NPH029.fm Page 339 Tuesday, December 19, 2000 7:26 PM
Research
Polymorphism of simple sequence repeats reveals gene flow within and between ectomycorrhizal Suillus grevillei populations Blackwell Science Ltd
Z. Zhou, M. Miwa1 and T. Hogetsu Symbiotic Function Research Unit, Asian Natural Environmental Science Center, The University of Tokyo, Midori-cho 1–1-8, Tanashi-shi, Tokyo 188 – 0002, Japan; 1Present address: Center for Environmental Science in Saitama, Kisai Town, Saitama 347–0115, Japan
Summary Author for correspondence: Zhihua Zhou Tel: +81(0) 424 65 5601 Fax: +81(0) 424 65 5601 Email:
[email protected] Received: 8 June 2000 Accepted: 27 September 2000
• Gene flow within and between two populations of the ectomycorrhizal fungus Suillus grevillei is shown here using co-dominant simple sequence repeat (SSR) markers. • Co-dominant SSR markers were developed for S. grevillei. Distribution and frequency of alleles at the three codominant SSR markers were analysed within two S. grevillei populations in two Larix Kaempteri stands located 700 m apart. • Among eight SSR loci isolated from S. grevillei, five loci (designated SG1–5) were polymorphic and SG1–3 were co-dominant. Genets (73) previously identified by intersimple sequence repeat markers at the Larix stands were divided by the combination of SG1–3 into 22 genotypes. Most of the SSR genotypes were spatially clustered, indicating that the dispersal distance of S. grevillei spores was relatively short. • There was no conspicuous genetic differentiation within or between the two S. grevillei populations, indicating extensive gene flow. The spread of alleles within or between populations might be by repeats of short-distance spore dispersal rather than long-distance spore dispersal.
Key words: ECM fungi, genetic differentiation, gene flow, population, spore dispersal, SSR microsatellite marker, Suillus grevillei. © New Phytologist (2001) 149: 339–348
Introduction Ectomycorrhizal (ECM) fungi form symbiosis association on roots of many plant species in natural ecosystem. The mutualistic association is beneficial to the growth of the plants, through promoting nutrient and water absorption, and providing protection from infection by plant pathogens in roots. It is undoubted that ECM fungi play a significant ecological role in the function and stability of the natural ecosystem. However, little is known about the origins of ECM fungal populations. The investigation of the pattern of reproduction of ECM fungal population is indispensable to address the above question. The potential for establishing ectomycorrhizal populations from spores has been reported to be high according to the large sum production of spores per sporocarp (Dahlberg & Stenlid, 1995). The results of experiments that potted seedlings had
© New Phytologist (2001) 149: 339 – 348 www.newphytologist.com
been fully mycorrhizal after being placed in a forest without contact with the forest soil for several months also reflected the high potential of spores for ECM fungal colonization (Robertson, 1954). Study of genet sizes of the ECM fungus, Pisolithus tinctorius (Anderson et al., 1998), suggests that this species may expand its populations mainly by sexual reproduction (i.e. spore dispersal). Even in a mature forest, spore colonization of Laccaria amethystina seems to be more important than mycelial colonization (Gherbi et al., 1999). In well established populations of Suillus spp., mycelial extension have been reported to be mainly responsible for spread of ECM colonization in the forest (Dahlberg & Stenlid, 1990), however, under certain environmental conditions, for example disturbance, sexual reproduction might be more important than vegetative reproduction (Dahlberg & Stenlid, 1995; Zhou et al., 1999). The above studies indicate that spore dispersal often plays
339
NPH029.fm Page 340 Tuesday, December 19, 2000 7:26 PM
340 Research
