(Russell et al.,2004). 2-2-4 Prostate Cancer in Women. The female ...... specification purposes (Fairbrother et al.,1998). The DNA extraction by geneaid DNA ...
Polymorphism of GSTM1 and GSTT1 gene in prostate cancer
Osamah Mohammed Hasan Mohammed Ibrahem Nader
1
Dedication To My parents
My wife
My son (Haider)
2
Acknowledgements First of all, thank God for giving me the power and the insistence to proceed up to complete this work and get this degree. I would like to introduce my deep gratitude to my supervisor Dr.mohammed ibrahem nader(PHD) for his support, attention, cooperation and notification throughout the study. MY deepest thanks are to University of Baghdad and to Genetic Engineering and Biotechnology Institute for Postgraduate studies which gave me these opportunity to complete the requirement of my study
I would like to express my deepest gratitude to my sister Dr .zainb almosawy (PHD) and to the staff of Urology Unit of gahzie AL- Hariri Teaching Hospital, especially my brother Dr. zaid AL- mosawy ,Dr.Samir Ali(PHD)and Dr . Hasanin frhan(PHD). Many thanks go to my dear friend Aymen Almulla and Ali alhajii for their kinds support . I would like to express sincere gratitude to my family, especially my wife for support and help.
Osama
3
Summary This study explores the relationship between Polymorphisms of glutathione-S-transferase M1, T1 which is a family of cytosolic enzymes involved in the detoxification of various exogenous as well as endogenous reactive species, and the risk of prostate cancer in Iraqi patients. The present study included 35 Iraqi men who were diagnosed as prostate cancer patients. The age of the patients ranged from 40 to 86 years beside 25 who were Apparently healthy men, Blood sample were collected Frome patients attended Gazhi Alhariri hospital(in Baghdad), from November, 2012 to May,2013. Blood group, age, family history, smoking were analyzed to detect
any relationship between these and prostate cancer, to be taken in account as risk factors.
The molecular study was carried out in the Genetic Engineering and Biotechnology Institute –Baghdad University for detection of gene polymorphisms. Genomic DNA was isolated from these samples using genead kit. The detection of the presece and absence of the GSTT1 and GSTM1 gene was done by multiplex PCR using specific forward and reverse primers.
The CYP1A1 gene was used as an internal
control. The internal control amplified CYP1A1 fragment was 312 bp, whereas the presence of the GSTM1 1 and GSTT1 genes was identified by 459 and 219 bp fragments, respectively. The Statistical Analysis System (Chi square) was used to evaluate of different factors in the study and its association with prostate cancer . Frequencies and distribution of metabolic genes (GSTM1 and GSTT1) 4
were used to investigate the relationship between deletion/ presence of occurrence of prostate cancer. A significant association was considered at level ( P < 0.01 ). Results obtained may be summarized as follows : 1- Results showed that 23( 65.7%)samples of the under study patients have deletion in one gene or both (Null genotype) , whereas 12( 34.2%)samples only were normal
. The chi-square test reflected
significant association(P0.01) between
prostate cancer smoker patients
and
GSTM1,GSTT1 deletion. 4- This study included 34.29% with blood group A , 22.86% of B , 14.29% of AB and 28.57% of O blood group . Control samples included 32% A, 28% B, 12% AB and 28% were O blood group. A significant difference
was noted (p< 0.01) Thus, A and O blood groups may be
considered as risk factors for prostate cancer among Iraqi population. 5-The thirty five patients included 5(4.30%) patients
with family
history of prostate cancer . These 5 cases were of abnormal GST genotype (deletion ).In this study, Statistical analysis which use of fisher 5
exact test showed, that there is no significant difference (P>0.01); in other words, there was
no association between family history and
prostate cancer.
.
.
6
LIST OF CONTENTS Section No. Contents
Page
Dedication
2
Acknowledgment
3
Summary
4
List of Contents
7
List of Figures
12
List of tables
13
CHAPTER ONE 14
Introduction
CHAPTER TWO 2-1
Literature Review
16
ANATOMY
16
Physiology
17
Prostate Cancer
18
2-2-1
Epidemiology of prostate cancer
18
2-2-2
Risk factors of prostate cancer
20
Staging of prostate cancer
20
Prostate Cancer in Women
21
2-1-1 2-1-2 2-2
2-2-3 2-2-4
7
2-2-5 2-2-6 2-2-6-1 2-2-6-2 2-2-6-3 2-2-6-4 2-2-6-5 2-3 2-3-1 2-3-2 2-3-3 2-3-4 2-3-4-1 2-3-4-2
Prostate cancer symptoms and signs
21
prostate cancer diagnosis
22
Digital rectal examination(DRE)
22
Prostate-Specific Antigen (PSA)
22
Transrectal ultrasound imaging(TRUS)
24
Needle biopsy
25
Molecular Diagnosis of Prostate Cancer
25
Processes that promote prostate carcinogenesis
26
Familial Prostate Cancer
27
Inflammation
28
Senescence
29
Epigenetic alterations
30
Hypermethylation
30
Hypomethylation
30
miRNAs (microribonuclease )
31
Genomic alterations
32
2-3-4-3 2-3-5 2-3-5-1 2-3-5-2 2-3-5-3 2-3-5-4
NKX3.1 ( NK3 homeobox 1)
34
Myc (Myelocytomatosis viral oncogene homologue) PTEN ( phosphatase and tensin)
34
RNASEL(ribonuclease L)
35
8
35
2-3-5-5 2-3-5-6 2-3-5-7 2-3-5-8 2-3-5-9 2-3-5-10 2-3-5-11
MSR1 (Macrophage Scavenger Receptor 1)
36
EZH2(enhancer of the zeste homologue 2)
36
BRCA2(Breast cancer gene 2)
37
E-cadherin
38
Her2/Neu(human epidermal growth factor receptor 2) Bcl2(B-cell CLL/lymphoma 2)
38
Metabolic Gene Polymorphisms
39
CHAPTER THREE
3.1.1 3.1.2 3.2 3.2.1 3.2.2 3.2.2.1 3.2.2.2
43
Materials
43 43
Equipment and instruments
43
Chemicals
44
Methods
45
Sampling
45
DNA extraction
45
kit components
45
Protocol
46
Materials and Methods 3.1
38
Estimation of DNA concentration
47
Multiplex Polymerase Chain Reaction (PCR) for GSTM1 and GSTT11 genotyping Primers
48
3-2-3 3-2-4 3-2-4-1
9
48
3-2-4-2 3-2-4-3 3-2-5 3-2-5-1 3-2-5-2
3-2-6
Reaction setup
49
Cycling conditions
49
Agarose gel electrophoresis
50
components
50
Protocol
50
Agarose gel preparation
50
Casting of the Horizontal Agarose Gel
50
Loading and Running DNA in agarose gel
51
Statistical analysis
51
CHAPTER FOUR
52
Results and Discussion
52
Demographical Parameters
52
4-1-1
Age
52
4-1-2
Blood group
53
4-2
Genotyping
55
4-2-1
Genomic DNA Extraction
55
4-2-2
Multiplex PCR
56
risk factors
61
4-3-1
smoking
61
4-3-2
Family history
63
4-1
4-3
10
Conclusion and Recommendations Conclusion
66 66
Recommendations
67
References
68
11
List of Figures No.
