polymorphisms of human mitochondrial

Proceedings of the Third International Conference on Mathematics and Natural Sciences (ICMNS 2010)

POLYMORPHISMS OF HUMAN MITOCHONDRIAL DNA ANALYSIS IN PAPUAN POPULATIONS Epiphani I. Y. Palit, Hendrikus M.B. Bolly, Yohanis Ngili Universitas Cenderawasih, Indonesia Abstract. D-loop region of mitochondrial DNA (mtDNA) consists of hypervariable segment I (HVSI) and HVSII, has been widely influenced the development of bioetnoantropologi science, genetics, molecular biology, and forensic medicine. Previous studies have determined the nucleotide sequence in HSVI and HVS2 D loop to various ethnic groups in Indonesia, except for Papua. In this study the nucleotide sequence shown Dloop: HVS1 and HVSII in some ethnic in Papua. This research was conducted in four phases namely isolation and preparation of the individual Papuan mtDNA template, amplification of mtDNA template in vitro by PCR using M1 and HV2R primers, sequenced by Sanger method Dideoxy method using Automatic DNA Sequencer, and nucleotide sequence analysis of mtDNA using DNASTAR software. Results mtDNA sequence analysis of human mtDNA samples of ethnic Papuans produce 820-858 nucleotides of D-loop. Normal specific mutations, among others: the sample Papua namely C16.223t, C16.295t, T16.362c, T16.519c, A73G, T146c, T199c, and A263G. These mutations can be used as an indicator to distinguish human-specific mutation with a variety of ethnic Papuans in Indonesia and the World Populations. Outcomes obtained from this research is a sequence of mtDNA and polymorphism individuals on ethnic Papuans and databases that can be used directly for the bene fit of the field of forensic medicine, police, population, and other related fields. Keywords: mtDNA, D-loop, Papuan Populations

1 Introduction Anderson have determined the sequence of mitochondrial DNA (mtDNA) of human complete with size 16569 bp arrange d in a circle (circular) and consists of genecoding genes (coding region) and non-coding regions (control region). Non-coding region is also called the Displacement loop or D-loop. Susceptible human mtDNA mutation causing a high degree of polymorphism bet ween one individual than another individual. Regional mitochondrial genome (mtG), which has the highest level of polymorphism is the D-loop. Another characteristic of mtDNA is a specific pattern of inheritance through the maternal lineage (maternally inherited) [1-2]. Anderson's invention is then used as a standard in many molecular genetic studies, especially relating to human mtDNA polymorphisms. Analysis of nucleotide sequence variations of D-loop can be used to determine the identity of a person or a particular ethnic and human evolution and global migration. [3-4]. This research is part of an effort to obtain a database normal variant of human mtDNA ethnic Papua Indonesia which has not been published in

62

Polymorphisms of Human Mitochondrial DNA Analysis in Papuan Populations

Genbank [5]. This research was specifically carried out to determine and analyze the nucleotide sequence of 0.8 kb. D-loop region of human mtDNA Indonesia in individuals tribe Serui, Biak, Wamena, Nabire, Jayapura in Papua province, Indonesia. In this paper we show that mutation of specific mutations of mtDNA sequence analysis of human mtDNA samples of Indonesian Papua, which generate ethnic specific nucleotide mutations. The result is expected to complete the database normal variant of human mtDNA Indonesia.

2 Materials and Methods Preparation of mtDNA templ ate Template was amplified mtDNA from blood cells of individuals ethnic Papuans. Taking blood cells is done by taking from the arm veins. Further blood put into 1.5 mL micro tubes (Eppendorf) ready to lysis in final volume 300 L with Maniatis method [6]. Tabl e 1. Description of samples used in research . Sequence code Sample code Ethnic type P apua 1 DK01SE Serui P apua 2 JB02BI Biak P apua 3 GW16NA Nabire P apua 4 TN21WA Wamena P apua 5 SM24JA Jayapura