an important role in the establishment and reproduction of ECM fungal populations in natural ecosystems. However, little is known about how ECM fungal spores are dispersed. Analyses of gene flow within and between ECM fungal populations may be helpful for elucidating the characteristics of the spore dispersal of ECM fungi. Genetic studies on ECM fungi by inter-simple sequence repeat (ISSR) markers demonstrated that ISSR analysis is a powerful method to identify ECM fungal genets from sporocarps or cultured mycelia (Anderson et al., 1998; Gherbi et al., 1999; Sawyer et al., 1999). Based on DNA polymorphisms of ISSR, the size and distribution of genets of S. grevillei in two stands were also estimated (Zhou et al., 1999; Zhou et al., 2000). However, since ISSR markers are not co-dominant, the method rarely provides accurate information about alleles at individual loci, such as allele frequency and heterozygosity, which are necessary for further studies on gene flow within or among populations. Most population genetic studies of gene flow have adopted the fixation index FST for estimation of the genetic differentiation among sub-populations or populations (Desplanque et al., 1999; Franceschinelli & Kesseli, 1999; Levy & Neal, 1999). FST is calculated from allele frequencies (Wright, 1978; Nei, 1987). Thus, re-examination of the S. grevillei populations with alternative co-dominant markers, which can identify polymorphic alleles at individual loci, would be necessary to reveal aspects on the reproductive biology of the populations. Recently, simple sequence repeat (SSR) regions have become the preferred co-dominant markers in population genetics of many species (Byrne et al., 1996; Ciofi & Bruford, 1999; Gladden et al., 1999; Tessier & Brenatchez, 1999). Co-dominant SSR markers meet most requirements of ideal markers for assessing gene flow. They follow simple Mendelian inheritance (Queller et al., 1993), are easily and reliably scored because amplification of alleles at one locus produces only one or two bands for an individual, are distributed sparsely throughout eukaryotic genomes (Hamada et al., 1982), and are also usually highly polymorphic ( Weber & May, 1989; Powell et al., 1996). In fact, SSR markers often show higher polymorphism than other co-dominant markers, like allozymes (Desalle & Schierwater, 1998; Reusch et al., 1999). In the present research, several SSR markers were developed from S. grevillei DNA, and gene flow, via spore dispersal within and between two S. grevillei populations, was inferred from the spatial distribution and frequencies of alleles determined by SSR polymorphic analyses.
Materials and methods Description of test fields The two stands used as field sites in the present studies were the same as those used previously by (Zhou et al., 2000). Stand A was located by Lake Yamanaka at the foot of Mt. Fuji,
Japan (35°24′N, 135°52′E), where Larix kaempferi (Lamb.) Carriere trees over 85-yr-old were sparsely and unevenly distributed, and mixed with Japanese red pines (Pinus densiflora L.) and broad-leaf trees. Stand B was located 700 m from stand A and was a pure 35-yr-old L. kaempferi plantation, of which Larix trees were planted there at 2 m intervals, however, gaps existed. Between L. kaempferi stand A and B, there were another two small L. kaempferi stands in which the age of the Larix trees was approx. 70 and 74 yr, respectively. Some 50-yr-old Larix trees were also scattered in a seed-breeding stand (Fig. 1). The five stands are physically separated from one another by road or stands of other tree species. All of the Larix trees in the five stands were planted for the first rotation. DNA samples The sporocarps of S. grevillei (Klotz.) Sing in both stands were sampled in 1997 and 1998. Positions of sporocarp emergence were mainly localized in two areas in stand A and three areas in stand B (Fig. 1). The DNA samples from those sporocarps that had been used for the previous ISSR polymorphic analysis (Zhou et al., 2000), were used again for SSR analysis. Isolation of SSR loci Four SSR (microsatellite)-enriched libraries were established using a membrane-enrichment method (Karagyozov et al., 1993; Armour et al., 1994; Edwards et al., 1996) with some modifications (Miwa et al., 2000). Briefly, DNA extracted from one sporocarp was digested by one of the four restriction enzymes EcoR I, Hin dIII, XhoI and Sal I. The resulting fragments were ligated to EcoR I/Not I/Bam H I adaptors (Takara Shuzo Co., Tokyo, Japan) with DNA ligation Kit version 1 (Takara Shuzo Co.), after being blunted by a DNA blunting kit (Takara