Population genetics of invasive Citrullus lanatus ... - Springer Link

Biol Invasions (2015) 17:2475–2490 DOI 10.1007/s10530-015-0891-6

ORIGINAL PAPER

Population genetics of invasive Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus (Cucurbitaceae) in Australia: inferences based on chloroplast and nuclear gene sequencing Razia S. Shaik • David Gopurenko • Nigel A. R. Urwin • Geoffrey E. Burrows Brendan J. Lepschi • Leslie A. Weston

•

Received: 16 August 2014 / Accepted: 31 March 2015 / Published online: 8 April 2015 Ó Springer International Publishing Switzerland 2015

Abstract To understand the invasion history of the invasive weeds Citrullus lanatus (camel melon), Citrullus colocynthis (colocynth) and Cucumis myriocarpus (prickly paddy melon) in Australia, we studied a collection of geographically diverse samples from Africa (native range), Asia, North and South America, Europe and Australia (introduced ranges). We sequenced portions of two gene regions, the nuclear G3pdh gene and the chloroplast ycf6–psbM intergenic spacer region, to identify the diversity and relationships of alleles/haplotypes present within and among sampled populations of each species. We found that C. lanatus

Electronic supplementary material The online version of this article (doi:10.1007/s10530-015-0891-6) contains supplementary material, which is available to authorized users. R. S. Shaik (&) G. E. Burrows School of Agricultural and Wine Sciences, Charles Sturt University, Locked Bag 588, Wagga Wagga, NSW 2678, Australia e-mail: [email protected] R. S. Shaik D. Gopurenko N. A. R. Urwin G. E. Burrows L. A. Weston Graham Centre for Agricultural Innovation (NSW Department of Primary Industries and Charles Sturt University), Locked Bag 588, Wagga Wagga, NSW 2678, Australia

and C. myriocarpus populations in Australia contain negligible levels of diversity in both genes, indicative of single, genetically impoverished founder events by both species and potentially derived from single source populations in both instances. Together, historical and sequence information point to the north-western region of the Indian subcontinent as the likely source of Australian C. lanatus. Surprisingly, Australian C. myriocarpus plants share the same genetic profile as that observed in all other invasive populations of this species, but differ from that observed in native African plants. This indicates a shared origin of invasive C. myriocarpus populations and potentially a stepping-stone pathway of founder events across the globe, the origins of which are yet unidentified. In contrast, moderate levels of genetic diversity are present among N. A. R. Urwin School of Animal and Veterinary Sciences, Charles Sturt University, Locked Bag 588, Wagga Wagga, NSW 2678, Australia B. J. Lepschi Australian National Herbarium, Centre for Australian National Biodiversity Research, GPO Box 1600, Canberra, ACT 2601, Australia

D. Gopurenko NSW Department of Primary Industries, Wagga Wagga Agricultural Institute, Pine Gully Rd, Wagga Wagga, NSW 2650, Australia

123

2476

Australian C. colocynthis that can be geographically sorted mainly into eastern and western regions of the continent. This suggests two separate introductions of the species into Australia, from two different source populations, most likely originating from northern Africa and/or southern Europe/Turkey. The evidence of impoverished genetic diversity in Australian populations of C. lanatus and C. myriocarpus indicates they are likely to exhibit similar responses to control measures. In contrast, development of effective chemical or biocontrols for C. colocynthis in Australia may present a greater challenge. Keywords Biological invasion G3pdh ycf6– psbM Genetic diversity Introduction Phylogenetic analysis

Introduction Citrullus lanatus (Thunb.) Matsum. and Nakai, Citrullus colocynthis (L.) Schrad. and C. myriocarpus Naudin are cucurbitaceous weeds found widely distributed throughout Australia (http://avh.chah.org.au/) and are native to Africa (Parsons and Cuthbertson 2001). They are prominent in Australian crops (Michael et al. 2010b), fallow paddocks and natural habitats (Harris et al. 2007; Martin et al. 2006; Michael et al. 2010a) causing significant yield reductions and biodiversity losses (Martin et al. 2006; Michael et al. 2010a). Camel melon (C. lanatus) and prickly paddy melon (C. myriocarpus) are monoecious annuals, while colocynth (C. colocynthis) is a monoecious perennial with a resprouting tuberous rootstock (Burrows and Shaik 2014; Parsons and Cuthbertson 2001). All three species are summer weeds in Australia and can be distinguished by morphological and molecular characteristics (Parsons and Cuthbertson 2001; Shaik et al. 2012). Historical records for the timing of introduction of C. myriocarpus and C. colocynthis to Australia are unavailable. However, it is postulated that introduction of C. lanatus to Australia likely accompanied the importation of camels to Australia during the mid 1800s to facilitate road and railway construction (Parsons and Cuthbertson 2001). Outside of Australia, C. lanatus is widely naturalised in North America (Hickman 1993; Miller and Schlising 2013; Ramirez et al. 2014), South America, Asia, New Zealand

123

R. S. Shaik et al.

(Parsons and Cuthbertson 2001) and also in Europe (GBIF 2011b). C. colocynthis is naturalised in the Mediterranean region of Western Asia to India, and also in North America (GBIF 2011a). Cucumis myriocarpus is naturalised in southern Europe (Elorza et al. 2011), North America (GBIF 2011c; Hickman 1993) and New Zealand (Williams and Randall 2002). The fitness of an invasive weed to a new environment is determined by many factors, which typically include its inherent pre-adaptive traits (Clark et al. 2013; Dlugosch and Parker 2007) such as life history characteristics and morphological traits (Gallagher et al. 2011; Stricker and Stiling 2013). Invasive plants can also succeed in a new environment if more favourable conditions exist (Le Roux et al. 2008), including the release from natural enemies (Hinz et al. 2012; Huffaker and Kennett 1959), and enhanced pollination (Meyerson and Cronin 2013; Pysˇek et al. 2010). Invasion success may also be associated with differential gene expression in certain biotypes leading to successful growth as in the case of the invasive weed Ambrosia artemisiifolia L. (Prentis and Pavasovic 2013). In some cases successful invasion is the result of a combination of two or more factors (Dlugosch and Parker 2007; Hinz et al. 2012; Kelager et al. 2013; Sexton et al. 2002). Population genetic studies of invasive species suggest that the level of genetic variation present in an introduced population determines its evolutionary potential in a new habitat (Dlugosch and Parker 2007; Hornoy et al. 2013; Simberloff 2009) and is an important factor contributing to the success of the invasive species (Prentis et al. 2008). Available genetic variation within an invasive population is influenced by the initial effective size of the founder population(s), breeding system, and additional gene flow from other source populations in the invasive range or from closely related introgressive species (Dlugosch and Parker 2007; Meyerson and Cronin 2013; Pysˇek et al. 2010). Founder populations of introduced species can experience population bottlenecks (reductions in effective population size) during early stages of expansion and establishment in a novel range. The intensity, duration and frequency of these bottle-necks can increase the effects of genetic drift leading to further loss of genetic diversity in these populations (Meimberg et al. 2006; Simberloff 2009). Alternatively, plant invaders can develop postinvasion genetic diversity (Jakobs et al. 2004) by mutation and novel chromosomal or ploidy changes,

Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus (Cucurbitaceae) in Australia

and also by hybridization and/or introgression with closely related congeners present in the invasive range (Meyerson and Cronin 2013; Prentis et al. 2009). In contrast, multiple introductions of a species to a location from diverse source populations can result in a significantly diverse meta-population in the invaded range (Hornoy et al. 2013; Kelager et al. 2013; Simberloff 2009; Ward et al. 2008). Such enhanced variability can be expressed in traits most likely to be adaptive in new environments (Ellstrand and Schierenbeck 2000). In turn, this may result in the development of locally-adapted ecotypes/genotypes through natural selection (Prentis et al. 2008; Sexton et al. 2002). It is therefore vital to evaluate the invasive population’s genetic makeup, as it can provide information on the evolutionary processes that have occurred and their role in invasion success (Hornoy et al. 2013). Assessing the genetic composition of an invasive species can be useful in different ways. Firstly, the potential number of introductions and the diversity of an invasive population can be identified (Meimberg et al. 2006); this may provide insight into the responses of weed populations to specific management methods (Ward et al. 2008). Secondly, potential source populations of the invader can be identified (Clark et al. 2013; Kelager et al. 2013); these populations may host natural enemies (Ellstrand and Schierenbeck 2000; Ndlovu et al. 2013) which can be useful as biological control agents (Goolsby et al. 2006). The history of an invasive species can be determined by assessing their population genetic variability and structure (Le Roux et al. 2011). Molecular genetic studies, either solely or in conjunction with historical records, can therefore assist in the reconstruction of introduction pathways, or assessment of population genetic diversity after introduction into the new range (Hornoy et al. 2013; Kelager et al. 2013; Le Roux et al. 2011; Novak and Mack 2001). In this paper we present results of a molecular sequence analysis of the nuclear G3pdh Intron-2 gene region and the chloroplast ycf6–psbM intergenic spacer region from specimens of native and invasive populations of three cucurbit invasive species: C. lanatus (camel melon), C. colocynthis (colocynth) and C. myriocarpus (prickly paddy melon). These regions have been reported as useful for identifying genetic diversity and relationships within Citrullus (Dane and Liu 2007; Dane et al. 2007). Our focus was on

2477

identifying the possible origins and historical pathways of introduction of the three weeds into Australia using comparative phylogeographic methods of analysis. We also report on the extent of diversity of these weeds in Australia, thus providing useful genetic information that is potentially informative for management of these species.

Materials and methods Sampling A total of 256 accessions were sampled for this study (C. lanatus N = 124, C. colocynthis N = 67 and C. myriocarpus N = 65), including living plants (N = 65), preserved herbarium material (N = 108) and seed material from germplasm collections (N = 41). Samples selected for analysis were distributed throughout the distributional ranges of C. lanatus, C. colocynthis and C. myriocarpus [as per the Global Biodiversity Information Facility (GBIF) data portal (GBIF 2011a, b, c)]. This material was supplemented by additional pre-existing gene sequence data (N = 42) derived from accessions available at GenBank (http:// www.ncbi.nlm.nih.gov/genbank/). Sample tissue type and location are detailed in Table S1 and Figure S1. Molecular sequence analysis For each species, we examined sequence variation at a portion of the nuclear gene G3pdh, and the chloroplast intergenic spacer region ycf6–psbM. These two independent markers were informative in earlier population genetic analyses of cucurbits (Dane et al. 2007). Methods of sample digestion and DNA extraction, PCR method, primers for G3pdh and sequence analysis are presented elsewhere (Gopurenko et al. 2013; Shaik et al. 2011). We had limited success in amplifying the chloroplast ycf6–psbM intergenic spacer region using the primers previously reported by Dane et al. (2007); PCR success at this gene was greatly improved using novel primers ycf6F2F (5 CTTGGGCTGCTTTAATGGTA 30 ); based on the reverse complement of primer ycf6 r2 (Heinze 2007) and psbMR1D (50 GTAAATATTCTYGCATTTA TTGC 30 ); based on psbMR (Heinze 2007). All primers incorporated 17 bp 50 M13 tails to facilitate downstream sequencing performed at the Australian

123

2478

Genome Research Facility, Brisbane. Nuclear sequences containing heterozygous nucleotide sites were phased as two separate alleles using the phase module implemented in DnaSP v5 (Librado and Rozas 2009). The phase run was performed using 1000 iterations, 10 thinning intervals, 1000 burn iterations and incorporated a model that accounted for recombination and use of default settings. All sequences were queried at GenBank using the BLAST tool to test for presence of contamination by non-target species. All representative sequences were deposited at GenBank and are publicly available as accessions KP209445 to KP209449, KP209453, KP209459, KP209460, and KP271126 to KP271150. Chloroplast and nuclear gene alignments were truncated to 941 bp and 583 bp (C. lanatus); 935 bp and 582 bp (C. colocynthis); and 629 bp and 983 bp (C. myriocarpus), respectively. An additional sequence alignment including GenBank sequence accessions at ycf6–psbM for C. colocynthis was reduced to 660 bp to allow equal length sequence comparisons at that gene and species. It was not possible to generate sequences from all specimens at both loci. Chloroplast haplotypes and nuclear alleles present among specimens at each gene alignment (treating indels/sequence gaps as informative single characters) were identified using the online tool FABOX (Villesen 2007). Summary genetic statistics were estimated within populations and continents using ARLEQUIN ver. 3.5 (Excoffier and Lischer 2010), and included estimates of haplotype (h) and nucleotide (p) diversity (Nei 1987) to assess the level of DNA polymorphism within each species. Neutrality tests including Tajima’s D (Tajima 1989) and Fu’s Fs (Fu 1997) were used to determine if there was evidence at either gene of deviation from neutral evolution induced by selection and/or demographic events within continental populations. To provide an initial evaluation of the influence of geography on genetic structure among continental native and invasive populations, we used analysis of molecular variance (AMOVA) (Excoffier et al. 1992) as implemented in ARLEQUIN version 3.5 (Excoffier and Lischer 2010) to partition and estimate genetic variance among and within continents. AMOVAs were conducted independently at nuclear and chloroplast genes and were based on allele and haplotype frequency, respectively. In addition, we estimated pairwise population fixation statistics (FST) between continents to provide relative measures of genetic

123

R. S. Shaik et al.

subdivision between continental populations at each gene. Significance of FST values in all pairwise tests and also at AMOVA were estimated by permutation procedures (10,000 replicates) as implemented in ARLEQUIN. Genetic distance relationships among representative alleles and haplotypes were estimated as distance trees using the Neighbour Joining (NJ) method (Saitou and Nei 1987) as implemented in MEGA 6.0 (Tamura et al. 2013) to show the relative extent of genetic distance within and among the species at each gene. Missing sites and indels/gaps were excluded using the pairwise deletion option in MEGA. Statistical significance of nodes in the distance trees were assessed by bootstrapping (10,000 replicates). We also constructed 95 % statistical parsimony networks at the two genes using TCS software version 1.21 (Clement et al. 2000) to infer genealogical relationships among alleles and haplotypes present in native and invasive continental populations of each species, and as a means to provide greater resolution of the putative sources of the three species introduced into Australia. Resolution of genealogical relationships was further informed by coding indels as single mutations and including them in network analyses as ‘‘5th’’ characters. It is to be noted in the case of C. colocynthis, India and Pakistan were considered as in South Asia (S. Asia), while Afghanistan, Iran, Iraq and Israel were regarded as Middle East Asia (M.E. Asia) for related analyses.

