonitrile orwith the reducing agent dithiothreitol(see samples. Obviously, P T N is only expressed in a fraction of be seen in a largersurvey Ref. 3). To achieve production of biologically active disulfide the tumors, and it remains to bridge-containing proteins in prokaryotic systems, denatura- whether P T N positive tumors indicate a different prognosis tion and refolding conditions have to be worked out empiri- of the respective patient. It is worth pointing out that normal cally (see Ref. 22), and we wished to circumvent these obsta- breast tissue, which is present in these tumor samples, does not expressPTN ata significant enough level to be picked up cles by using the eukaryoticbaculovirus/insect cell system. We infected Sf9 insect cells with recombinant baculovirus by the RNase protectionassay. Finally, we assayed for P T N gene expression in carcinogencontaining a transcription unit for P T N driven by the polyhedrin promoter (for details, see “Materials and Methods”). induced mammary carcinoma in rats (Table 11). This is a We harvested media from these infected cells after 2-3 days standard animalmodel of breast cancer andis frequently used and partiallypurified P T N from themedia by heparin affinity to evaluate the efficacy of breast cancer treatments (24, 25). To our surprise all eight tumors studied showed high levels of chromatography. The predominant proteins present after elution from the column were an 18- and a 14-kDa species P T N gene expression as assessed by Northern blot. Studies of other laboratories (26, 27) have shown that in carcinogenvisualized by Coomassie stainingafterSDS-PAGE(not
25895
Pleiotrophin Function and Expression * FIG. 5. Expression of PTN mRNA in human tumorcell lines and breast 622cancer samples analyzed by RNase protectionassays. “2P-Labeledribo52% probes for P T N (lane 1) and for the ribosomal protein 36B4 (lane 2) were used. After hybridization of yeast tRNA 404-y (lane 3), or total RNA (30 pg; lanes 417), thesamples weredigested with RNase, fractionated on a 6% 8 M urea polyacrylamide gel, and autoradiographed for 2 days. The arrowheads indicate specific protected fragments of P T N ( t o p ) and 36B4 (bottom). Lanes4IO,primary human breast cancer tissues from different patients. Cell lines: lane 11, MDA-MB-231; lane 12, SW-13; lane 13, MCF-7; lane 14, ZR-75-1; lane 15, WM 239A; lane 16, WM 852; lane 17, Hs-578T (for further details see “Materials and Methods” and Table 11).
”
-
0
4
*
1 2
3 4
5 6 7 8 9 1 0
-
4
d
11 12
13 14
15
16
17
TABLE I1 PTN mRNA expression in cell lines and tumor tissues RNase protection assays were used for the human cell lines and tissues and Northernblots for the rat tumor tissues. Orinin
characteristics Saecial
Human cell lines Breast cancer
Prostate cancer Melanocytes and melanoma Ovarian carcinoma Others
Tumor tissues Human primary breast cancer Rat carcinogen-induced mammarv cancer
PTN mRNA-positive
Estrogen receptor-positive
T47Dco
Estrogen receptor-negative
MDA-MB-231, MDA-MB-361, Hs-578T
Melanocytes, primary melanoma, metastatic melanoma
PC-3 WM 852, WM 239A
PTN mRNA-negative
T47D/wt, MCF-7, MCF”i/LY-2, ZR-75-1 BT-474, BT-549, MDA-MB-134, MDA-MB-435, MDA-MB453, MDA-MB-468. SK-RR-3 DU-145, LNCaP, LNCaP/H26 Melanocytes, 39, D
A1827, PA-1
A2780, OVCAR-2, -3, -4 A-431 HL-60 A-204 HGT-1, KAT0 111
n = 16 n=8
n = 11 n=O
Epidermoid carcinoma, leukemia, rhabdomyosarcoma, stomach cancer
induced tumors, neoangiogenesis is one of the early signs of questioned by different laboratories (14-17), and we will dismalignant growth, and we are currently investigating whethercuss this point first. In our purification protocol that resulted activation of P T N gene transcription and of angiogenesis in in the detection of PTN in conditioned media from tumor the tumorous lesions coincide. cells, we used a soft agar cloning assay to select chromatographic fractions containing biologically active growth factor DISCUSSION (3). Although the major protein in that fractionwas identified Our current studies focus on the biological activities of the as PTN by NH2-terminal sequencing, it is