Shuzo Co.). Amplifications were generated by PCR with primers specific to the adaptor and restriction sites. The amplified fragments were then hybridized with Hybond-N+ membrane (Amersham, Tokyo) to which a combination of the oligonucleotides (GCC)10 (CAA)10 (GTC)10 (GT)15 (GA)15 and (GC)15 was attached. SSR-containing fragments were captured on the membrane. After washing the membrane, bound fragments were eluted in boiling water and amplified by PCR with the adaptor primer. The SSRenrichment process was repeated again. After the second PCR amplification, PCR products were purified by a chroloform extraction and cloned into pT7Blue vectors by using pT7Blue Perfectly Blunt Cloning Kit (Novagen, WI, USA) and transferred to Escherichia coli, XL1-Blue MRF′ competent cells (Sambrook et al., 1989). Clones that integrated with the PCR products were selected and the integrated fragments were sequenced in a DNA sequencer (SQ-5500, Hitachi Co., Tokyo, Japan) using Thermo Sequence premixed cycle sequencing kit (Hitachi Instrument Service Co., Tokyo, Japan)
www.newphytologist.com © New Phytologist (2001) 149: 339 – 348
NPH029.fm Page 341 Tuesday, December 19, 2000 7:26 PM
Research
Fig. 1 Maps of Larix kaempferi stands A, B and interstand Larix stands at the foot of Mt Fiji, Japan. Each dark area in stand A or B represents the main area where S. grevillei sporocarps occurred. Crosses indicate L. kaempferi trees. Triangles represent individual sporocarps and a circle represents an aggregate of sporocarps.
according to the manufacturer’s instruction. Primer pairs were designed from flanking sequences of each SSR locus. PCR for polymorphic analyses Amplifications of SSR loci of S. grevillei samples were performed in a reaction solution containing 5 ng template DNA, 0.4 mM of each dNTP, 1 × GC buffer I (Takara Shuzo Co.)
© New Phytologist (2001) 149: 339 – 348 www.newphytologist.com
which included 2.5 mM Mg 2+, 0.5 U LA Taq DNA polymerase (Takara Shuzo Co.) and 0.2 µl of each designed primer pair, of which one primer was labelled with Texas Red. PCR was carried out in a PCR Thermal cycler (TP3000, Takara Shuzo Co.) under a schedule of 29 cycles of 1 min at 94°C, 1 min at annealing temperature (Ta) and 1 min at 72°C. This was then followed by one cycle of 1 min at 94°C, 1 min at Ta and 5 min at 72°C.
341
NPH029.fm Page 342 Tuesday, December 19, 2000 7:26 PM
342 Research
Results
Gel electrophoreses separates Electrophoresis by a slab acrylamide gel One portion of end PCR product was mixed with 2 µl loading buffer (50% glycerine, 1 mM EDTA, 0.25% xylene cyanol FF; Wako Co. Osaka, Japan) and subjected to electrophoresis on 12% polyacrylamide gels. After staining with ethidium bromide, band patterns were visualized on a UV transilluminator (Toyobo, Tokyo, Japan). Electrophoresis by a sequencer Another portion of the end PCR product was denatured at 94°C for 4 min and separated on 6% sequencing gels made of 6% Longer Ranger acrylamide (FMC Bioproducts Co., ME, USA), 6.1 M urea and 1.2 × TBE (0.1 M tris (hydroxymethyl) aminomethane, 3.0 mM EDTA and 0.1 M boric acid), by a sequencer (SQ-5500, Hitachi Co.). The resulting banding pattern was analysed using software ‘FRAGLYS 2.0’ (Hitachi Electronics Engineering Co., Tokyo). Statistical analysis Allele frequencies and observed heterozygosity at an individual locus were calculated from electrophoretic banding patterns. The expected heterozygosity of a multiallele single locus was calculated according to Nei (1987). To estimate the genetic differentiation between the two populations, fixation index FST originally formulated by Wright (1978) was employed and calculated according to Weir & Cockerham’s model (1984), in which several modifications have been made to avoid errors derived from small sample size and to enable analyses of multialleles at multiloci. The following guidelines were adopted for interpretation of FST values: the FST values ranging from 0 to 0.05 indicate little genetic differentiation among the populations, those ranging from 0.05 to 0.15 moderate genetic differentiation, and those ranging from 0.15 to 0.25 indicate great genetic differentiation, while values > 0.25 indicate very great genetic differentiation (Wright, 1978; Hartl & Clark, 1997).