Results Sequence information A total of 409 sequences were available for analysis across both markers (Table S1). Indel polymorphisms (1–3 bp) were observed among G3pdh alleles within C. lanatus and C. myriocarpus; indels at the ycf6– psbM locus were observed for C. colocynthis and C. myriocarpus. In C. lanatus samples we detected 16 G3pdh alleles and five ycf6–psbM haplotypes; C. colocynthis had eight alleles and five haplotypes, and C. myriocarpus had nine alleles and five haplotypes (Table 1). For ease in identification, alleles and haplotypes associated with the three species were sequentially numbered as N1–N34 (nuclear alleles) and C1–C15 (chloroplast haplotypes), respectively.


2479

Table 1 Alleles at nuclear gene G3pdh and haplotypes at chloroplast ycf6–psbM intergenic spacer identified for Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus sampled from Africa (native) and other continents (invasive) Range

Continent

N N alleles G3pdh

Alleles

n n hap ycf6–psbM

Haplotypes

Australia

45 5

1

N1

33

1

C1

3

N1, N2, N4

5

2

C1, C2

Citrullus lanatus Invasive range

Europe

Native range

N. America

11

5

N1, N2, N4, N5, N6*

S. America

1

1

N2

10

2

C1, C2

1

1

C3

Asia (India)

11

4

N1, N2, N4, N12*

10

3

C1, C2, C5*

Africa

34

13

N1,N3, N4,N5, N7*, N8*, N9, N10*, N11*, N13*, N14*, N15, N16

30

3

C1, C2, C4*

Australia

31

4

N17, N19, N20*, N24

29

2

(C6), C9

3

1

N17

1

1

C6

14

2

N18, N22*

17

2

C7, C10*

Africa

9

4

N17, N18, N19, N21*

9

3

C6, C7, C8

B and TWS#

1

1

N23*

1

1

C6

Citrullus colocynthis Invasive range

Europe Asia Native range Cucumis myriocarpus Invasive range

Native range

Australia$

22

1

N25

27

1

C11

Europe

2

1

N25

2

1

C11

N. America

2

1

N25

2

1

C11

14

9

N25, N26, N27, N28, N29, N30, N31, N32, N33

17

4

C12, C13, C14, C15

Africa

Number (n) of individuals sampled, number of alleles (n alleles) and haplotypes (n hap) observed and their designation as per Table S1 B and TWS# indicates commercial sample from unknown location provided by B and T World seeds Co. via GenBank (C6) indicates the shared haplotype between Citrullus lanatus and Citrullus colocynthis Australia$ indicates samples at G3pdh represented only by eastern Australian material with no representative sequences of Western Australian origin * Indicates sequences obtained from GenBank not sampled directly for this study

Several of the nuclear gene alleles were determined by performing phase analysis of the specimens with heterozygous sequences. A single specimen morphologically identified as C. lanatus (ww09735) shared a chloroplast haplotype (C6) that was prevalent among C. colocynthis specimens (Table S1); due to this sharing and the uncertain heritage and taxonomy of this specimen, it was excluded from genetic diversity analyses for C. lanatus but included in the distance tree and parsimony network analyses (see below). Genetic diversity measures and tests of neutrality Nucleotide (p) and haplotype (h) diversity at the two assayed genes and in all three species was generally higher in the native distribution in Africa than in

invasive populations from other continents (Table 2). The single exception was North American C. lanatus, which had both higher nucleotide and cpDNA haplotype diversity [(p = 0.0017; h = 0.555) than those from Africa (p = 0.0015; h = 0.480)]. Diversity in all other invasive populations of C. lanatus was moderately high except in those from Australia, which were fixed for a single nuclear allele (N1) and cpDNA haplotype (C1). All invasive C. myriocarpus populations were genetically homogenous and shared a single nuclear allele and cpDNA haplotype; in contrast, African C. myriocarpus had higher levels of diversity similar to that of the two other melon species in Africa. Diversity levels within invasive populations of C. colocynthis were generally moderate at the two

123

123

Africa

0.0082 ± 0.0045

0.0037 ± 0.0024 0 0

Africa

Australia@

Europe and N. America$

Africa

1

1

1

1

0.0032 ± 0.0021

0.0075 ± 0.0042

0

Asia (M.E. and South)

Europe

1

0.0020 ± 0.0014

1

Australia

1

1

0.0050 ± 0.0031

0.0046 ± 0.0030

0 0.0055 ± 0.0033

0.891 ± 0.031

0

0

0.705 ± 0.070

0

0.254 ± 0.095

0.443 ± 0.060

0.852 ± 0.025

0.705 ± 0.070

0.667 ± 0.091

0 0.724 ± 0.049

– 0.745

20.700

–

1.892

0

0

0.852

–

5.445

0

20.035

0.0015 ± 0.0010

0.0014 ± 0.0010

0

0

0.0079 ± 0.0047

0

0.0009 ± 0.0008

0.0010 ± 0.0008

20.021 1.611

0.882

0.477

0.0010 ± 0.0009 0.0017 ± 0.0013

3.168

0 0.0008 ± 0.0007

2.848

20.299 1.844

– 3.914

0 1.150

Fs

p

D

p h

ycf6–psbM

G3pdh

0.493 ± 0.131

0

0

0.844 ± 0.102

0

0.220 ± 0.120

0.069 ± 0.063

0.480 ± 0.072

0.555 ± 0.090

0.400 ± 0.237

0 0.377 ± 0.181

h

21.366

0

0.510

–

–

0.750 0

– 20.339

1.822 0

20.720

2.711 21.183**

1.109

3.276

1.687

– 0.058

Fs

21.149

1.948

21.048

0 21.667*

D

Europe and N. America$ merged for analysis due to low sample size

Australia@ denotes additional samples from Tasmania were also represented at ycf6–psbM gene

- denotes parameters not calculated due to single haplotype and or allele presence

Haplotype diversity (h), nucleotide diversity (p) and standard deviation of estimate as per Nei (1987). Results of neutrality tests of D (Tajima 1989) and Fs (Fu 1997) as reported; significant values indicated in bold as: * (P \ 0.05); ** (P \ 0.001)

Cucumis myriocarpus

Citrullus colocynthis

Europe

N. America

1

1

Australia Asia (India)

1 1

Citrullus lanatus

Continent

Group

Species

Table 2 Summary of continental population genetic diversity (±SD) for Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus, at nuclear G3pdh and chloroplast ycf6–psbM genes

2480 R. S. Shaik et al.


2481

Table 3 Analysis of molecular variance (AMOVA) among and within continents at nuclear G3pdh and chloroplast ycf6–psbM genes sampled from Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus Species