Figure Title
2.1
Human prostate location The miRNA processing pathway
2.2 2.3
Genetic
Page
predisposition,
oxidative
17 32 damage,
and
34
inflammatory changes
2.4
4.1
Role of metabolism in chemical carcinogenesis. between phase 1 activation and phase 2 detoxication enzymes. GST, glutathione Stransferases Chromosomal DNA bands on 1% agarose gel at 100
47
57
volt for 20min
4.2 4.3
Patterns of PCR product for GSTT1&GSTM1 polymorphisms on 2% agarose gel PCR product for GSTT1 and GSTM1 polymorphisms on 2% agarose gel
12
59 60
List of Tables No.
Table Title
Page
3.1
Equipment and instruments used in this study
43
3.2
44
3.3
chemicals used in this study primer sequences used multiplex PCR amplification of GSTM1, GSTT1,CYTP1A1 genes
3.4
Reaction setup for multiplex PCR
49
3.5
Cycling conditions for multiplex PCR Number & percentage of prostate cancer patients and
49
4.1
48
52
control according to Age group 4.2
Number & percentage of prostate cancer patients and
54
control according to blood group 4.3 4.4
Number & percentage of prostate cancer patients and control according to type of gene Number & percentage of prostate cancer patients/
59 62
smoker and non-smoker according to type of gene 4.5
Number & percentage of prostate cancer patients/ family history
13
63
Chapter one Introduction The most common neoplasms of the male genital tract involve the prostate gland (Mc Nicol et al.,1999). The prostate gland is a walnut size structure which is located around the urethra at the base of the bladder (Andreoli et al.,1968) . This gland in the male reproductive system helps produce semen, the thick fluid that carries sperm cells(Hayes et al .,1999). Prostate cancer is considered
the fifth common cancer in the
world and the second in cancer mortality exceeded only by lung cancer (Bray et al.,1995). This disease is age related pathology and as such destined to be increasingly relevant in an aging general population ( Alberts and Blute,2001). The identification of high frequency (>1%) genetic polymorphism in genes associated with carcinogens metabolism has explained the high degree of individual variability in cancer susceptibility that has been observed for example ,among smokers (Hein et al., 2000).
Glutathione S-transferases (GSTs) are a family of cytosolic enzymes involved in the detoxification of various exogenous as well as endogenous reactive species ( Ketterer,1988) .
GSTs function as dimmers by catalyzing the conjugation of mutagenic electrophilic substrates to glutathione. In humans, 4 major subfamilies of GSTs can be distinguished and are designated as GSTa, GSTμ, GSTu, and GSTp.( Mannervik et al.,1992). Each of these 14
subfamilies is composed of several members, some of which display genetic polymorphism. Within the GSTμ subfamily, the gene coding for GSTM1 exhibits a deletion polymorphism, which in case of homozygozity (GSTM1 null) leads to absence of phenotypic enzyme activity. ( Seidegard et al.,1988) . A similar mechanism is described for GSTT1 within the GSTu subfamily ( Pemble et al.,1994). Increasing of evidence show that polymorphism of glutathione Stransferase genes can be associated with the risk of developing some types of cancer as these polymorphisms have been investigated in association with lung, bladder, colon (Ketterer et al., 1992), oral (Nair et al., 1999; Buch et al., 2002) and prostate cancers(Pemble et al., 1994; Steinhoff et al., 2000; Nakazato et al., 2003).
Aims of the study : 1- investigating the relative impact of the genetic polymorphisms at the gene loci GSTT1 and GSTM1 on susceptibility to prostate cancer. 2-investigate the correlation of the null genotypes , incidence of mutations, various etiological factors(age ,smoking ,blood group ,family history) . 3-investigate the risk of prostate cancer in Iraq in relation to the normal controls users by using multiplex PCR analysis .
15
CHAPTER TOW
2-1 THE PROSTATE GLAND 2-1-1 Anatomy The term "prostate", originally derived from the Greek word prohistani which means" to stand in front of," has been attributed to Herophilus of Alexandria who used the term in 355 B.C. to describe the small organ located in front of the bladder ( Kirby et al.,1996) . The prostate is a small gland in the male reproductive system that helps produce semen, the thick fluid that carries sperm cells. The prostate is a walnut-sized structure located beneath the bladder of males. It surrounds the upper part of the urethra Fig(2-1). The urethra is the tube that carries urine from the bladder. Prostate function is regulated by testosterone, the male sex hormone produced primarily in the testicles. (
Nystrand , 2005)
Fig. (2.1) Human prostate location(Encyclopaedia Britannia, Inc 2007) 16
2-1-2 PHYSIOLOGY: A normal prostate gland comprises a smooth muscle or stromal tissue and glandular tissue. The prostate produces some secretions that are included in the male ejaculate, and another secretion that may exert an antibacterial effect. Unlike a normal prostate, the prostate in patients with benign prostate hyperplasia( BPH) contains a higher ratio of stromal to glandular tissue (5:1) ( Cooper et al.,1999). The smooth muscle is innervated by α-adrenergic receptor stimulation α 1 and α 2 . The outer prostatic capsule (outer shell), bladder neck (base), and proximal urethra also have a high concentration of α 1 -adrenergic receptors. Excessive stimulation of postsynaptic α 1 -adrenergic receptor stimulation causes the smooth muscle of the prostate, prostatic capsule, bladder neck, and proximal urethra to contract, resulting in a decrease in the urethral lumen and obstructive voiding symptoms. This causes difficulty in urination, a decreased force of urinary stream, urinary hesitancy, straining to void, incomplete bladder emptying, urinary dribbling, and an intermittent urinary stream. Stimulation of presynaptic α 2 -adrenergic receptors has an unknown effect on the prostate(De Mey,1999)
.
Inside the prostate, testosterone is metabolized to dihydrotestosterone (DHT) by 5-alpha reductase, an enzyme which is located mainly on nuclear membrane. DHT is 2.5 times more potent than testosterone. DHT binds to androgen receptor (AR) within the glandular cells. The complex DHT-AR activates several cell functions by targeting the DNA sequences 17
in the nuclei and results in growth and proliferation. Two possible functions have been suggested for prostate in the body. First, there is a high production of immunoglobulin in the prostate , the gland seems to have a protective function against local infections. Second is the importance of prostate secretion in the motility of the spermatozoa (Fredricsson,1997).