Isolation of SSR markers In total, eight loci were isolated from the four enrichment libraries of SSR-containing fragments. Primer pairs were designed from sequences flanking the isolated SSR loci. While one of the eight primer pairs yielded no amplification products, the others amplified products which were detected as clear electrophoresis bands. Preliminary tests for polymorphism of the seven primer pairs showed that although two were not polymorphic, five, designated as SG-1, SG-2, SG-3, SG-4 and SG-5, were polymorphic. PCR amplification by SG-1, SG-2 and SG-3 produced one or two electrophoresis bands for each sporocarp, indicating that those primer pairs might amplify alleles at individual loci. SG-4 and SG-5, however, amplified two to five and one to eight bands for each sporocarp, respectively, suggesting that SG-4 and SG-5 amplified alleles at plural loci. The characteristics of the five SSR loci were summarized in Table 1. The first three primer pairs were used for the subsequent studies. DNA polymorphism was analysed using the three SSR markers for all sporocarps of 57 genets in stand A and 14 genets in stand B, which had been identified previously (Zhou et al., 1999; Zhou et al., 2000). SG-1 to SG-3 grouped sporocarps into 2, 8 or 9 groups of identical banding pattern by ordinary polyacrylamide electrophoresis, respectively. Combined analysis using the three SSR markers grouped all the genets into 22 genotypes that were designated as type 1 to type 22. Sporocarps comprising an individual genet were classified into the same SSR genotype. The PCR products were also subjected to electrophoresis by a sequencer in order to determine allelic sizes precisely. The genets in the same SSR genotype showed identical banding pattern on the sequencing gel confirming the groupings by ordinary polyacrylamide gel electrophoresis.
Table 1 The characteristics of five SSR (simple sequence repeat) markers Heterozygosity SSR Marker SG-1 SG-2 SG-3 SG-4 SG-5
Primer pair sequence 5′(r)3′
Repeat motif
Size@ (bp)
F: GACCACAGAGCATGTCACAAC R: GGTGCGAGTAAATTCATTGGG F: ACTGTAAGAGACTGACTTGC R: GAGTAGATGAAAGAACGGTC F: CACAGCATATTAGCTCCGTC R: GAATTAGCTTGTGAGGCTAC F: GCATTCTTCTCTTCCTCC R: CCTACCTGGTTGTGCTTTTG F: ACAACGGGCCATGGCACAATG R: GGTCGTTAGTGGCATCATCG
(AAC)4(AGC)5(CTC)2
129
No. of Alleles*
HE
HO
2
0.06
0.05
98
5
0.54
0.52
(GCA)5 … (GCA)6 … (GCA)8
165
7
0.49
0.52
(CTC)10
226
–
–
–
(CAG)15 … (CAG)24
264
–
–
–
(AT)2(GT)8
@, Sizes are estimated from cloned sequences. *, The numbers of alleles were determined based on banding pattern of 72 S. grevillei sporocarps; –, multiple bands were detected by amplification.
www.newphytologist.com © New Phytologist (2001) 149: 339 – 348
NPH029.fm Page 343 Tuesday, December 19, 2000 7:26 PM
Research
Fig. 2 Distribution of genotypes based on allelic combinations at the three co-dominant SSR loci in stand A and B. Bold numbers indicate the genotypes.
The distribution of the 22 SSR genotypes in the two populations was also mapped (Fig. 2). Many SSR genotypes, such as types 7, 11, 20 and 22, were neighbouring. Although the most frequent genotypes, for example, type 1, 4 and 9 were observed in the areas of both populations, their distributions within each area were localized in clusters.