Source of variation

% Var G3pdh

FST

Citrullus lanatus

Among continent

35.9

0.360***

Within continent

64

Among continent

50.6

Within continent

49.4

Among continent

51.3

Within continent

48.6

Citrullus colocynthis Cucumis myriocarpus

% Var ycf6–psbM

FST

45.4

0.455***

54.5 0.506***

69.2

0.692***

30.8 0.514***

78

0.781***

21.9

Partitioning of total genetic variance is denoted by % Var. Statistical significance indicated as *** P \ 0.0005, and fixation index (FST) as per Excoffier et al. (1992)

genes and similar between Asia and Australia; however, European samples were fixed for a single allele/ haplotype, likely due to the small sample size evaluated for that continent. Population neutrality tests using Tajima’s D and Fu’s Fs were not significant in most cases (Table 2), indicating little supportive evidence for selection and/or deviation from constant population size. Two exceptions to this occurred at ycf6–psbM. C. lanatus from India were significantly negative for Tajima’s D (D = -1.667, P = 0.029) but not at Fu’s Fs (Fs = 0.058, P = 0.396). As Fu’s Fs is considered a stronger test for departures from neutrality (Ramos-Onsins and Rozas 2002), we disregarded the significant outcome detected using Tajima’s D test. The C. colocynthis population in Australia was significantly negative at ycf6–psbM (Fs = 1.183, P = 0.007) indicating an excess of low frequency cpDNA polymorphisms in the population; however this may be a sample size artefact as there were only two haplotypes detected in Australia. Genetic structure analysis Analyses of molecular variance of the two genes (Table 3) provided strong evidence of significant (P \ 0.0005) geographic structure among continents for each of the three species. In each AMOVA, the ‘‘among continents’’ FST values were high and accounted for more than 35.0 % of total genetic variance in each dataset. The ‘‘within continents’’ component of total genetic variance was greatest (64.0 %) at the nuclear gene in C. lanatus and lowest (21.9 %) in the chloroplast gene for C. myriocarpus. For all other tests, the proportion of genetic variance attributed among and within continents was roughly

equal but with a marginal trend towards greater variance among continents. Pairwise FST estimates between continents for each gene and species generally indicated strong evidence of significant population structure among all invasive populations relative to native African samples (Table 4a–f). Australian populations of both Citrullus species were significantly different from other global populations (Table 4a–d). In C. lanatus this was likely due to the paucity of diversity present in Australia relative to that seen elsewhere (Tables 1, 2). In contrast, greater diversity in Australia relative to that of other invasive populations likely resulted in significant structure seen in C. colocynthis. C. lanatus populations in Europe, India and North America shared much of their diversity at the two genes (Table 1) and this was reflected by low and generally non-significant FST estimates observed among those regions (Table 4a, b). In C. myriocarpus, all invasive populations were fixed for the same nuclear allele and chloroplast haplotype, which is in marked contrast to the richer diversity found at these loci in Africa (Table 1). This resulted in the significant population structure observed between Africa and all invasive populations (Table 4e, f). Neighbour joining distance trees and network genealogy analyses Neighbour Joining distance analyses of the nuclear G3pdh gene (Fig. 1a) resolved each of the three species as highly supported ([92 % bootstrap value) monophyletic clades, with average levels of sequence difference among the species ranging from 1.6 to 12.6 % with no shared alleles among the species. In

123

2482

R. S. Shaik et al.

Table 4 Pairwise genetic differentiation (FST) estimates between populations of Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus at G3pdh and ycf6–psbM Population

Australia

Europe

N. America

Asia (India)

Africa

(a) Citrullus lanatus-G3pdh Australia

0

Europe

0.879***

N. America

0.663***

0.049

Asia (India)

0.732***

20.003

Africa

0.450***

Population

Australia

0 0

0.126** Europe

0.058

0

0.072**

0.062*

0

N. America

Asia (India)

Africa

(b) Citrullus lanatus-ycf6–psbM Australia

0

Europe

0.935***

N. America

0.730***

20.038

0

Asia (India)

0.897***

20.141

0.089

0

Africa

0.291***

0.042

0.364**

Population

0

0.276* Australia

Europe


0 Africa

(c) Citrullus colocynthis-G3pdh Australia

0

Europe

0.078


0.627***

0.800***

0

Africa

0.351***

0.476***

0.251***

Population

0

Australia


0 Africa

(d) Citrullus colocynthis-ycf6–psbM Australia

0


0.874***

0

Africa

0.416***

0.406***

0

Population

Australia

Europe and N. America

Africa

(e) Cucumis myriocarpus-G3pdh Australia

0


0

0

Africa

0.548***

0.343***

0

Population

Australia


Africa

(f) Cucumis myriocarpus-ycf6–psbM Australia

0


0

0

Africa

0.802***

0.629***

0

FST based on haplotype frequencies only. Significance estimates indicated as: * P \ 0.05, ** P \ 0.005, *** P \ 0.0005, from permutation (N = 10,000 replicates)

contrast, species relationships were only partially resolved at the cpDNA ycf6–psbM spacer region (Fig. 1b). At this gene region C. myriocarpus was

123

maximally supported (100 %) as monophyletic and [2.6 % different to the two Citrullus species. The two Citrullus species were poorly supported (\60 %) as


separate clades, and in one instance a C. lanatus specimen (ww09735) from Australia shared a haplotype (C6) prevalent among specimens of C. colocynthis. The 95 % probability parsimony networks constructed for each gene incorporated indels/gaps as 5th characters for analysis and allowed greater resolution of the genealogical relationships among native and invasive populations. The two Citrullus species resolved as a single joined network at both the nuclear and the chloroplast genes (Fig. 2a, b). The two species were reciprocally monophyletic and separated by ten base pairs (1.72 %) at the nuclear gene, but resolved at the chloroplast gene as a single shallow network with a single haplotype (C6) shared between the species. At both gene networks, C. myriocarpus was uniquely resolved as an independent network from the two Citrullus species (Fig. 2c, d). In the case of C. myriocarpus, greater diversity was observed in the nuclear network than in the chloroplast network. All Australian C. myriocarpus were fixed for single lineages at both genes, shared with Africa, Europe and North America at the nuclear gene (N25), but only with specimens from Europe and North America at the chloroplast gene (C11). All Australian C. lanatus shared a single nuclear allele (N1) that was also observed in Africa, Europe, North America and India; four nuclear alleles (N17, N19, N20* and N24) were observed among Australian C. colocynthis and these were geographically segregated between populations present in the eastern and western regions of Australia. The most frequently observed allele among Western Australian populations of C. colocynthis (N19) was also present in northern Africa [Algeria, Chad and Sudan, (Table S1)]; the high frequency allele observed in eastern Australia (N17) was present in Africa and Europe [specifically Morocco, Cyprus, Greece and Turkey (Table S1)]. Two low frequency nuclear alleles N20* and N24 were unique to Australia and were seen in western and eastern Australian populations, respectively, and were not observed in Africa or in any of the other invasive populations of C. colocynthis. Apart from haplotype C6, all Australian C. lanatus had a single chloroplast haplotype i.e. C1, which was also present in Africa, Europe, North America and India. Most Australian C. colocynthis had a single haplotype i.e. (C6). This haplotype was shared with populations in Africa and Europe as indicated above and was also present in one Australian specimen of C. lanatus.