2-2 PROSTATE CANCER Prostate cancer is the most common non coetaneous malignancy and the second leading cause of cancer death in men in the United States (Jemal et al., 2006). Prostate-specific antigen (PSA) screening began in the late 1980s and dramatically increased the diagnosis of this disease. An almost simultaneous decrease in disease specific mortality has been noted (Baade et al .,2004). Prostate cancer has a very heterogeneous natural history and screening has resulted in over detection and over treatment of men with indolent prostate cancer .Prostate cancer is not, curable once it has metastasized; differentiation of early-stage disease that ultimately will progress from disease destined to remain indolent is a major research priority. The molecular genetics of prostate cancer hold promise for the development of new screening and diagnostic tests to resolve this issue ( Lu-Yao et al.,2002). 2-2-1Epidemiology of prostate cancer: Prostate cancer accounts for 33% of all diagnosed malignancies among men in the United States in 2003 ( American Cancer Society2003). In 2008, the American Cancer Society estimated 28,660 prostate cancer– related deaths in the United States, for an approximate annual rate of 23.3 per 100,000 population ,representing a 41% decrease from the peak in 1991 (American Cancer Society, 2007).Between 1996 and 2004 the age 18
standardised incidence rate of prostate cancer increased in all cancer networks in England and Wales. In England the average increase was 20% whilst in Wales it was 49%. There was a range of increase in individual networks between 1% and66%. Prostate cancer is rarely diagnosed in men younger than 40 years, and it is uncommon in men younger than 50 years (Raman et al., 2001). In many of the countries of the Middle-east, prostate cancer is already a problem . In Mauritanian males it is the most frequent neoplasm A Egyptian case-control study pointed to sausages, butter and natural ghee as risk factors, while vegetables were protective (Kamel et al., 2005). Arab Kuwaiti and Omani men were reported to have lower serum PSA levels and prostate volumes than those reported for Caucasians, but similar to those reported for Asians (Japanese and Chinese) (Kehinde et al., 2005 ) .Subclinical prostatitis is a significant source of high serum PSA in over 40% of men in Kuwait, suggesting the need for a locally applicable paradigm to identify prostate cancer(Anim et al., 2007). In Iraq, Iraqi Cancer Board 2008 registered that Prostate cancer is one of the top ten cancers that affect men in Iraq, where new cases registered in 2008 numbered 246 by 3.73 the mean infected rate that is 1.56 per 100,000 population was registered either of the capital Baghdad ,where there were 66 new cases in the same year .That prostate cancer is ranked 61 of all cancers registered in Iraq, amounting to 88 depending on the type of areas affected by them has been proven by histological analysis of prostate cancer. It is reported that the Adenocarcinoma, type is the most prominent of the prostate cancers recorded in Iraq, where the rate is 34.55% then comes next the Epithelial tumor ,with 2.03% (Iraqi Cancer Board,2008).
19
2-2-2 Risk factors of prostate cancer: •
Race, black men are at the greatest risk due to a genetic factor
(Hsing et al.,2000). •
Family history, men with a brother or father with prostate cancer
have a two-fold risk of developing the disease. Those with both an affected brother and father have an eight-fold increased risk (Whittemore et al.,1995). •
Diet, a high intake, of animal or saturated fat increase the risk
(Chan et al.,2005)
•
Lack of exercise, may increase the risk in those who eat a high fat
diet. •
Age before the age of 50 years at least 0.7% of these neoplasms are
diagnosed and between 75 and 85% are diagnosed after the age of 65 years. •
Infections. Bacterial and viral infections (Markianos et al.,2004).
•
Obesity, alcohol abuse and cigarette smoking may also be risk
factors (Giovannucci et al .,2002).
2-2-3 Staging of prostate cancer: Prostate cancer has been classified into four stages: • Stage A The tumor is not found by normal tests but during surgery. 20
•
Stage B. The tumor can be palpated during rectal Examination.
• Stage C. Cancer has spread to tissues outside of the prostate. • Stage D. The cancer has metastasized to the lymph nodes of the pelvis or other parts of the body, especially the pelvic bone (Russell et al.,2004).
2-2-4 Prostate Cancer in Women The female prostate, also called Skene paraurethral glands in women or simply paraurethral glands in other mammals, is an accessory gland found in the female genital system, and it has been described as morphofunctionally similar to the male prostate gland and with a histological pattern distinct from other accessory reproductive glands, such as paraurethral and/or bulbourethral glands in males (zaviacic,1999). In addition, the embryonic development of the male and female prostate is homolog, arising from the urogenital sinus, whereas, considering several phases of the postnatal period, the secretory maturity of the female prostate has been assumed to precede the male gland secretory development (Custodio et al .,2004).
2-2-5 Prostate cancer symptoms and signs: • Blood in the urine (haematuria). •
Blood in the semen( Hematospermia).
•
Swelling in the legs (leg oedema).
21
•
Discomfort Trouble urinating in the pelvic area• Painful ejaculation ( Tan et al.,2001).
2-2-6 prostate cancer diagnosis: 2-2-6-1 Digital rectal examination (DRE) DRE is probably the most common diagnostic test in urological practice. It requires the insertion of a finger into the rectum to palpate the prostate gland for in duration or abnormal masses. Suspected abnormalities can then be investigated further by ultrasound scan or biopsy. It was the principal ‘first line’ method for detecting the presence of prostate cancer prior to the introduction of prostate specific antigen (PSA) testing in the 1980s, and will remain an important early and relatively uninvasive investigative test. However, a proportion of the lesions that are palpable at DRE will be benign, and may be caused by conditions such as BPH, retention cysts, prostatic calculi, prostatic atrophy,
fibrosis
associated
with
prostatitis
and
non-specific
granulomatous prostatitis. False positive rates for prostate cancer caused by DRE are as high as 40–50% and, although BPH nodules that originate in the Mperipheral zone rarely result in abnormal findings at DRE, it is more typical for BPH originating in the transition zone to be palpable and confused with cancer ( Gann et al., 1994).The incidence of these nonmalignant masses increases with age, resulting in the fall of the positive predictive value of DRE (25% in men aged under 65 years compared with 12.5% in men over the age of 65 years).( Mettlin et al .,1991).Approximately 50–95% of localised prostatic tumours are palpable and could thus be detected by DRE.( Drago et al .,1989)
22
2-2-6-2 Prostate-Specific Antigen (PSA): Over the past 41 years, prostate specific antigen (PSA) early detection programs have transformed the diagnosis and treatment of prostate cancer. The most widely used tumor marker in clinical oncology , PSA allows for detection of prostate cancer at an early asymptomatic stage amenable to curative treatment. Early detection has resulted in a dramatic reduction in prostate cancer-specific mortality; 36years ago, 1 in 3 men with prostate cancer died from the disease; in 2007, only 1 in 100 does. ( American Cancer Society,2007). PSA is a glycoprotein 34KD produced by the columnar acinar and ductal prostatic epithelial cells and its function is to liquefy the ejaculate, enabling fertilization. Large amounts are secreted into the semen, and small quantities are found in the urine and blood. 75% of circulating PSA is bound to plasma proteins (complexed PSA) and metabolized in the liver, while 25% is free and excreted in the urine ( David et al.,2011). The level of PSA in serum is increased by inflammation of the prostate, urinary retention, prostatic infection, benign prostatic hyperplasia, prostate cancer, and prostatic manipulation ( Daniel et al.,2010).The prostate-specific antigen (PSA) gene which appears to be affected by histone
methylation, which contains the androgen receptor response
element in its 5′ regulatory region. Methylation of H3 is associated with transcriptional inactivation of the PSA gene in the prostate cancer cell line LNCaP, and transcription of the PSA gene is accompanied by rapid decreases in di- and trimethylated H3 at lysine 4. In addition, a lysinespecific demethylase (LSD1) has been found to interact with the androgen receptor to stimulate the androgen receptor (AR)-dependent transcription of PSA in LNCaP cells by removing the methyl group at 23
H3-K9 ( Metzger et al.,2005) Recent changes in recommendations that now suggest later and less frequent PSA screenings highlight a major clinical challenge for prostate cancer diagnosis and treatment (Wolf et al., 2010). These new recommendations have been proposed because the widespread use of PSA testing has led to a vast increase in the diagnosis of patients with clinically localized low Gleason grade carcinomas that may not require treatment, since their tumors are relatively indolent. In particular, patients with a Gleason pattern of 3 or less almost never relapse after local therapy, and very likely can be managed conservatively with ‘‘watchful waiting’’; nonetheless, a small fraction of these tumors will progress rapidly and require immediate treatment (Lu-Yao et al., 2009).