-97, and SG3-180, -168, -165, -162, -159, -157 and -133) were plotted (Figs 3;4;5). Most alleles, for example SG1-129, SG2-97and SG3-162, were distributed sparsely over all areas in both stands. However, a few alleles aggregated in small areas or appeared only at a single position. For example, allele SG2-106 was found only in area 2 of stand A (Fig. 4), allele SG3-180 appeared only in one genet in both stands, and allele SG3-168 only in one genet of stand B (Fig. 5).
Allele distribution within S. grevillei populations Since products of amplification by SG-1, SG-2 or SG-3 were co-dominant alleles at an individual locus, the distribution of the alleles held by the 73 S. grevillei genets at the three loci (i.e. alleles SG1-131 and -129, SG2-106, -102, -100, -99 and
© New Phytologist (2001) 149: 339 – 348 www.newphytologist.com
Comparison of the allelic frequencies in the two S. grevillei populations The frequency distribution profiles of the co-dominant alleles
343
NPH029.fm Page 344 Tuesday, December 19, 2000 7:26 PM
344 Research
Fig. 3 Distribution of Suillus grevillei alleles at locus SG-1 in areas 1 and 2 in stand A, and areas 1, 2 and 3 in stand B. Triangles represent individual sporocarps. Open and closed circles represent aggregates of sporocarps belonging to a single genet and belonging to plural genets, respectively. Sporocarps and aggregates of sporocarps within the same genet are connected by solid lines. Pairs of asterisks near each genet represent its allele pair, green for SG1-129 and red for SG1-132.
at loci SG-1, SG-2 and SG-3 were compared between the two S. grevillei populations (Fig. 6). The overall profile was similar between the populations. The most frequent alleles, like SG3162, were distributed in both populations with similar frequencies. Some less common alleles, such as SG3-159 and SG3-180 in population A, were also observed in population B. However, several alleles (SG2-100, SG2-106, SG3-133 and SG3-168) were present only in one population. The difference between allele frequency distribution in the two populations was statistically analysed by FST. The FST values calculated from the allele frequencies and observed heterozygosities at the three SSR loci in the two populations was 0.024 (< 0.05), indicating little genetic differentiation between the two populations.
Discussion There was significant spatial clustering of SSR genotypes of sporocarps in our present investigation (Fig. 2). Our previous study also demonstrates that S. grevillei genets in the same high similarity ISSR groups tend to be localized in a limited area (Zhou et al., 1999). This is consistent with the study in chestnut blight fungus, Cryphonectria parasitica, of which similar genotypes of nuclear and mitochondrial RFLP encompass only neighbouring individuals (Milgroom & Lipari, 1995). Such spatial clustering of fungal genotypes could be caused by the short-distance spore dispersal. In a study of basidiospore dispersal, Morkkynen et al. (1997) showed that steep gradients of reduced spore deposition exist with increasing
www.newphytologist.com © New Phytologist (2001) 149: 339 – 348
NPH029.fm Page 345 Tuesday, December 19, 2000 7:26 PM
Research
Fig. 4 Distribution of Suillus grevillei alleles at locus SG-2 in areas 1 and 2 in stand A, and areas 1, 2 and 3 in stand B. Triangles represent individual sporocarps. Open and closed circles represent aggregates of sporocarps belonging to a single genet and belonging to plural genets, respectively. Sporocarps and aggregates of sporocarps within the same genet are connected by solid lines. Pairs of diamonds near each genet represent its allele pair, closed green for SG2-97, closed blue for SG2-99, closed black for SG2-100, open red for SG2-102 and closed red for SG2-106.
distance from a spore source, demonstrating that most basidiospores are deposited in the vicinity of sporocarps. In our case, most S. grevillei spores may also be deposited within relatively short distances from the sporocarps. Allele distributions within a population would provide some information about the gene flow at a relatively small scale. In our present study three patterns of allele distribution were found. Some alleles, for example SG3-180 and SG3-168, were distributed in only one genet, some such as SG2-106 and SG2-102 in several genets distributed in limited areas and the others such as SG2-97, SG2-99, SG3-157 and SG3-165 in many genets distributed over an entire stand (Figs 3; 4; 5).