MtDNA template to be amplified is obtained directly from the analysis without prior purification. Lysis carried out by mixing blood cell pellets with 40 µL lysis buffer10x (500 mM Tris-HCl) pH 8,5 (Pharmacia Biotech), 10 mM EDTA pH 8,5 (J.T. Baker), and 5% Tween-20 (Merck), 8 µL proteinase enzymes K 10 mg/mL (USB Corporation) and added ddH 2O sterile until the volume 400 µL, then the reaction mixture was incubated at 55 0C for an hour in incubator (WaterbathGrant Instrument Ltd) and continued at a temperature 95 0C for 5 minutes for inactivation of the enzyme proteinase K. After incubation the reaction mixture was centrifuged using a type microcentrifuge 5417C (Eppendorf) at 20000 g for 3 minutes and then taken supernatant subsequently used as template for PCR reaction [7-8]. Templ ates by PCR amplific ation In this study amplified 0.8 kb D-loop mtDNA region by using a pair of primers M1 (5'-CACCATTAGCACCCAAAGCT-3') and HV2R (5'-CTGTTAAAAGTGCATA CCGCC3'). The process of PCR performed with PCR conditions of Aquadro and Greenberg. PCR reaction mixture was performed in 0.5 mL tubes (Eppendorf), which consists of 10 µL mtDNA template lysis results , 1 µL primer M1 (20 pmol/µL), 1 µL primer HV2R (20 pmol/µL), 5 mL PCR buffer 10x (Amersham life science: 500 mM KCl, 100 mM Tris-HCl pH 9,0 at temperature 250C, 1,0% Triton X-100, 15 mM MgCl 2), 2 enzyme unit Taq DNA Polymerase (Amersham life science), 1 µL mixture dNTP (Amersham life science) and added ddH 2O sterile so that the volume reaches 50 µL. In each PCR tube plus a drop of nujol mineral oil (Perkin Elmer) to prevent

63

E.I.Y. Palit, H.M .B. Bolly, Y. Ngili

evaporation during the PCR process. Results PCR amplification of the process were then analyzed by agarose gel electrophoresis 1.2% (w/v) ( Boehring er-Manheim), Conductor current in voltage 75 volts for 45 minutes, a marker used is pUC19/HinfI (Amercham life science). The results of electrophoresis and visualized by UV lamp series 9814-312 nm (Cole Parmer). Purification of PCR performed with ethanol precipitation method [7-8]. Purified DNA was electrophoresed on 1.2% agarose gel to estimate DNA concentration by using a marker pUC19/HinfI. Tabl e 2. Nucleotide sequence of M1 and HV2R primers. Primer P osition Sequence 5’ 3’ M1 CACCATTAGCACCCAAAGCT L 15.978-15.997 HV2R CTGTTAAAAGTGCATACCGCC H 429-409

Direct Sequencing Direct sequencing is a stage to determine the nucleotide sequence fragment amplified by PCR without going through the process of cloning. Sequencing methods that are used just like ordinary sequencing process, but there are some differences in the stages of reaction, namely the preparation of template DNA and PCR amplification process. DNA template for sequencing process was prepared by using GFX kit (GFX TM PCR DNA and Gel Band Purific ation kit, Amersham life science), which aims for the purification of DNA by removing salts, enzymes, nucleotides and the rest of the PCR primers. The working principle GFX kit is specifically bind DNA with a glass fiber matrix and using chaotropic reagents that can denaturated protein and dissolve agarose. Furthermore, the DNA eluted with TE buffer, Tris-HCl or ddH2O sterile. The first stage in the preparation of this DNA is the concentration of DNA fragments of 0.8 kb PCR product with a vacuum concentrator until the volume 20 L. Then 20 L concentration results electrophoresed with 1.2% agarose gel in 0.5 x TBE buffer (Merck: tris-borate 0.09 mM and 0.002 mM EDTA). DNA markers used are pUC19/HinfI and voltage electrophoresis at 75 volts for 45 minutes. About 0.8 kb DNA band is cut with a sterile cutter and then put in 1.5 mL sterile tube of known weight of the empty tube. Further tube containing pieces to be weighed so as to determined the net weight of the gel pieces. Then add capture buffer 10 L for every 10 mg of gel (maximum column capacity is 300 L c apture buffer added to the 300 mg gel) and stirred with vortex then heated at 60 o C for 15 minutes until the gel dissolves completely. After centrifugation the gel dissolves done with the series 5417 C microcentrifuge speed 20000 g for 1 min and transferred to the GFX column. Samples were incubate d in the GFX column at room temperature for 1 minute then centifugated with the same speed for 1 minute. The fluid reservoir is accommodated in the tube removed and GFX column placed back into the reservoir tube. GFX column was washed with washing buffer and centrifuged at same speed for 1 min and then centrifuged again under the same conditions until dry GFX column. GFX column leaching results transferred to sterile 1.5 mL tube and added 50 L ddH 2O into the GFX column matrix and incubated at 37 °C for 2 minutes. Furthermore, to obtain purified DNA is centrifuged at a speed of 20000 g for 1 minute. The purified DNA was concentrated with a vacuum concentrator to a volume of 10 L. Determination of the