2-2-6-3 Transrectal ultrasound imaging(TRUS) TRUS is currently used in a number of ways: to estimate the size of the prostate, diagnose prostate cancer, guide needle biopsies, stage the cancers detected and to monitor disease prior to and after treatment. The evidence for the ability of TRUS in each of these roles varies. In particular, it is more accurate than DRE in the estimation of prostate size but its sensitivity and specificity in the detection of prostate cancer are poor in comparison with other measures such as PSA assay. TRUS is not normally used as a primary screening measure, it is used confirm the diagnosis of prostate cancer for those with a raised PSA or lesions suspicious on DRE. TRUS is the most commonly used imaging technique for evaluating prostate cancer. Early TRUS scans were obtained with a chair mounted 3.5 MHz probe, but contemporary equipment uses a handheld transducer with a frequency ideally between 6 and 7 MHz. This acts as an extension of the hand, and simple rotation allows instantaneous multidirectional imaging ( Lange ,1995). A scan is usually performed 24
with the patient lying in the left decubitus position. This enables images to be obtained in transverse, axial, and sagittal planes, optimizing evaluation of the prostate ( Clements , 1991).
2-2-6-4 Needle biopsy Cancer can only be correctly diagnosed by needle biopsy of the prostate and histopathology of the sampled tissues. The most common technique for detection of prostate cancer is transrectal ultrasound-guided (TRUS) needle core biopsy. Since a normal prostate tissue cannot usually be differentiated from a cancerous tissue during the biopsy, a number of standard protocols have been developed to assist the urologist in performing the biopsy. A biopsy protocol designates the number of needles to be used, and their location within the prostate. The most commonly used is the systematic sextant biopsy (Hodge et al., 1989) However, this strategy has an unacceptable level of false negative diagnoses, and many patients who have a negative initial biopsy are found to have cancer in repeat biopsies. As a result, recent clinical studies have investigated new protocols that have higher detection rates (Eskew et al. ,1997).
2-2-6-5 Molecular Diagnosis of Prostate Cancer Molecular diagnosis would be more objective and, hopefully, significantly less subjected to human error if obtained with reliable methods. But the ideal method should also be fast, standardized and economically convenient. Such achievement is indeed possible in theory, but results published are not completely satisfactory yet, because they are usually based on a conventional approach with takes advantage of a single molecular predictor significantly up- or down-regulated in the 25
cancer specimen versus benign control. A major obstacle to this goal is that the molecular events causing PCA onset and progression are still far from being completely revealed: very few well known oncogenes or tumor suppressors have been clearly linked to prostate tumorigenesis, and For this reason PCA is considered an elusive disease. Therefore ,new molecular approaches for early screening and diagnosis are urgently needed. Gene expression analysis has been used to increase knowledge about the biology of PCA (Huppi and Chandramouli 2004). Gene signatures at RNA level are determined and often used as predictors to model clinically relevant information (e.g. prognosis, survival time, sensitivity to drugs, etc.). To this aim, final conclusions on the classification power of the gene signature studied are entirely drawn on the basis of the molecular data obtained at a transcriptional level by using methods such as DNA microarray or RT q-PCR. By Northern blot analysis. There are informative genes whose expression changes on the basis of the presence of CaP malignancy in humans (Bettuzzi et al.,2000).
2-3 Processes that promote prostate carcinogenesis The single most significant risk factor for prostate cancer is advanced age. While men who are younger than 40 have one in 10,000 chance of developing prostate cancer, this risk increases to one - seven by the age of 60 (American Cancer Society 2007). However, prostate cancer is not simply a by-product of aging, since the incidence varies considerably among different populations. More likely, the relationship of prostate cancer to advanced age likely reflects the interplay of environmental, physiological, and molecular influences with normal consequences of aging that presumably exacerbate the effects of these influences. Moreover, while the precise molecular consequences of aging as they pertain to prostate cancer have not been elucidated, various studies have described gene expression changes associated with aging, 26
particularly in the prostatic stroma, including genes involved in inflammation, oxidative stress, and cellular senescence (Bavik et al., 2006; Bethel et al., 2009).
2-3-1Familial Prostate Cancer: Familial aggregation of prostate cancer(PCA) has been recognized since1958. Familial prostate cancer, which accounts for up to 20% of all cases of the disease in general population, refers to the occurrence of multiple cases (clustering) of PCA within a family. It is commonly defined as a family in which there are two first-degree (father, brother, son) relatives or one first-degree and at least two second-degree (grand father, uncle, nephew) relatives with PCA. This clustering may be due to shared environment or chance occurrence given high frequency of PCa in general population, or may be due to genetic susceptibility. Populations of different origins including US Caucasian, Canadian, European, Asian, African-Americans exhibit this type of clustering( Filion et al.,2007). Evidence also indicates that the risk of PCa increases proportionally to the number of relatives affected, the degree of relationship to the pro band and is inversely related to the age at diagnosis of PCa. Epidemiologic studies employing different study designs and/or populations suggest that a family history of PCa that includes an affected father or brother is associated with at least a 2-fold increase in the disease risk among the relatives(Steinberg et al .,1990). Men with 3 or more first -degree relatives with PCa are at a 5 to 11-fold increased risk of disease, than men without family history (Carter e t al.,1990). A study involving a cohort of 179 patients from Quebec, Canada ,reported familial clustering, defined as having at least one affected relative in the family, in 25% of cases( Filion et al.,2007).
27
2-3-2 Inflammation: Various lines of epidemiological, pathological, and molecular evidence have supported the idea that chronic inflammation is causally linked to prostate carcinogenesis(Bardia et al., 2009). Chronic inflammation can induce proliferative events and posttranslational DNA modifications in the prostate tissue through oxidative stress. In fact, repeated tissue damage and oxidative stress related to this event may provoke a compensatory cellular proliferation with the risk of hyperplastic growth or neoplastic modifications (Palapattu et al.,2005). It is well accepted that regions of prostatic inflammation can generate free radicals and many reactive species of oxygen. In particular, macrophages and neutrophil infiltrations provide a source of free radicals that can induce hyper-plastic or precancerous transformations through the oxidative stress to the tissue and DNA (Sciarra et al.,2007). Cytokines can contribute to cancer development in several ways. TNF-α has been shown to enhance the formation of Reactive Oxygen Species (ROS) by inflammatory cells, and thereby increase the risk for DNA damage and inhibition of DNA repair in tumor cells (De Miguel et al.,2000), Other mechanisms include direct stimulation of cell growth, induction of angiogenesis, and recruitment of inflammatory neutrophils (Lucia and Torkko , 2004).These observations have raised interest in the potential causes of prostate inflammation, which may include hormonal perturbations such as altered androgen and estrogen levels, or infection by bacterial or viral agents,physical trauma, or dietary factors (De Marzo et al., 2007).Indeed, the susceptibility of the prostate gland to infection is known from the incidence of chronic bacterial prostatitis, and a potential role for bacterial infection in prostate carcinogenesis has been suggested by the identification of multiple bacterial species in most prostatectomy samples examined (Sfanos et al., 2008). 28
2-3-3 Senescence: Cellular senescence corresponds to a form of cell cycle rest in which cells remain fully viable, but are non proliferative despite exposure to mitogenic signals(Courtois-Cox et al., 2008). Much work has identified cellular senescence as a potent mechanism of tumor suppression that prevents manifestation of the malignant phenotype after oncogenic insults. In particular, activated oncogenes are believed to induce senescence through a variety of molecular mechanisms, including replicative stress or formation of ROS, or as a response to DNA damage. Thus, oncogeneinduced senescence may play a central role in preventing the progression of preneoplastic lesions to the fully malignant state .In the prostate, cellular senescence has been shown to occur during aging-related prostate enlargement, and has been implicated as a tumor suppressor mechanism for prostate carcinogenesis. Thus, SA-b-Gal, a commonly used biomarker of senescence, is frequently detected in BPH in the human prostate (Castro et al.,2003). Moreover, other markers of senescence, including 14arf and p16ink4a, are increase with aging and particularly in nonmalignant cancers, suggesting these may represent markers that distinguish indolent from more aggressive forms of the disease (Zhang et al., 2006). In addition to senescence-related changes observed in epithelial cells, senescent primary prostatic fibroblasts display gene expression signatures associated with oxidative damage and DNA damage, which may in turn influence the invasive behavior of epithelial cells (Bavik et al. ,2006).