conceivable that heparin-binding growth factor PTN and its potential as a other contaminating minor proteinscould contribute in part or completely to the biological activity observed. It should, tumor growth factor. Originally P T N was purified from developing rat brain andbovine uterine tissues and preliminary however, be noted that none of the known growth factors for NH2-terminal amino acidsequence data of P T N were re- SW-13 cells (19) were detected by us in the purified PTN ported in 1989 (9, 12). It was postulated by different labora- preparation by immunoblots (3), and theseconsiderations led tories (11, 14,28)that PTNis a protein that functions during us to believe that PTN was the active growth factor present in the purified material. neuronal growth and development, but other data indicated The final proof that PTN acts asa growth factor can only that PTN also acts as a mitogen for fibroblasts (11) and for endothelial cells (5). We were the first to report the purifica- stem from production of recombinant material and our current study provides this evidence. The autocrine activity of tion of PTN as agrowth factor from thetissueculture supernatants of a human cancer cell line (MDA-MB-231), P T N is apparent from experiments with SW-13 cells transand we also detected active P T N in supernatants from human fected with P T N (Figs. 2C and 3B). The paracrineactivity of melanoma cells (3). We therefore postulated that P T N may P T N is demonstrated in studies in which PTN is harvested play a role in the promotion of tumor growth in addition to from the supernatants of transfected cells and added back its presumed function during neuronalgrowth (3). onto different cell lines to study its mitogenic or soft agar Very recently the mitogenic activities of P T N have been colony stimulating effects (Fig. 2C, 3B, and 4). We show that
25896
Pleiotrophin Function and Expression
transient expression of PTN in humankidney cells as well as tumorigenic T-47Dcosubclone (see Table 11).Whether or not SW-13 cells results in the secretion of immunoreactive and P T N expression supports amore malignantphenotypeis biologically active P T N from these cells (Fig. 2). The growth currently being addressed by expressing the gene in PTNfactor activity was not only assessed with SW-13 cells but negative tumor cell lines. also using NRK fibroblasts andtwo different endothelial cell We have expanded our studies with cell lines to tissues lines. Furthermore, stable transfection and selection of clonal from primary human tumors and found of1627 breast cancer SW-13 cells gave the same result, namely that PTN functions samples positivefor PTN (Table 11, Fig. 5). Sincebreast as a secreted growthfactor (Figs. 3 and 4). A final experimen- cancersamplescontainmixtures of normal and of tumor a growth factor in tumors are tissue, the fact that11 of the samples were negative for P T N tal proof that PTN can act as results from animal studies which show that clonal SW-13 mRNA indicate that P T N is not present in normal breast cellsexpressing P T N form tumors in athymic nude mice tissue a t levels high enough to be detected with RNase pro(Table I). It should be emphasized that in all of these studies, tection assays. P T N detected in the other 16 breast cancer our negative controls were cells expressing P T N with a frame samples is thus mostlikely derived from the tumor cells and shift point mutationleading to a truncated product(Fig. 1B). not from activated normal host parenchyme. Ina pilot study We conclude that PTN acts as a tumor growth factor and with four lung cancer samples, we found all of them highly that its mitogenic activities on endothelial cells make it a positivefor P T N mRNA in contrast to five samples from normal lung thatshowed no orvery faint bands in the RNase candidate tumor angiogenesis factor. in human These results obtained withP T N expressed in human cells protection assay.’ In line with the observations are in contrast with those obtained with recombinant P T N tumor tissues, carcinogen-induced rat mammary carcinoma protein from insect cells (see “Results” and Ref. 16) as well showed P T N mRNA in eightof eight samples (Table11).The as from bacteria (17). The failure to obtainbiologically active data with thecarcinogen-induced rat mammary cancer samples indicate that the PTN gene is turned on during the protein from bacterial expression systems may bedueto improper processing of this protein in prokaryotes ordue to transforming events, and it is tempting to speculate that PTN the loss of activity during extraction under the harsh condi- gene expression is the switch from the nonangiogenic to the tions required to harvest the recombinant protein (see Ref. angiogenic phenotype (27,38, 39). Careful studies monitoring 22). This reasoning does, however, not suffice to explain the tumor angiogenesis and PTN gene expression after carcinonegative data obtained with expression of P T N in insectcells. gen exposure in thismodel will be required to obtain concluI n agreement with datapublished veryrecentlyfrom the sive evidence. Finally, whether or not P T N gene expression of the laboratory of H. Rauvala (16), we found P T N properly se- in human cancer indicates a less favorable outcome creted into the media of insect cells infectedwith recombinant disease will require a larger number of samples from patients with longterm clinical follow-up. baculovirus carryingthe P T N gene(see “Results”).This recombinant material was, however, not active as a growth CONCLUSION factor, and we conclude that this expression system is not We demonstrate that PTN functions as a tumor growth adequate to obtain large quantities of biologically active material for further studies. Wewish t o emphasize that thelack factor i n vivo, stimulates endothelial, fibroblast, and epithelial of biological activity of proteins obtainedfrom the baculovirus cells in vitro, and may contribute to a more aggressive phenotype of tumors. Further clinical studies will have to show expression systemis not uncommon and different laboratories if the PTN gene expression observed by us in a small set of have attributed this to poor processing of the protein (29), improper folding (30, 31), or to inadequate posttranslational human tumors could signify a more malignant phenotype. modifications like phosphorylation (32, 33) or glycosylation REFERENCES (34). We are currently testingif the recombinant P T N from 1. Cross, M., and Dexter, T. M (1991) Cell 64, 271-280 2. Liotta, L. A., Steeg, P. S., and Stetler-Stevenson, W. G. (1991) Cell 64, the baculovirus systemcanbeactivated by refolding the 327-336 protein (22, 30) or by removing potential posttranslational 3. Wellstein, A,, Fang, W., Khatri, A,, Lu, Y., Swain, S. S., Dickson, R. B., Sasse, J., Riegel, A. T., and Lippman, M. E. (1992) J. Biol. Chem. 2 6 7 , modifications with phosphatases (35) or with glycosidases. It 2582-2587 is worth pointing out thata t extremely high P T N concentra4. Courty, J., Dauchel, M. C., Caruelle, D., Nguyen, T. T.,and Barritault, D. (1991) J. Cell. Biochem. 15F, 221 (abstr.) tions of about 1gg/ml from insect cells (16)and from bacterial 5. Courty, J., Dauchel, M. C., Caruelle, D., Perderiset, M., and Barritault, D. expression (17) some neurite-outgrowth and minor mitogenic (1991) Biochem. Biophys. Res. Commun. 1 8 0 , 145-151 6. Kovesdi, I., Fairhurst, J. L., Kretschmer, P.J., and Bohlen, P.(1990) activity was actually observed. This activity could be due to Biochem. Bwphys. Res. Commun. 172,850-854 traces of active PTN present in these preparations and makes 7. Huher, D., Gautschi-Sova, P., and Bohlen, P. (1990) Neurochem. Res. 15, 435-439 i t worthwhile trying to recoverafully active preparation. 8. Kuo. M. D.. Oda. Y.. Huane. J. S.. and Huanz. S. S. (1990) J. Biol. Chem. Alternatively, transfection with pPTNwtprovides high levels 285,18749-18752 9. .. Rauvnln. H.11989) E M R O J . 8. -. 