2483

Haplotype C9 was unique to Australian C. colocynthis and occurred at a low frequency.

Discussion Population genetic diversity and pathways of introduction into Australia All three species exhibited high levels of sequence variation in their native range. In contrast, genetic diversity in invasive populations varied among species and geographical locations. For example, no diversity was present in C. lanatus and C. myriocarpus across Australia, similar to the reduced diversity observed in other invasive weeds such as Miconia calvescens DC in the Pacific (Le Roux et al. 2008), Aegilops triuncialis L. in North America (Meimberg et al. 2006) and Dolichandra unguis-cati (L.) L.G. Lohmann in Australia (Prentis et al. 2009). The reduced diversity observed in both C. lanatus and C. myriocarpus in Australia is in contrast to much higher levels of genetic diversity noted in their native range in Africa. This reduced diversity may potentially be attributed either to entry by a small number of viable propagules of each weed into Australia (founder effect), or loss of diversity through sustained reductions in effective population size (bottle-neck effect) following the entry and establishment of these species (Meimberg et al. 2006). Citrullus lanatus and C. myriocarpus appear to exist as genetically homogeneous populations throughout Australia, and hence it is likely each was introduced from single source populations, and as single introduction events. In the case of C. myriocarpus, all invasive populations across the globe share the same nuclear allele and chloroplast haplotype. This is in contrast to the richer diversity found within the species in its native distribution in Africa, which suggests a shared or similar pathway of invasive colonisation by C. myriocarpus across the globe, whereby all invasive populations were derived either independently from a single source, or derived incrementally as a series of stepping stone founding events between continents. Surprisingly, the single chloroplast haplotype fixed in all invasive populations was not detected among any of the sampled populations in Africa. This likely indicates that our sampling of this species was insufficient to pinpoint the putative native source of invasive C. myriocarpus.

123

2484

R. S. Shaik et al. N7*- Africa

97

a

84

N10*- Africa N3- Africa N11*- Africa N5- Africa, N. America N13*- Africa

87

N14*- Africa

N1- Australia, N. America, Africa, Asia (N.W. India), Europe N8*- Africa

94

N9- Africa N16- Africa N15- Africa

74

N12*- Asia (India)

76

N2- Asia (India), Europe, S. America, N. America

74

N4- Asia (India), Africa, N. America, Europe

75

N6*- N.America N22*- Asia (S. Asia) N18- Africa, Asia (M.E. Asia)# 93

N17- E. Australia@, Africa, Europe

70 77

87

N20*- Australia N24- Australia N19- W. Australia, Africa

94

N21*- Africa N23*- B and T WS* (commerical collection) N32- Africa

98

N33- Africa N28- Africa

100

N30- Africa

73

N25- Australia, Africa, N. America, Europe

75

N29- Africa N26- Africa N27- Africa N31- Africa

0.02

b

C2- N. America, Asia (India), Europe, Africa C5*- Asia (India) C4*- Africa C3- S. America C1- Australia, Africa, N. America, Europe, Asia (India including N.W. India) C9- Australia (C6)- Australia, Africa, Europe, B & T WS (commercial collection) C10*- Asia (S. Asia) C7- Asia (M.E. Asia)#, Africa C8- Africa C13- Africa C14- Africa

100

C12- Africa

84 98

C11- Australia, N. America, Europe C15- Africa

0.02

123

Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus (Cucurbitaceae) in Australia b Fig. 1 a Unrooted neighbour joining tree showing the relation-

ship within and between alleles of Citrullus lanatus (N1–N16), Citrullus colocynthis (N17–N24) and Cucumis myriocarpus (N25–N33), at nuclear G3pdh region (with pairwise deletion option). The boot strap support values from 10,000 replications are indicated at the nodes. The scale bar equals a genetic difference of two percent. Filled square Australian Citrullus lanatus. Filled circle Australian Citrullus colocynthis. Filled triangle represents the position of Australian Cucumis myriocarpus; the equivalent unshaded symbols represent non-Australian alleles. W. Australia represents Western Australia excluding the Kimberley region. E. Australia@ represents eastern Australian states and the Kimberley region of Western Australia. Nuclear alleles N6*, N7*, N8*, N10*, N11*, N12*, N13*, N14*, N20*, N21*, N22* and N23* were downloaded from GenBank accessions and not present in other samples used in this study. M. E. Asia# indicates Afghanistan, Iran, Iraq and Israel. B and TWS indicates commercial sample from unknown location provided by B and T World Seeds Co. via GenBank. b Unrooted neighbour joining tree showing relationships among chloroplast ycf6–psbM gene region haplotypes identified for Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus. Indels and missing sites were excluded using the pairwise deletion option. The bootstrap supports ([70 %) estimated from 10,000 replications are indicated at the nodes. The scale bar equals a genetic difference of two percent. Tree tip labels indicate haplotype designation (C1–C15) and continents where they were observed. Squares, circles and triangles indicate Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus, respectively. Shaded symbols indicate haplotype(s) identified in Australia. Haplotypes C5*, C4* and C10* downloaded from GenBank accessions and not present in other samples used in this study. (C6) indicates shared haplotype between Citrullus lanatus and Citrullus colocynthis. M. E. Asia# indicates Afghanistan, Iran, Iraq, Israel. B and TWS (commercial collection) indicates sample from unknown location provided by B and T World Seeds Co. from GenBank

Australian C. lanatus are also genetically depauperate at the two genes examined, which is in contrast to all other invasive populations of C. lanatus where moderate to high levels of diversity at both the chloroplast and nuclear genes was observed. Entry of this species to Australia was likely independent of introductions of the species elsewhere across the globe. Support for this contention is provided by the pairwise analyses of population differentiation for this species which indicates a genetically homogenous population structure present among European, Asian and North American samples that is significantly different to that found in Australia. Historical evidence based on available records suggests that C. lanatus was probably introduced into Australia from the northwestern region of the Indian subcontinent (Barker 1964) during the camel trade in the mid 1800s (Parsons and Cuthbertson 2001). Although our genetic