29
2-3-4 Epigenetic alterations: Epigenetic perturbations are also believed to represent
important
contributing factors in prostate carcinogenesis, and may provide useful biomarkers for disease progression (Li et al., 2000; Nelson et al., 2003). One of the earliest identified hallmarks of epigenetic alterations is DNA methylation—the addition of a methyl group to the 5′-carbon of cytosine in CpG sequences. This process is catalyzed by three DNA methyltransferases (DNMTs): DNMT1, DNMT3a, and DNMT3b. Methylcytosine residues are often found in short stretches of CpG-rich regions called CpG islands. These CpG islands are found in the 5′ region of approximately 60% of genes and are generally 0.5 to 2 kb in length (Gardiner-Garden and Frommer ,1987). 2-3-4-1 Hypermethylation
DNA hypermethylation is one of the most common and best characterized epigenetic abnormalities in prostate cancer .Genes including classic and putative tumor-suppressor genes as well as genes involved in a number of cellular pathways, such as hormonal responses, tumor-cell invasion/tumor architecture, cell cycle control, and DNA damage repair, have been demonstrated to be hypermethylated. For many of these genes, promoter hypermethylation is often the mechanism responsible for their functional loss in prostate cancer. Inappropriate silencing of these genes can contribute to cancer initiation, progression, invasion, and metastasis(Kirsten et al.,2008).
2-3-4-2 Hypomethylation DNA methylation is a regulatory mechanism by which repetitive DNA is transcriptionally silenced to prevent it from propagating(Urnov ,2002). Hypomethylation, or removal of methyl groups from normally methylated DNA, can disrupt this mechanism leading tostructural and 30
functional alterations of the genome. Hypomethylation can be global, in which case there is an overall decrease in 5-methylcytosine content in the genome, or gene-specific, which refers to a decrease in cytosine methylation relative to the “normal” methylation level. Gene-specific methylation affects discrete regions of the genome, such as the promoter regions of proto-oncogenes or normally highly methylated sequences such as repetitive sequences and oncogenes. Global and gene-specific hypomethylation both have been implicated in human malignancy. (Kirsten et al.,2008)
2-3-4-3 microribonucleic acid ( miRNAs) Micro-RNAs (miRNAs) are a recently discovered class of nanoproteincoding RNAs with evidence for diverse functions in development ,cell differentiation, metabolism, and many disease processes including cancer. MicroRNAs are transcribed from the genome as long primary microRNAs, ranging from hundreds to thousands of nucleotides in size. The primary miRNAs are processed by an RNase III endonuclease, into stem– loops called precursor micro-RNAs (pre-miRNAs), which are then exported into the cytoplasm by Exportin-5. In the cytoplasm, premiRNAs are further processed by a second RNase III endonuclease, Dicer, (Lewis et al.,2005). Expression profiling studies of human prostate tumors have suggested that the expression patterns of miRNAs may distinguish indolent from aggressive tumors (DeVere White et al., 2009), and have implicated specific miRNAs in castration-resistant prostate cancer (Sun et al., 2009). Sylvestre et al. (2006) reported that miR- 20a, a member of the mir-17–92 cluster, affects prostate cancer PC-3 cell apoptosis by modulating the translation .Furthermore, miRNAs have specific roles in regulation of critical target genes, as the cluster miR-106b-25 negatively
31
the regulates phosphatase and tensin( PTEN) gene expression(Poliseno et al., 2010). Fig (2-3).
FIGURE ( 2-2) The miRNA processing pathway(Fardod et al.,2012)
2-3-5 Genomic alterations Extensive genomic analyses of prostate cancer have identified copy number alterations and chromosomal rearrangements associated with prostate carcinogenesis. In particular, a number of important somatic alterations have been identified by comparative genomic hybridization (CGH) as gains or losses of chromosomal regions, including gains at 8q and losses at 3p, 8p, 10q, 13q, and 17p (Lapointe et al., 2007). 32
Importantly, several of these genetic alterations have also been identified in proliferative inflammatory atrophy(PIA) lesions, which has supported the precursor relationship of these lesions to prostate cancer and has also emphasized their relevance for promoting cancer progression. Finally, several key regulatory genes have been mapped to within these chromosomal regions undergoing copy number alterations, including NKX3.1 at 8p21, PTEN at 10q23, and MYC at 8q24 (figur2-3 ) In contrast, however, targeted resequencing studies have suggested that somatic point mutations may be relatively infrequent in
prostate cancer, with tumor
suppressor genes such as TP53 undergoing alterations of copy number instead (Taylor et al., 2010).
Figure( 2-3)Genetic predisposition, oxidative damage, and inflammatory changes(Gonzalgo and Isaacs,2003)
33
2-3-5-1 NK3 homeobox 1 ( NKX3): A tumor suppressor gene located at 8p21 has been shown to be a critical regulator of prostate epithelial differentiation and stem cell. In the absence of Nkx3.1, there is a significant decrease in prostatic ductal branching, as well as in the production of secretory proteins (BhatiaGaur et al., 1999) . Loss of heterozygosity at polymorphic 8p21 sequences has been noted in as many as 90% of prostate cancers .Despite allelic loss in this region, somatic mutations of NKX3.1 have yet to be identified in a single case of prostate cancer(Bowen et al.,2000). Bowen et al.(2000) noted diminished NKX3.1 expression in as many as 20% of PIN lesions, 6% of low stage prostate cancers, 22% of high stage prostate cancers, 34% of androgen-independent prostate cancers and 78% of prostate cancer metastases. Analyses of Nkx3.1 function in human tumor cells and genetically engineered mice have provided insights into its potential roles in cancer initiation. In particular, Nkx3.1inactivation in mice results in a defective response to oxidative damage, while its expression
in human prostate
cancer cell lines protects against DNA damage and is
regulated by
inflammation (Bowen and Gelmann ,2010). 2-3-5-2 Myelocytomatosis viral oncogene homologue ( Myc) : It has long been known that the 8q24 chromosomal region encompassing the MYC oncogene is somatically amplified in a subset of advanced prostate tumors (Sato et al., 1999). However, recent studies have suggested a role for MYC over expression in cancer initiation, as nuclear MYC protein is up-regulated in many PIN lesions and the 34
majority of carcinomas in the absence of gene amplification (Gurel et al., 2008). Interestingly, another recent study has found that the X-linked gene FOXP3 encodes a winged helix transcription factor that represses MYC expression and itself is mutated in prostate cancer (Wang et al., 2009).