© New Phytologist (2001) 149: 339 – 348 www.newphytologist.com
If wide-range gene flow occurs, a spore carrying new alleles would sometimes be introduced from outside into the stand, become established new small genets after fusion of monokaryotic mycelia, extend its occupied area by mycelial development, form sporocarps with spores carrying the new alleles, and finally release a large number of spores in the vicinity of the sporocarps. The distribution area of new alleles introduced from outside would be gradually enlarged in the population. The three patterns of allele distribution described above might correspond to the early, mid-term and final stages of allele spread by spore dispersal and mycelial development. Since mycelial extension only causes expansion of the same genet, spread of
345
NPH029.fm Page 346 Tuesday, December 19, 2000 7:26 PM
346 Research
Fig. 5 Distribution of Suillus grevillei alleles at locus SG-3 in areas 1 and 2 in stand A, and areas 1, 2 and 3 in stand B. Triangles represent individual sporocarps. Open and closed circles represent aggregates of sporocarps belonging to a single genet and belonging to plural genets, respectively. Sporocarps and aggregates of sporocarps within the same genet are connected by solid lines.
introduced alleles among different genets may depend more on spore dispersal. As already discussed, new alleles introduced in the populations might spread throughout the stand stepwisely via annual repeats of short-distance spore dispersal. Genetic differentiation among populations or sub-populations in a region could reflect the range and extent of gene flow ( Wright, 1978). FST indicated no conspicuous differentiation between the two S. grevillei populations, suggesting that extensive gene flow occurred and shared alleles evenly between the two populations. As stands A and B were separated by 700 m, the above results mean that S. grevillei alleles can
exchange freely over this distance. Distribution of L. laccata incompatibility alleles over distances ranging from as wide as 5–1200 km also implied wide-range gene flow among ECM fungal populations (Doudrick & Anderson, 1989; Doudrick et al., 1990). Long-distance spore dispersal by wind was suggested as a possible cause for wide range gene flow (Dahlberg & Stenlid, 1995). Mycophagy might also be another media for long-distance spore dispersal ( Johnson, 1995). However, the long-distance spore spread by wind or mycophagous animals may not occur frequently and the quantity of such long-distance-dispersed spores may be small (Dahlberg &
www.newphytologist.com © New Phytologist (2001) 149: 339 – 348
NPH029.fm Page 347 Tuesday, December 19, 2000 7:26 PM
Research
& Stenlid, 1995), especially in the areas where spore density is low. Thus, allele spread via long-distance spore dispersal may be relatively small. As we have discussed above, most S. grevillei spores appear to be deposited within relatively short distances and allele spread via short-distance spore dispersal may occur frequently. As stand B was the first rotation for Larix and the age of it was c. 35 yr, the extensive gene flow between stand A and B began 35 yr ago. Given that there were L. kaempferi trees which were younger than stand A but older than B in the interstand stands between stands A and B, it is possible that the migrating alleles might reach the other stand through the interstand Larix stands, via repeats of spore dispersal, genet establishment and sporocarp formation. This possible process may accelerate the allele migration over a distance of 700 m. In conclusion, the allelic analysis by three codominant SSR markers has demonstrated that although spores were mainly deposited in the vicinity of the parent sporocarps, extensive S. grevillei gene flow occurred between the two populations separated from one another by 700 m. The main cause for the spread of alleles between the two populations might be dependent on repeated short-distance spore dispersal through interstand Larix stands instead of long-distance spore dispersal.
Acknowledgements This work was supported in part by a grant from PROBRAIN and Grants-in Aid (Nos 09NP0901 and 10460064) from the Ministry of Education, Science, Sports and Culture of Japan. The authors would like to thank the other members of the lab and the staff of the University Forest at Yamanakako, The University of Tokyo, for their help in sampling.