2485

evidence does not discount this view, the genetically depauperate Australian populations contain a genetic profile shared with specimens present in India and elsewhere. Therefore, it is not possible using results from the gene markers examined to determine if C. lanatus was introduced into Australia indirectly from India, or directly from Africa as hypothesized by Dane and Liu (2007). The high level of diversity in C. lanatus in Africa observed by Dane and Liu (2007) led them to propose that southern Africa (Swaziland) was likely the primary source for the global introductions of C. lanatus. The work presented here confirms the high levels of diversity observed in Africa relative to all other populations of the species. In contrast to C. lanatus and C. myriocarpus, relatively greater allelic and haplotype diversity was present within the Australian populations of C. colocynthis. This diversity was mainly distributed as two nuclear allele groups partially sorted by geography, with one group found mostly in western regions of Australia and the other group distributed across eastern and northern regions, with both partially overlapping in central Australia. Consequently, we propose that the introduction of C. colocynthis to Australia may have occurred as two separate events, from different source populations. Specimen haplotype and allele identities (Table S1) indicate the western group in Australia may have been introduced from northern Africa (Algeria, Chad and Sudan), whereas the other group prevalent in eastern Australia may have been sourced directly from Morocco or through a secondary introduction from populations present in Southern Europe (Greece, Cyprus) and Turkey. This view is partly supported by the earlier work by Dane et al. (2007), which indicated Australian C. colocynthis was most likely introduced from Morocco. Sampling of Australian specimens by Dane et al. (2007) was likely insufficient to detect the western allelic group detected in our study. It is possible that the two allelic groups in Australia could have been introduced by a single introduction event from a mixed population from northern Africa but evidence for partial geographic sorting of the alleles in Australia is not supportive of this hypothesis. Evidence of a shared chloroplast haplotype between C. colocynthis and C. lanatus in Australia One novel result emerging from this study was evidence of a shared chloroplast haplotype between

123

2486 Fig. 2 Haplotype (ycf6– psbM) and allele (G3pdh) 95 % parsimony networks (Clements 2000) identified for Citrullus lanatus and Citrullus colocynthis ycf6– psbM (a), G3pdh (b); Cucumis myriocarpus ycf6– psbM (c) and G3pdh (d). Indels included here as a 5th character in analyses. Haplotypes and alleles represented by circles and labelled as per Table 1. The size of the circle denotes the relative allele frequency (G3pdh) and haplotype frequency (ycf6–psbM). The most recent common ancestor in each network is indicated by an enclosed square. Connecting lines indicate a single mutation; cross bars on the connecting lines indicate additional mutations. B and T WS indicates commercial sample from unknown location provided by B and T World seeds Co. via GenBank. Alleles/ haplotypes with a * were accessed from GenBank and were unsampled in this study; samples with # indicates Afghanistan, Iran, Iraq and Israel

R. S. Shaik et al.

Citrullus lanatus

a

C5* C8

C7

C4*

C2 C3

C10* C6 1

C9

C1


b

N20*

N17

N24

N4

N15

N2

N16

N21*


N6*

N19 N23*

N18

N9

N12*

Citrullus lanatus N5

N13*

N1

N14*

N22* N7*

N10*

N3

N8* N11*

c

d

N26 N25

C12

C15

N30

N29

C14

N28

C11

N32

C13

123

N27

N33

N31


the two species of Citrullus. This was observed in one specimen (ww09735) sampled from Norseman, Western Australia (Table S1) which was identified by morphology and nuclear gene analyses as C. lanatus, but contained a chloroplast haplotype (C6) absent from all other C. lanatus but prevalent among C. colocynthis specimens in Australia and elsewhere (Table 1; Table S1). The presence of a shared haplotype between the two Citrullus species may signal incomplete lineage sorting, which occurs where there is a random assortment of ancestral shared alleles between sister species after a speciation event (Rautenberg et al. 2010). Average sequence difference between the two species examined here was 1.72 and 0.05 % at the nuclear and chloroplast genes, respectively, indicating the very close relationship between the two species, particularly at the assayed chloroplast gene. As presented in the network analysis (Fig. 2b), the shared chloroplast haplotype (C6) was prevalent in greater frequency among C. colocynthis in most of the continental populations. It is not without precedent for a high frequency haplotype to be retained and shared among recently diverged sister species (Roe and Sperling 2007). Alternatively, the sharing of the chloroplast haplotype between two closely related Citrullus species may have occurred by hybridisation or introgression between the species mediated either by pollen or seed gene flow, and potentially involved pollen exchange from one species to another (Rieseberg 1997; Roe and Sperling 2007). Therefore if the specimen is representative of a hybrid, it is likely a product of pollen exchange from C. lanatus to C. colocynthis (Singh 1978). This remains to be investigated in future research evaluating potential for hybridisation among these species under field conditions.

2487

strategies such as phenotypic plasticity (Geng et al. 2007), local adaptation (Eriksen et al. 2012), and by taking advantage of higher resource availability and lower herbivory/pathogen rates in an invasive range (Hinz et al. 2012). In addition, stabilising selection and preadaptation (Dlugosch and Parker 2007) and allelopathy (Hao et al. 2007; Harrison et al. 2012; Yu et al. 2000), may assist in plant invasions (Hinz et al. 2012; Vergeer and Kunin 2013). Future research focused on these areas may be useful to determine the key factors assisting in invasions of these species in Australia. Potential role of breeding system on plant invasion Self-pollination is reported to better support invasion success in plant invaders than other pollination systems (Pysˇek et al. 2010). Reduced or limited genetic diversity along with a self-fertilizing breeding system is also evident in the case of the invasive weeds Miconia calvescens, Aegilops triuncialis and Dolichandra unguis-cati (Le Roux et al. 2008; Meimberg et al. 2006; Prentis et al. 2009). Cucurbits are generally out-crossers, however self-fertilization is reported in C. lanatus (Kumar et al. 2013), C. colocynthis (Dane et al. 2007), and Cucumis melo subsp. agrestis (Naudin) Pangalo (Kouonon et al. 2009). In cucurbits, self-pollination has been reported to occur without inbreeding depression (Allard 1999; Dane et al. 2007). This inbreeding capability in isolated plants and populations in combination with phenotypic plasticity may contribute to the invasive potential of less genetically diverse populations (Meimberg et al. 2006; Shaik et al. 2011) and may support the invasion success of these three melons in Australia. Implications for weed management

Likely reasons for invasion success of C. lanatus and C. myriocarpus in Australia Populations of these three invasive species in Australia are genetically depauperate. This in contrary to the expectation that introduced populations with reduced genetic diversity will have lowered fitness and consequently reduced competitiveness to other species (Lynch et al. 1995). This paradox has been observed in a number of other invasive species (Meimberg et al. 2006). Less diverse weed populations can persist in novel environments by exploiting

Our findings indicate invasive populations of C. lanatus and C. myriocarpus in Australia are genetically depauperate and thus may respond similarly to applied management methods or control agents. It is hypothesized that weed species with limited genetic diversity are more vulnerable to pests and diseases and hence liable to mitigation by use of specific biological controls (Burdon and Marshall 1981). In contrast, C. colocynthis in Australia shows greater genetic diversity, likely due to its introduction to Australia on at least two separate occasions from genetically

123

2488

distinct populations. C. colocynthis populations in Australia may subsequently have varied responses to conventional and bio-control measures (Goolsby et al. 2006) and possibly present greater challenges for mitigation (Ward et al. 2008) and biocontrol due to its genetic diversity, perennial life cycle and persistent underground root stock (Burrows and Shaik 2014). Our findings related to the biology and genetics of these three species may therefore have implications for the management of these weeds in agricultural settings as well as conservation of biodiversity in Australian landscapes. Acknowledgments We thank Tiffany Fields (United States Department of Agriculture, Georgia) and Kathleen Reitsema (United States Department of Agriculture, Iowa) for providing seed material used in this study. Herbarium material was kindly provided by Fred Hrusa (Herbarium, California Department of Food and Agriculture), Susanne Renner (Herbarium, Botanische Staatssammlung Mu¨nchen), Jan Wieringa (Nationaal Herbarium Nederland,Wageningen University branch, Wageningen University) and the curators and staff of the Natural History Museum Herbarium, London; National Herbarium of Victoria, Northern Territory Herbarium, State Herbarium of South Australia, Tasmanian Herbarium and the Western Australian Herbarium. We also thank numerous Australian colleagues who personally collected plant material used in this study. Prof. Fenny Dane, University of Auburn, kindly provided information on PCR protocols. We thank Mr Craig Poynter at Spatial Data Analysis Network, CSU, Wagga Wagga for help with sample distribution map preparation. We acknowledge the financial support provided by the Graham Centre for Agricultural Innovation through a New Research Initiative Grant and for a research fellowship for RSS.