2-3-5-3 phosphatase and tensin (PTEN): a tumor-suppressor gene located at10q23 codes for protein that regulates cell cycle and prevents cell proliferation and encoding a phosphatase active against both proteins and lipid substrates, is a common target for somatic alteration during the progression of prostate cancer. In prostate cancers, the level of PTEN is frequently reduced, particularly in cancers of a high grade or stage somatic PTEN alterations which are more common than they are in primary prostate cancers (McMenamin et al.,1999). Analyses of PTEN deletion in genetically engineered mouse models have uncovered its cooperativity with inactivation of other key genes that are deregulated in prostate tumorigenesis, and have also provided insights into new therapeutic options for the treatment of prostate cancer. Germline loss of PTEN in heterozygous mutants or conditional deletion in the prostate epithelium results in PIN and/or adenocarcinoma (Wang et al.,2009). Inactivation of PTEN has been shown to cooperate with loss of function of the Nkx3.1 homeo box gene, up regulation of the
c-Myc
proto-oncogene (King et al., 2009).
2-3-5-4 ribonuclease L (RNASEL): RNASEL, which lies within chromosome 1q24–25, encodes an endoribonuclease that mediates the activities of an interferon-inducible 35
RNA degradation
pathway. Polymorphisms of the RNASEL gene have
been associated with an increased prostate cancer risk. However, not all studies have confirmed these findings. Mutations in the ribonuclease L gene do not occur at a greater frequency in patients with familial prostate cancer compared with patients with sporadic prostate cancer (Xu J,2000). .In addition, a less active RNASEL variant was observed to be associated with a higher risk of prostate cancer ( Casey et al.,2002). the genetic variants of RNASEL increase the risk for prostate cancer only in the presence of some environmental exposure (e.g. viral infection) that may vary from one population to other population (Kotar et al.,2003) 2-3-5-5 Macrophage Scavenger Receptor 1 (MSR1): MSR1 encodes a receptor on the macrophage cell surface that induces binding of oxidized low-density lipoprotein and other polyanionic ligands. Mutations, polymorphisms, or loss of the MSR1 gene may compromise a global macrophage function thereby exposing organs, including the prostate, to oxidative stress and damage. Although this gene does not code for prostatic proteins directly, oxidative stress has been implicated in the initiation of prostate carcinogenesis (Shand and Gelmann,2006).
2-3-5-6 enhancer of the zeste homologue 2 ( EZH2): DNA is organized into a nucleoprotein complex termed “chromatin.” The basic chromatin unit is the nucleosome, which is composed of 146 bp of DNA wrapped around four pairs of histone proteins . Accumulating evidence indicates that histone modifications play important roles in regulating gene expression during prostate cancer initiation, progression, and metastasis. Notably, the enhancer of the zeste homologue 2, Drosophila (EZH2) gene is involved in multiple epigenetic abnormalities. 36
As mentioned previously, EZH2 encodes a polycomb protein that contains a SET domain and thus has histone methyltransferase activity and can catalyze the addition of a methyl group to the histone (Cao et al.,2002). Varambally et al., (2002) were the first to link the EZH2 gene to prostate cancer by observing that EZH2 is over expressed in hormonerefractory and metastatic disease. Following this initial study, a number of important discoveries have been made indicating that EZH2 may play a causal role in cancer progression. EZH2 has been shown to silence the expression of DAB2IP, a putative tumor suppressor, in prostate cancer cells by adding methyl groups to H3- on the DAB2IP promoter and inducing histone deacetylation (Chen et al .,2005). Furthermore, EZH2 was found to control DNA methylation through direct physical contact with DNA methyltransferase (Vire et al.,2006).
2-3-5-7 Breast cancer gene 2 (BRCA2): BRCA1 and BRCA2 are both tumor suppressor genes involved in DNA repair; inherited mutations in these genes have been strongly associated with different cancers. DNA mechanisms are critical to prevent accumulation of DNA damage and maintain stability (Agalliu et al., 2007). An increased risk of prostate cancer has been observed in breast cancer families carrying BRCA2 mutations (Eerola et al., 2001). Mutations in these genes predominantly predispose carriers to breast and ovarian cancers, though potential links to prostate cancer have also been studied for both genes. Multiple studies have shown that mutations in BRCA2 lead to an increased risk of developing prostate cancer (Friedenson, 2005).
37
2-3-5-8 E-cadherin : The E-cadherin gene, which is located on chromosome 16q22.1,encodes a transmembrane glycoprotein that mediates intercellular adhesion as well as cell signaling (Takeichi, 1991). E-cadherin expression is reduced in a significant percentage of prostate cancers, particularly in poorly differentiated tumors, E-cadherin expression in prostate cancer correlates inversely with grade, stage, metastasis, recurrence, and survival (Urakami et al.,2006).
2-3-5-9 human epidermal growth factor receptor 2 (Her2/Neu): The deregulated expression of oncogenic tyrosine kinases has been studied extensively in many cancers, since these can represent targets for therapeutic intervention (Gschwind et al., 2004). In prostate cancer, aberrant tyrosine kinase signaling, particularly through Her2/Neu or SRC tyrosine kinases, has been implicated in aggressive disease, progression to metastasis, and castration resistance, and, consequently, has been implicated as a key therapeutic target in patients with advanced disease (Fizazi ,2007). In particular, stimulation of AR signaling leads to activation of SRC in prostate cancer cells, which can lead to phosphorylation of AR, castration resistance, and cellular proliferation and invasiveness ( Kraus et al., 2006). 2-3-5-10 B-cell CLL/lymphoma 2 (Bcl2): Over -expression of Bcl2 in prostate carcinoma cells is a hallmark of advanced, hormone-refractory disease; it may account for the resistance to apoptosis that is characteristic of late stages (McDonnell et al., 1997).