2933-2941 ~of P T N in supernatants from human SW-13 cells (2-10 ng/ 10. Merenmies, J., and Rauvala, H. (1990) JBiol. Chem. 2 6 5 , 16721-16724 ml; see Fig. 4) and could be used as a source for recombinant 11. Li, Y . S., Milner, P. G., Chauhan, A. K., Watson, M. A,, Hoffman, R. M., Kodner. C. M.. Milhrandt.. J... and Deuel. T. F. (1990) Sczence 250,1690protein. These levels are about 10-fold above those of condi1694 tioned media from the breast cancer cell line MDA-MB-231 12. Milner, P. G., Li, Y. S., Hoffman, R. M., Kodner, C. M., Siegel, N. R., and Deuel, T. F. (1989) Biochem. Biophys. Res. Commun. 1 6 6 , 1096-1103 originally used in our purification of P T N (3). 13. Tezuka, K., Takeshita, S., Hakeda, Y., Kumegawa, M., Kikuno, R., and Hashimoto-Gotoh, T. (1990) Biochem. Biophys. Res. Commun. 173,246An aspect closely related to the above discussion of the 251 biological activity of P T N is the potential significance of 14. Bohlen, P., and Kovesdi, I. (1991) Prog. Growth Factor Res. 3. 143-157 P T N gene expression for human tumor growth. Our survey 15. Hampton, B. S., Marshak, D. R., and Burgess, W. H.(1992) Mol. Biol. Cell 3,85-93 of different human cell lines showed that PTN is expressed 16. Raulo, E.,Julkunen, I., Merenmies, J., Pihlaskari, R., and Rauvala, H. (1992) J. Biol. Chem. 267. 11408-11416 in about one fourthof the cell lines and it appears asif gene H:, Itoh, M., Kimura, M., Gospodarowicz,D., and Amann, E. expression might be related to a more malignant phenotype 17. Takamatsu, (1992) Biochem. Biophys. Res. Commun. 186,224-230 (Table I1 and Fig. 5). This is truefor the comparisonbetween 18. Sanger, F., Nicklen, S., and Coulson. A. (1977)Proc. Natl. Acad. Sci. U S A . 74,5463-5466 cell lines derived from melanocytes and from primary mela- 19. Wellstein, A., Lupu, R., Zugmaier, G., Flamm, S. L., Cheville, A. L., Delli noma versus metastatic melanoma (36, 37) as well as for the W. Fang and A. Wellstein, unpublished data. comparison between T-47Dwtandthe moreinvasive and I ,
~
I
~~
”
~~
Function Pleiotrophin Bovi, P., Basilico, C., Lippman, M. E., and Kern,F. G . (1990) Cell Growth & Differ. 1, 63-71 20. Klagsbrun, M., Sullivan, R., Smith, S., Rybka, R., and Shing, Y. (1987) Methods Enzyml. 147.95-105 21. Wellstein, A,, Zugmaier, G., Califano, J. A.,3d., Kern, F., Paik, S., and Lippman, M. E. (1991) J. Natl. Cancer Inst. 83,716-720 22. Kohno, T., Carmichael, D. F., Sommer, A,, and Thompson, R. C. (1990) Methods Entvmol. 185. ~ 186-195 , ~ ~ . 23. Lippman, M. E:, and Dickson, R. B. (1989) Recent Prog. Horm. Res. 45, 383-435 24. Jordan, V. C. (1983) Breast Cancer Res. Treat. 3, (suppl.) S73-S86 25. Gottardis, M. M., and Rose, D. P. (1985) Anticancer Res 5,397-402 26. Kaidoh, T., Yasugi, T., and Uehara, Y. (1991) Virchows Arch. A Pathol. Anat. Histol. 418, 111-117 27. Folkman, J., and Shing, Y. (1992) J. Bid. Chem. 267, 10931-10934 28. Bohlen, P., Muller,T.,Gautschi-Sova, P., Albrecht, U., Rasool, C. G., Decker, M., Seddon, A,, Fafeur, V., Kovesdi, I., andKretschmer, P. (1991) Grouth Factors 4,97-I07 29. Matsuura, Y., Sato, H., and Sato, Y. (1991) Deu. Bid. Stand. 73, 79-85 "~
and Expression
25897
30. Xie, Y. B., Sui, Y. P., Shan, L. X. Palvimo, J. J., Phillips,D. M., and Jiinne, 0. A. (1992) J. Biol. Chem.'267,4939-4948 Y., Ogawa, H., Harada, N., Shimada, H., and Ishimura, Y. (1992) Bwchem. Biophys. Res. Commun. 184,471-477 32. Christensen, K., Estes, P. A., Oenate, S. A,, Beck, C. A,, DeMarzo, A,, 31. Takagi,
33. 34. 35. 36. 37. 38. 39.
Altmann, M., Lieberman, B. A,, St. John,J., Nordeen, S. K.,and Edwards, D.P. (1991) Mol. Endocrinol. 5, 1755-1770 Siow, Y. L., Chilcote, T. J., Benfenati, F., Greengard, P., and Thiel, G. (1992) Biochemistrv 31.4268-427s Sarkadi B. Bauzon D. Huckle W..R EaH. S., Berry, A,, Suchindran, H., Piice' E. M 'Okon J. Cy Bougher,?. C., andScarborough, G. A. (1992) J. 'Biol. d e m . 267, 2Ok7-2095 Wellstein, A., Dobrenski, A. F., Radonovich, M. N., Brady, J. F., and Riegel, A. T. (1991) J. Biol. Chem. 266, 12234-12241 Herb M., and Malkowicz, S. B. (1991) Lab. Znuest. 65, 262-271 Rod& U., Melber, K., Kath, R., Menssen, H. D. Varello, M., Atkinson, B., and Herlyn, M. (1991) J. Inuest. Demaatol. $7,20-26 Welsch, C. W. (1985) Cancer Res. 45, 3415-3443 Kandel, J., Bossy-Wetzel, E., Radvanyi, F., Klagsbrun, M., Folkman, J., and Hanahan, D. (1991) Cell 66,1095-1104