References Allard RW (1999) Principles of plant breeding, 2nd edn. Wiley, New York Barker HM (1964) Camels and the outback. Sir Isaac Pitman & Sons Ltd., Melbourne Burdon JJ, Marshall DR (1981) Biological control and the reproductive mode of weeds. J Appl Ecol 18:649–658 Burrows GE, Shaik RS (2014) Comparative developmental anatomy of the taproot of the cucurbitaceous vines Citrullus colocynthis (perennial), Citrullus lanatus (annual) and Cucumis myriocarpus (annual). Aust J Bot 62:537–545. doi:10.1071/BT14124 Clark L, Evans K, Jasieniuk M (2013) Origins and distribution of invasive Rubus fruticosus L. agg. (Rosaceae) clones in the Western United States. Biol Invasions 15:1331–1342. doi:10.1007/s10530-012-0369-8 Clement M, Posada DCKA, Crandall KA (2000) TCS: a computer program to estimate gene genealogies. Mol Ecol 9:1657–1659

123

R. S. Shaik et al. Dane F, Liu J (2007) Diversity and origin of cultivated and citron type watermelon (Citrullus lanatus). Genet Resour Crop Evol 54:1255–1265. doi:10.1007/s10722-006-91073 Dane F, Liu J, Zhang C (2007) Phylogeography of the bitter apple, Citrullus colocynthis. Genet Resour Crop Evol 54:327–336. doi:10.1007/s10722-005-4897-2 Dlugosch KM, Parker IM (2007) Molecular and quantitative trait variation across the native range of the invasive species Hypericum canariense: evidence for ancient patterns of colonization via pre-adaptation? Mol Ecol 16:4269–4283. doi:10.1111/j.1365-294X.2007.03508.x Ellstrand NC, Schierenbeck KA (2000) Hybridization as a stimulus for the evolution of invasiveness in plants? Proc Natl Acad Sci USA 97:7043–7050 Elorza MS, Bernardo FG, Oliva´n AS, Iglesias LPG (2011) Invasiveness of alien vascular plants in six arid zones of Europe, Africa and America. Lazaroa 31:109–126 Eriksen RL, Desronvil T, Hierro JL, Kesseli R (2012) Morphological differentiation in a common garden experiment among native and non-native specimens of the invasive weed yellow starthistle (Centaurea solstitialis). Biol Invasions 14:1459–1467. doi:10.1007/s10530-012-0172-6 Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564–567. doi:10.1111/j.1755-0998.2010.02847.x Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131:479–491 Fu YX (1997) Statistical tests of neutrality of mutations against population growth, hitch-hiking, and background selection. Genetics 147:915–925 Gallagher RV, Leishman MR, Miller JT, Hui C, Richardson DM, Suda J, Tra´vnı´cˇek P (2011) Invasiveness in introduced Australian acacias: the role of species traits and genome size. Divers Distrib 17:884–897. doi:10.1111/j.1472-4642. 2011.00805.x GBIF (2011a) Species: Citrullus colocynthis (L.) Schrad. http:// data.gbif.org/species/2874622/. Accessed 20 Feb 2014 GBIF (2011b) Species: Citrullus lanatus (Thunb.) Matsum. & Nakai. http://data.gbif.org/species/2874621/. Accessed 25 Feb 2014 GBIF (2011c) Species: Cucumis myriocarpus E. Mey. ex Naudin http://data.gbif.org/species/2874575/. Accessed 25 Feb 2014 Geng Y-P et al (2007) Phenotypic plasticity rather than locally adapted ecotypes allows the invasive alligator weed to colonize a wide range of habitats. Biol Invasions 9:245–256. doi:10.1007/s10530-006-9029-1 Goolsby JA, De Barro PJ, Makinson JR, Pemberton RW, Hartley DM, Frohlich DR (2006) Matching the origin of an invasive weed for selection of a herbivore haplotype for a biological control programme. Mol Ecol 15:287–297. doi:10.1111/j.1365-294X.2005.02788.x Gopurenko D, Fletcher MJ, Lo¨cker H, Mitchell A (2013) Morphological and DNA barcode species identifications of leafhoppers, planthoppers and treehoppers (Hemiptera: Auchenorrhyncha) at Barrow island. Records of the western Australian museum, supplement 83: the terrestrial

Citrullus lanatus, Citrullus colocynthis and Cucumis myriocarpus (Cucurbitaceae) in Australia invertebrate fauna of Barrow island, western Australia. Western Australian Museum Publications, Perth, pp 253–285 Hao ZP, Wang Q, Christie P, Li XL (2007) Allelopathic potential of watermelon tissues and root exudates. Sci Hortic (Amst) 112:315–320. doi:10.1016/j.scienta.2006.12.030 Harris CJ, Murray BR, Hose GC, Hamilton MA (2007) Introduction history and invasion success in exotic vines introduced to Australia. Divers Distrib 13:467–475. doi:10. 1111/j.1472-4642.2007.00375.x Harrison HF Jr, Wechter PW, Kousik CS (2012) Inhibition of bacterial, fungal, and plant growth by testae extracts of Citrullus genotypes. Hort Sci 47:448–451 Heinze B (2007) A database of PCR primers for the chloroplast genomes of higher plants. Plant Methods 3(4). doi:10. 1186/1746-4811-3-4 Hickman JC (1993) The Jepson manual: higher plants of California. University of California Press, Berkeley Hinz HL, Schwarzla¨nder M, McKenney JL, Cripps MG, Harmon B, Price WJ (2012) Biogeographical comparison of the invasive Lepidium draba in its native, expanded and introduced ranges. Biol Invasions 14:1999–2016. doi:10. 1007/s10530-012-0207-z Hornoy B, Atlan A, Roussel V, Buckley YM, Tarayre M (2013) Two colonisation stages generate two different patterns of genetic diversity within native and invasive ranges of Ulex europaeus. Heredity 111:355–363. doi:10.1038/hdy.2013.53 Huffaker CB, Kennett CE (1959) A ten-year study of vegetational changes associated with biological control of klamath weed. J Range Manag 12:69–82 Jakobs G, Weber E, Edwards PJ (2004) Introduced plants of the invasive Solidago gigantea (Asteraceae) are larger and grow denser than conspecifics in the native range. Divers Distrib 10:11–19. doi:10.1111/j.1472-4642.2004.00052.x Kelager A, Pedersen J, Bruun H (2013) Multiple introductions and no loss of genetic diversity: invasion history of Japanese Rose, Rosa rugosa, in Europe. Biol Invasions 15:1125–1141. doi:10.1007/s10530-012-0356-0 Kouonon LC, Jacquemart A-L, Bi AIZ, Bertin P, Baudoin J-P, Dje Y (2009) Reproductive biology of the andromonoecious Cucumis melo subsp. agrestis (Cucurbitaceae). Ann Bot 104:1129–1139 Kumar R, Dia M, Wehner TC (2013) Implications of mating behavior in watermelon breeding. Hort Sci 48:960–964 Le Roux JJ, Wieczorek AM, Meyer JY (2008) Genetic diversity and structure of the invasive tree Miconia calvescens in Pacific islands. Divers Distrib 14:935–948. doi:10.1111/j. 1472-4642.2008.00504.x Le Roux JJ, Brown GK, Byrne M, Ndlovu J, Richardson DM, Thompson GD, Wilson JRU (2011) Phylogeographic consequences of different introduction histories of invasive Australian Acacia species and Paraserianthes lophantha (Fabaceae) in South Africa. Divers Distrib 17:861–871. doi:10.1111/j.1472-4642.2011.00784.x Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–1452. doi:10.1093/bioinformatics/btp187 Lynch M, Conery J, Burger R (1995) Mutational meltdowns in sexual populations. Evolution 49:1067–1080. doi:10.2307/ 2410432