38
Bcl2 expression is restricted to basal cells in the normal prostate (Hockenbery et al., 1991). Moreover, as is the case for p53, Bcl2 expression may provide a prognostic marker that correlates with disease outcome (Mackey etal., 1998). Indeed, several preliminary studies have examined whether Bcl2inactivation may prevent tumor recurrence (Miyake et al., 1999)
2-3-5-11 Metabolic Gene Polymorphisms: Oxidative stress is defined as an imbalance between pro-oxidants (free radical species) and the body's scavenging ability (antioxidants). It may be due to either increased production of reactive oxygen species (ROS) or decreased levels of antioxidants (enzymatic and non enzymatic) or both (Irashad and Chaudhuri,2002). Oxidative stress could be considered a large increase (becoming less negative) in the cellular reduction potential, or a large decrease in the reducing capacity of the cellular redox couples, such as glutathione (Schafer and Buettner,2001). Many biochemical compounds, namely nucleic acid, amino acid, protein, lipid, lipoprotein, carbohydrate, and macromolecules of collagen tissue, can be damaged irreversibly or reversibly by free radicals (Halliwell,1994). A xenobiotic is a compound that is foreign to the body. The principal classes of xenobiotics of medical relevance are drugs, chemical carcinogens, and various compounds that have found their way into our environment. It is convenient to consider the metabolism of xenobiotics in two phases. In phase 1, the major reaction involve dis hydroxylation, catalyzed by members of a class of enzymes referred to a monooxygenases or cytochrome P450s(CYP). Cytochrome P450 (CYP) proteins in humans are drug metabolizing
39
enzymes phase I. Humans have 18 families of CYP genes
and 43
subfamilies ( Humdy et al., 2002). Hydroxylation may terminate the action of a drug, though this is not always the case. In addition to hydroxylation, these enzymes catalyze a wide range of reactions ,including those involving deamination, dehalogenation,
desulfuration,
epoxidation,
peroxygenation,
and
reduction. Reactions involving hydrolysis(eg, catalyzed by esterases) and the hydroxylated or other compounds produced in phase 1 are converted by specific enzymes to various polar metabolites by conjugation with glucuronic acid, sulfate, acetate, glutathione, or certain amino acids, ( Guengerich,2001). Glutathione S-transferases (GSTs) are a supergene family of enzymes involved in phase II of biotransformation, which is characterized
by
the
conjugation
of
endogenous
water-soluble
compounds to lipophilic substrates. GSTs catalyze the conjugation of glutathione, a tripeptide consisting of glycine, glutamic acid and cysteine, to electrophilic compounds, resulting in less reactive and more easily excreted glutathione conjugates. Substrates of GST-catalyzed reactions include pre-carcinogens, such as polycyclic aromatic hydrocarbons, pharmacological drugs, including paracetamol, chemotherapeutic agents and free radicals generated during oxidativestress (Strange et al., 2001). This super family is made of four gene families (or enzyme classes in a protein oriented perspective), called alpha, mu, pi and theta. (there is also a zeta form, which is classified in theta category) ( Miller et al., 2001). Each gene family is tandemly located in a particular locus. Alpha is on 6q22, Mu is 1p13, Pi is on 11q13, and Theta is on 22q13.2. Glutathione S-tranferases are dimeric proteins which are located in the cytosol. ( Seidegard and
Ekstrom,1997). The α class appears to possess the
greatest peroxidase activity but enzymes of this class are expressed at low levels in both normal and tumor tissues (Fig 2-4) (Hayes et al.,1995). The 40
GSTM1 gene is located on chromosome 1p13.3, and 20 to 50% of individuals who do not express the enzyme due to a homozygous gene deletion, known as the GSTM1*0, or null allele (Seidgard et al., 1988). The percentage of individuals who do not express the enzyme is higher in Caucasians and Asians than in Africans (Roth et al., 2000). GSTM1 is involved in the detoxification of polycyclic aromatic hydrocarbons and other mutagens, and cells from GSTM1 null individuals are more susceptible to DNA damage caused by these agents.The GSTT1 gene is located on chromosome 22, and 20 to 60% of individuals do not express the enzyme, due to a gene deletion, known as the GSTT1*0 allele (Pemble et al., 1994). About 60% of Asians, 40% of Africans and 20% of Caucasians do not express this enzyme (Strange and Fryer, 1999). This polymorphism accounts for the variation in GSTcatalyzed metabolism of halomethanes by human erythrocytes (Pemble et al., 1994). In normal prostate epithelium GSTP1 expression is generally confined to the basal cell compartment. Benign luminal or columnar cells may be induced to express GSTP1 in
the
face
of
environmental
stress,
a
finding
characteristic of the histological lesion proliferative inflammatory atrophy (PIA) (DeWeese et al.,2001).The expression of this enzyme, GSTP1, is absent in approximately 70% of PIN and virtually all cases of prostate cancer, making it the most common genetic alteration in this malignancy(Nelson et al, 2003). This loss of expression results from hypermethylation of CpG islands in the GSTP1 promoter and causes a defect in cellular defense against oxidant stress, leading to a higher mutation rate. Additionally, GSTP1 hypermethylation has been identified in prostate biopsies with histologic findings of PIN (Nakayama et al., 2004) .A single nucleotide polymorphism in the GSTP1 gene causes substitution of isoleucine to valine at amino acid codon 105 (Ile105Val ).
41
The valine allele is associated with a decreased activity of the enzyme compared with isoleucine allele (Allan et al., 2001)
Fig(2-4) Role of metabolism in chemical carcinogenesis. between phase 1 activation and phase 2 detoxication enzymes. GST, glutathione S-transferases. (Paul and Jed ,2012)
42
Materials and Methods Chapter three 3.1. Materials: 3.1.1 Equipment and instruments The Equipment and instruments used in this study are presented in table (3-1) . Table (3-1) : Equipment and instruments used in this study Equipments
Company
Country
Autoclave
Arnreold and Sories
Germany
Blue tips (1000 µL)
JRL
Lebanon
Centrifuge
bioneer
South Korea
Digital camera
Sony
Japan
Electronic Balance
Mettler Tdedo
USA
Electrophoresis
bioneer
South Korea
Eppendorf tubes 1.5ml and 200µL
Ataco
China
Incubator
Gallenkamp
UK
Micropipette (Automatic)
Biobase
Germany
Refrigerator
Concord
France
Spectrophotometer
Cecil
France
43
Syring 3 and 5 mL
Medeco
UAE
Transiluminator
Vilberlourmat
Japan
Veriti™ Thermal cycler
Applied Biosystem
USA
Vortex
Gallenkamp
USA
Water bath
Towns on and Mercerpty
USA
Yellow tips (100µL)
JRL
Lebanon
3.1.2 Chemicals All Chemicals used in this study are presented in Table (3-2) .
Table(3-2) : chemicals used in this study
Chemicals
Company
Country
Agarose
Promega
USA
Absolute ethanol
Fluka
Germany
Bromophenol Blue
BDH
UK
DNA extraction kit
Jeneaid
South korea
Ethidium bromide
BDH
UK
44
PCR pre mix (master
Bioneer
South Korea
Primers
Bioneer
South Korea
Ladder Marker
Promega
USA
Loading dye
Promega
USA
TBE buffer (10X)
Promega
USA
mix)
(100bp)
3.2 Methods: 3.2.1 Sampling Blood samples (2-3ml) were collected in EDTA tubes for DNA isolation (Molecular genetic studies) from 35 patients(age of patients ranged between 40 - 86 years) all of them were males and diagnosed as having prostate cancer. They attended the Ghazi alHariri Hospital in Baghdad, and from 25 healthy controls(over 40 years old men) .The patients were interviewed and questioned according to special form.