64


concentration of purified DNA 1.2% agarose electrophoresis performed with standard DNA pUC19/HinfI. 3,5 L DNA miniprep (approximately 200 ng) plus 1,2 L primer PCR M1 and HV2R (2,4 pmol) and added ddH 2O sterile until 9 L. After the homogenized reaction mixture is inserted into the PCR machine to denatured at a temperature of 96 o C for 30 seconds and then stopped a moment to do the addition 6 L reaction mixture containing A-dye terminator, G-dye terminator, C-dye terminator, and Tdye terminator, dNTP, Tris-Cl (pH 9.0), MgCl 2, pyrophosphate and Amplitaq thermostable DNA polymerase. Sequencing reaction was homogenized by using a pipette tip, then resumes again with the process as much as 25 PCR cycles. PCR conditions for each cycle of denaturation carried out at a temperature of 96 o C for 30 seconds, annealing at a temperature of 48 o C for 15 seconds, and extension at 60 o C for 4 minutes [7-9]. Sequenc e analysis of mtDNA sequencing results Analysis of 0.8 kb of nucleotide sequence data of D -loop mtDNA in silico results of sequencing performed using the computer program DNASTAR, version 4.00. Each sample of individuals analyzed ethnic Papuan homology against existing nucleotide sequence is the order of the Cambridge reference seq uenc e (CRS) that has been revised. From the results of homology can be known of the sides of the nucleotides that are that are polymorphic (mutation). The reading of the results of sequencing can be seen from the electropherogram data showing each base has a color and a different peak height. Basa A green, black G-base, base C is blue, and red T-base [7]. The analysis was done by comparing the results of nucleotide sequence data with data electropherogram using the program DNASTAR seqman, then determine the size and nucleotide sequence that read well as a nucleotide sequence using DNASTAR EditSeq. Nucleotide sequence of all samples processed by meg align DNASTAR program to determine sequence homology with inter-sample and Cambridge.

3 Results and Discussion Results of collecting a sample of blood cells of individuals who subsequently Papuan ethnic lysis with modified Maniatis method [10]. The filtrate is the result of lysis of DNA template for PCR process. PCR fragments were analyzed by agarose gel electrophoresis, a standard measure used plasmid DNA pUC19/HinfI. All samples gave amplified fragment size of about 0.8 kb located between 1.419 and 517 bp band standard pUC/HinfI. These results are as expected, which has been amplified fragment 800 bp D-loop region of mtDNA using M1 and HV2R primers. Fragment amplification results obtained also confirmed not a contaminant because of the negative control PCR containing no DNA template (template is replaced with sterile ddH 2O) did not show any band on gel electrophoresis.

65


Figure 1. Sequencing of individual ethnic P apuan mtDNA template, which were sequenced using primers M1.

Figure 2. Results of P apua human mitochondrial DNA sequence analysis using EditSeq DNASTAR.