References
Fig. 6 Allele frequencies at loci SG-1 (a), SG-2 (b) and SG-3 (c) in the two S. grevillei populations in stand A (dotted bar) and stand B (hatched bar).
Stenlid, 1995). Germination from spores to form monokaryotic mycelia and fusion between two compatible monokaryotic mycelia to reconstitute dikaryotic mycelia are believed to be necessary for successful colonization on host plants in nature. Germination rates of basidiospores are very low, usually < 1% (Bonello et al., 1998; Chamber & Cairney, 1999) and the successful fusion between monokayotic hyphae and colonization on host root system in nature seems to be rare (Dahlberg
© New Phytologist (2001) 149: 339 – 348 www.newphytologist.com
Anderson IC, Chambers SM, Cairney JWG. 1998. Use of molecular methods to estimate the size and distribution of mycelial individuals of the ectomycorrhizal basidiomycete, Pisolithus tinctorius. Mycological Research 102: 295 –300. Armour JAL, Neumann R, Gobert S, Jeffreys AJ. 1994. Isolation of human simple sequence repeat loci by hybridization selection. Human Molecular Genetics 3: 599 – 605. Bonello P, Bruns T, Gardes M. 1998. Genetic structure of a natural population of the ectomycorrhizal fungus Suillus pungens. New Phytologist 138: 533 –542. Byrne M, Marquez GMI, Uren T, Smith DS, Moran GF. 1996. Conservation and genetic diversity of microsatellite loci in the genus Eucalyptus. Australian Journal of Botany 44: 331– 341. Chamber SM, Cairney JWG. 1999. Pisolithus. In: Cairney JWG, Chamber SM, eds. Ectomycorrhizal fungi- key genera in profile. Berlin, Germany: Springer-Verlag, 1 – 31. Ciofi C, Bruford MW. 1999. Genetic structure and gene flow among Komodo dragon populations inferred by microsatellite loci analysis. Molecular Ecology 8: S17 – S30. Dahlberg A, Stenlid J. 1990. Population structure and dynamics in Suillus bovinus as indicated by spatial distribution of fungal clones. New Phytologist 115: 487 – 493.
347
NPH029.fm Page 348 Tuesday, December 19, 2000 7:26 PM
348 Research Dahlberg A, Stenlid J. 1995. Spatiotemporal patterns in ectomycorrhizal populations. Canadian Journal of Botany 73: 1222 –1230. Desalle R, Schierwater B. 1998. Molecular approaches to ecology and evolution. Berlin, Germany: Birkhauser. Desplanque B, Boudry P, Broomberg K, Saumitou LP, Van Cuguen J, DH. 1999. Genetic diversity and gene flow between wild, cultivated and weedy forms of Beta vulgaris L. (Chenopodiaceae), assessed by RFLP and microsatellite markers. Theoretical and Applied Genetics 98: 1194 –1201. Doudrick RL, Anderson NA. 1989. Incompatibility factors and mating competence of two Laccaria spp. (Agaricales) associated with black spruce in northern Minnesota. Phytopathology 79: 694 –700. Doudrick RL, Furnier GR, Anderson NA. 1990. The number and distribution of incompatibility alleles in Laccaria laccata var moelleri (Agaricales). Phytopathology 80: 869 – 872. Edwards KJ, Baker JHA, daly A, Jones C, Karp A. 1996. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 20: 758 –760. Franceschinelli EV, Kesseli R. 1999. Population structure and gene flow of the Brazilian shrub Helicteres brevispira. Heredity 82: 355 –363. Gherbi H, Delarelle C, Selosse MA, Martin F. 1999. High genetic diversity in a population of the ectomycorrhizal basidiomycete Laccaria amethystina in a 150-year-old beech forest. Molecular Ecology 8: 2003 –2014. Gladden JB, Ferguson MM, Friesen MK, Clayton JW. 1999. Population structure of North American beluga whales (Dephinapterus leucas) based on nuclear DNA microsatellite variation and contrasted with the