3.2.2 DNA extraction. Total genomic DNA isolated from the whole blood collected in EDTA anticoagulant tubes for molecular studies was applied using genomic DNA purification kits (geneaid ) south Korea. The isolation of DNA was based on salting out methods. 3-2-2-1 Kit components. •
RBC Lysis Buffer 45
•
GT Buffer GB Buffer W1 Buffer Wash Buffer Elution Buffer (10 mM Tris-HCl, pH8.5 at 25ºC) GD Columns 2 ml Collection Tubes
• • • • • •
3-2-2-2 The protocol supplied by the Geneaid Company was used for DNA isolation, as follow: 1-Blood(200µl ) was added to a 1.5 ml micro centirfuge tube. 2- Protinase k (10mg\ml) 30 µl was added to the1.5 ml micro centirfuge tube and mixed briefly .Incubated the mixture in a 60℃ for 15 min. 3- GB buffer(200 μl) was added to the 1.5 ml micro centrifuge tube and mixed
by shaking vigorously.
4- Mixture was Incubated at 60ºC for 5 minutes. During incubation, inverted the tube every 3 minutes. 5- Elution Buffer (200 μl/sample) was pre-heat to 60ºC (for DNA Elution). 6- Absolute ethanol(200 μl) was added to the sample lysate and immediately mixed by shaking vigorously for 10 seconds. 7- GD column was Placed in a 2 ml collection Tube .Transferred all of the mixture (including any precipitate) to the GD Column Centrifuged at 14-16,000 x g for 1 minute. 8- Discarded the 2 ml collection Tube containing the flow-through and placed the GD Column in a new 2 ml Collection Tube.
46
9- Washing buffer( 1400 μl) was added to the GD Column and then centrifuged at 14-16,000 x g for 30 seconds. Discarded the flow-through and placed the GD column back in the 2 ml collection Tube . 10- Wash buffer2 (600 μl ) was added to the GD column centrifuged at 14-16,000 x g for 30 seconds. Discard the flow-through and placed the GD column back in the 2 ml collection tube centrifuge again for 3 minutes at 14-16,000 x g to dry the column matrix. 11- The dried GD Ccolumn was Transferred to a clean 1.5 ml microcentrifuge tube. 12- Pre-heated elution buffer (100 μl) was added to the center of the column matrix. 13-Let stand for at least 3 minutes to ensure the elution buffer or TE is absorbed by the matrix. 14-Centrifuged at 14-16,000 x g for 30 seconds to eluted the purified DNA
3.2.3 Estimation of DNA concentration: DNA concentration and purity were calculated according to Sam brook et al.(1989). DNA sample was diluted with TE buffer to 1:10 or 1:20 and the optical density was read with a spectrophotometer at wavelength 260 nm using the following equation: O.D 260 nm × Dilution factor × 50 µg/ml = DNA concentration µg/ml For measuring the purity of DNA, reading was taken at wavelength 280 nm. The purity of DNA would be: DNA purity = A260/A280 (range =1.8-2) 47
3.2.4 Multiplex Polymerase Chain Reaction (PCR) for GSTM1 and GSTT1 genotyping:
3.2.4.1 Primers Multiplex Polymerase Chain Reaction (PCR) for GSTM1 and GSTT1genotypig was done using a specific primer designed by other studies( Medeiros , et al 2004; Kidd , et al 2003;, Ntais , et al.,2005), NCBI and Primer 3programme.The primer was custom synthesized at Bioneer\South Korea Company as a lyophilized product. The Lyophilized primer was dissolved in free DNase/RNase water to give a final concentration of 100 pmol/μl (as a stock solution), to prepare 20μM concentration as working primer 20 pmol/μl in 80 μl of deionized water to reach a final concentration 20μM. The multiplex PCR was using primers like those presented in Table (3-3).
Table (3-3): primer sequences used in multiplex PCR amplification of GSTM1, GSTT1,CYTP1A1 genes.
Primer CYP1A1 (used as control)
TA
PCR Product size
F 5- GAACTGCCACTTCAGCTGTCT -3
59°C
312bp
R 5- CAGCTGCATTTGGAAGTGCTC -3
59°C
F 5- GAA CTC CCT GAA AAG CTA AAGC -3
59°C
R 5-GTTGGGCTCAAATATACGGTGG -3
59°C
F 5- TTCCTTACTGGTCCTCACATCTC -3
59°C
R 5- TCACCGGATCATGGCCAGCA -3
59°C
Primer sequences
219bp
GSTM1
GSTT1 •
TA= Annealing Temperature
48
459bp
3.2.4.2 Reaction setup Multiplex PCR was performed in a 20 μl total volume, as described in Table (3-4).
Table (3-4): Reaction setup for multiplex PCR Reaction volume (μl)
Component PCR pre Mix (BioNeer )(Ready-to
One tube
use):TaqDNA polymerase ,dNTPs, MgCl 2 and reaction buffer (pH 8.5) Primer forward
1 µl (20PM for each one)
Primer reverse
1 µl (20 PM for each one)
Template DNA
4 (μl ) , (4- 6μg/ml)
RNase –free water
10 (μl )
Total reaction volume
20 (μl )
3.2.4. 3 Cycling conditions . Cycling parameters for multiplex PCR are presented in Table (3-5). Table (3-5): Cycling conditions for multiplex PCR Steps
Temperature
Time
No. of cycles
Denaturation 1
95°C
3 min.
1 cycle
Denaturation 2
94°C
1min
Annealing
59°C
1min
Extension
72°C
1min
Final extension
72°C
5 min. 49
35 cycles
1 cycle
3.2.5 Agarose gel electrophoresis 3.2.5.1 components Agarose One X TBE buffer. Bromophenol blue in 1% glycerol. DNA marker (100 bp). Ethidium bromide (10 mg/ml).
3.2.5.2 Protocol A- Agarose gel preparation • One hundred ml of 1 X TBE buffer was taken in a beaker. • Tow g of agarose were added to the buffer. • The solution was heated till boiling in a water bath until all the gel particles were dissolved. The agarose was stirred in order to be mixed and to avoid the appearance of bubbles.
• The solution was left to cool down at 50-60°C.
B- Casting of the Horizontal Agarose Gel * The gel was assembled in a casting tray and the comb was positioned at one end of the tray. * The agarose solution was poured on to the gel tray ; the agarose was allowed to solidify at room temperature for 30 minutes. *The comb was carefully removed and the gel was re-placed in an electrophoresis gel chamber. 50
* The chamber was filled with a 1x TBE-electrophoresis buffer until the buffer reached 3-5 mm over the surface of the gel.
C- Loading and Running DNA in agarose gel * DNA (10 µl) was loaded in the wells of the 2% agarose gel. DNA ladder (100 bp) was used to estimate the molecular size of the bands.
* The cathode(-) was connected to the well side of the unit and the anode(+) to the other side. * The gel was run at 100 volt for 60 minutes ;afterwards the DNA
moved from cathode to anode poles.
*The DNA was observed by staining the gel with Ethidium bromide and viewed under UV Transilluminator at 302 nm and photographed.
3.2.6 Statistical analysis: The Statistical Analysis System- SAS (2010) was used to determine the effect of difference factors in study parameters such as age, smoking, blood group and family history . Frequencies and distribution
of metabolic genes (GSTM1 and GSTT1) were used to investigate the relationship and correlation between deletion/ presence with occurrence of prostate cancer.
51
Chapter four Results and Discussion 4.1
Demographical Parameters
4-1-1 Age . In the present study, the maximum age was 86 years and the minimum age 40, The maximum number of prostate cancer patients was found within the age group 61-70 (40%)and above70 years (31.43%), one patient (2.86%) was in the group of 40-50 years and nine patient (25.71%)were in the group of 51-60 age. There is also a significant difference(P