Fragments of PCR product was purified by ethanol precipitation [ 10], sequenced 0.8 kb fragment of mtDNA D-loop without going through the cloning process by using M1 and HV2R primers which produce around 800 bp that can be used for the analysis of homology is 800 bp. MtDNA sequence data processing sequence results to determine the position and type of mutation used by Seqman DNASTAR program. On this program can be known with accuracy mutations that occur through direct observation of the spectrum-spectrum of DNA. In figure 3 show examples of data processing using the program to compare with Seqman Papua samples 1 and 2 by using a primer Papua M1. In this paper we show that specific mutations of mtDNA sequence analysis of 5 samples of human mtDNA Indonesian ethnic Papuans. Specific mutations of the dominant normal among others: C16.223t, C16.295t, T16.362c, T16.519c, A73G, T146c, T199c, and A263G. The results of this research are expected to complement the database of normal variants of human mtDNA Indonesia, and indicated that the number of transition mutations are more likely than transversion mutations.

66


These data are supported by some research results from Horai et al. and Aquadro and Greenberg.

Figure 3. Examples of the results of human D-loop mitochondrial DNA sequence analysis of P apua Individuals using the program DNASTAR SegMan, which shows a comparison of nucleotide sequences of P apua and P apua 2.

4 Conclusion From the discussion, it can be concluded that the specific mutation that mutation of mtDNA sequence analysis of 5 samples of human mtDNA Indonesian ethnic of Papua on Biak, Serui, Wamena, Nabire, and Jayapura. Specific mutations normally include: C16.223t, C16.295t, T16.362c, T16.519c, A73G, T146c, T199c, and A263G. These mutations can be used as a specific marker for ethnic Papuans in the study of human migration, forensic chemistry, demography and bioetnoantropologi.

Acknowledgements We thank Mrs. Endang Sriatimah for her asistance during the research process and chemicals are required. Also To DP2M-DIKTI which has provided research grants: Cooperation Research Grant (PEKERTI) under contract 37/J20.2/PG/HP/DP2M.

References [1]

Wallace, D.C., (1989), Mitochondrial DNA mutations in neuromuscular disease, Trends in Genet., 5 (1) page 9-13.

[2]

Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J., Staden, R., and Young, I.G., (1981), Sequence and organization of the human mitochondrial genome, Nature, 290 (5806) page 457-467.

67


[3]

Aquadro, C.F. and Greenberg, B.D (1983), Human mitochondrial DNA variation and evolution; analysis of nucleotide sequences from seven individuals, Genetics., 103, 287 – 312.

[4]

Horai, S. and Hayasaka, K (1990), Intraspesific nucleotide sequences differences in the major noncoding region of human mitochondrial DNA, Am. J. Hum. Genet., 46, 828-842.

[5]

Ngili, Y, and Noer, A.S (2006), Polymorphis m mtDNA on Papuan Popul ation, International New Guinea Biology Conference , Port Moresby.

[6]

Qiagen, (1995), Qiaprep Plasmid Handbook, GFX TM PCR DNA and Gel Band Purification Kit, Amersham Pharmacia biotech, Inc.

[7]

Perkin Elmer (1995), ABI PRISM Comparative PCR Sequencing, The PerkinElmer Coorperation, USA.

[8]

Amersham Pharmacia Biotech, (1999), Manual GFX TM PCR DNA and gel band purification kit, USA

[9]

DNASTAR, (1997), Lasergene Biocomputing Software for Windows, User’s Guide : A Manual for the Lasergene System, DNSTAR, Inc, Wisconsin, USA.

[10]

Ngili, Y, dan Noer, A.S (2007), Studi Polimorfis me Nukleotid a Daerah D-Loop DNA Mitokondria Manusia: HVSI/HVSII pad a Populasi Papua, Book Program JSChem ITB-UKM 7th.

EPIPHANI I.Y. PALIT Faculty of Mathematics and Natural Sciences, Universitas Cenderawasih, Indonesia E-mail: [email protected] HENDRIKUS M.B. BOLLY Faculty of Medicine, Universitas Cenderawasih, Indonesia E-mail: [email protected] YOHANIS NGILI Biochemistry Division, Faculty of Mathematics and Natural Sciences, Universitas Cenderawasih, Indonesia E-mail: [email protected]

68