population structure revealed by mitochondrial DNA variation. Molecular Ecology 8: 347 – 364. Hamada H, Petrino MC, Takugana T. 1982. A novel repeated element with Z-DNA forming potential is widely found in diverse eukaryotic genomes. Proceedings of the National Academy of Sciences, USA 79: 6465 – 6469. Hartl DL, Clark AG. 1997. Principles of population genetics, 3rd edn. Canada: Sinauer Associates Inc. Johnson CN. 1995. Interactions between fire, mycophagous mammals, and dispersal of ectomycorrhizal fungi in Eucalyptus forests. Oecologia 104: 467 – 475. Karagyozov L, Kalcheva ID, Chapman VM. 1993. Construction of random small-insert genomic libraries highly enriched for simple sequence repeats. Nucleic Acids Research 21: 3911–3912. Levy F, Neal CL. 1999. Spatial and temporal genetic structure in chloroplast and allozyme markers in Phacelia dubia implicate genetic drift. Heredity 82: 422 – 431. Milgroom MG, Lipari SE. 1995. Spatial analysis of nuclear and
mitochondrial RFLP genotypes in populations of chestnut blight fungus, Cryphonectria parasitca. Molecular Ecology 4: 633 – 642. Miwa M, Tanaka R, Shinone M, Kojima K, Hogetsu T. 2000. Development of polymorphic microsatellite markers in a tropical tree species, Melaleuca cajuputi (Myrtaceae). Molecular Ecology 9: 639 – 640. Morkkynen T, Weissenberg KV, Pappine A. 1997. Estimation of dispersal gradients of S- and P-type basidiospores of. Heterobasidion Annosum. European Journal of Forest Pathology 27: 291–300. Nei M. 1987. Molecular evolutionary genetics. New York, USA: Columbia University Press. Powell W, Machray GC, Provan J. 1996. Polymorphism revealed by simple sequence repeats. Trends in Plant Sciences 1: 215 – 222. Queller DC, Strassman JE, Hughes CE. 1993. Microsatellites and kinship. Trends in Ecology & Evolution 8: 285 – 288. Reusch TBH, Stam WT, Olsen JL. 1999. Microsatellite loci in eelgrass Zostera marina reveal marked polymorphism within and among populations. Molecular Ecology 8: 317 –321. Robertson NF. 1954. Studies of the mycorrhiza of Pinus sylvestris : The pattern of development of mycorrhizal roots and its significance for experimential studies. New Phytologist 53: 253 –283. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press. Sawyer NA, Chambers SM, Cairney JWG. 1999. Molecular investigation of genet distribution and genetic variation of Cortinarius rotundisporus in eastern Australian Sclerophyll forests. New Phytologist 142: 561–568. Tessier N, Brenatchez L. 1999. Stability of population structure and genetic diversity across generations by microsatellite among sympatric populations of land locked Atlantic salmon (Salmo salar L.). Molecular Ecology 8: 169 –179. Weber JL, May PE. 1989. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. American Journal of Human Genetics 44: 388 –396. Weir BS, Cockerham CC. 1984. Estimating F-statistics for the analysis of population structure. Evolution 38: 1358 –1370. Wright S. 1978. Variability within and among natural populations. In: Evolution and the genetics of populations, Vol. 4. Chicago, IL, USA: University of Chicago Press. Zhou Z, Miwa M, Hogetsu T. 1999. Analysis of genetic structure of a Suillus grevillei population in a Larix kaempferi stand by polymorphism of inter-simple sequence repeat (ISSR). New Phytologist. 144: 55 – 63. Zhou Z, Miwa M, Hogetsu T. 2000. Genet distribution of ectomycorrhizal fungus Suillus grivellei Populations in two Larix kaempferi Stands over two years. Journal of Plant Research. 113: 365– 374.
www.newphytologist.com © New Phytologist (2001) 149: 339 – 348