2489

Martin TG, Campbell S, Grounds S (2006) Weeds of Australian rangelands. Rangel J 28:3–26. doi:10.1071/RJ06017 Meimberg H, Hammond JI, Jorgensen CM, Park TW, Gerlach JD, Rice KJ, McKay JK (2006) Molecular evidence for an extreme genetic bottleneck during introduction of an invading grass to California. Biol Invasions 8:1355–1366 Meyerson L, Cronin J (2013) Evidence for multiple introductions of Phragmites australis to North America: detection of a new non-native haplotype. Biol Invasions 15:2605–2608. doi:10.1007/s10530-013-0491-2 Michael DR, Lindenmayer DB, Cunningham RB (2010a) Managing rock outcrops to improve biodiversity conservation in Australian agricultural landscapes. Ecol Manag Restor 11:43–50. doi:10.1111/j.1442-8903.2010.00512.x Michael PJ, Borger CP, MacLeod WJ, Payne PL (2010b) Occurrence of summer fallow weeds within the grain belt region of southwestern Australia. Weed Technol 24:562–568. doi:10.1614/wt-d-09-00060.1 Miller JM, Schlising RL (2013) Citrullus, in Jepson flora project (eds.) Jepson e flora. http://ucjeps.berkeley.edu/cgi-bin/ get_IJM.pl?tid=56575. Accessed 06 June 2014 Ndlovu J, Richardson DM, Wilson JRU, O’Leary M, Le Roux JJ (2013) Elucidating the native sources of an invasive tree species, Acacia pycnantha, reveals unexpected native range diversity and structure. Ann Bot 111:895–904. doi:10.1093/aob/mct057 Nei M (1987) Molecular evolutionary genetics. Columbia University Press, New York Novak SJ, Mack RN (2001) Tracing plant introduction and spread: genetic evidence from Bromus tectorum (cheatgrass). Bioscience 51:114–122 Parsons WT, Cuthbertson EG (2001) Noxious weeds of Australia, 2nd edn. CSIRO Publishing, Collingwood Prentis PJ, Pavasovic A (2013) Understanding the genetic basis of invasiveness. Mol Ecol 22:2366–2368. doi:10.1111/ mec.12277 Prentis PJ, Wilson JRU, Dormontt EE, Richardson DM, Lowe AJ (2008) Adaptive evolution in invasive species. Trends Plant Sci 13:288–294. doi:10.1016/j.tplants.2008.03.004 Prentis PJ, Sigg DP, Raghu S, Dhileepan K, Pavasovic A, Lowe AJ (2009) Understanding invasion history: genetic structure and diversity of two globally invasive plants and implications for their management. Divers Distrib 15:822–830. doi:10.1111/j.1472-4642.2009.00592.x Pysˇek P et al (2010) Successful invaders co-opt pollinators of native flora and accumulate insect pollinators with increasing residence time. Ecol Monogr 81:277–293. doi:10. 1890/10-0630.1 Ramirez AHM, Jhala AJ, Singh M (2014) Factors affecting germination of citronmelon (Citrullus lanatus var. citroides). Weed Sci 62:45–50. doi:10.1614/WS-D-1300041.1 Ramos-Onsins SE, Rozas J (2002) Statistical properties of new neutrality tests against population growth. Mol Biol Evol 19:2092–2100 Rautenberg A, Hathaway L, Oxelman B, Prentice HC (2010) Geographic and phylogenetic patterns in Silene section Melandrium (Caryophyllaceae) as inferred from chloroplast and nuclear DNA sequences. Mol Phylogenet Evol 57:978–991. doi:10.1016/j.ympev.2010.08.003

123

2490 Rieseberg LH (1997) Hybrid origins of plant species. Annu Rev Ecol Syst 28:359–389. doi:10.1146/annurev.ecolsys.28.1. 359 Roe AD, Sperling FAH (2007) Population structure and species boundary delimitation of cryptic Dioryctria moths: an integrative approach. Mol Ecol 16:3617–3633. doi:10.1111/ j.1365-294X.2007.03412.x Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Sexton JP, McKay JK, Sala A (2002) Plasticity and genetic diversity may allow salt cedar to invade cold climates in north America. Ecol Appl 12:1652–1660. Shaik RS, Weston LA, Burrows G, Gopurenko D (2011) A comparative phenological and genetic diversity analysis of two invasive weeds, camel melon (Citrullus lanatus (Thunb.) Matsum. and Nakai var. lanatus) and prickly paddy melon (Cucumis myriocarpus L.), in inland Australia. In: Adkins S (ed) 23rd Asian-Pacific Weed Science Society Conference, The Sebel Cairns, Cairns, Queensland, Australia, 26–29 September 2011, pp 510–518 Shaik RS, Gopurenko D, Burrows GE, Urwin NAR, Lepschi BJ, Hildebrand SM, Weston LA (2012) Identification of the invasive weeds, camel melon, prickly paddy melon and colocynth in Australia—a morphological and molecular approach. In: Eldershaw V (ed) 18th Australasian weeds conference, The Sebel and Citigate Albert Park, Melbourne, Victoria, Australia, 8–11 October 2012. Developing solutions to evolving weed problems. Weed Science Society of Victoria Inc., Frankston, Australia, pp 73–77 Simberloff D (2009) The role of propagule pressure in biological invasions. Ann Rev Ecol Evol Syst 40:81–102. doi:10.1146/annurev.ecolsys.110308.120304

123

R. S. Shaik et al. Singh A (1978) Cytogenetics of semi-arid plants: 3. A natural interspecific hybrid of Cucurbitaceae (Citrullus colocynthis Schrad x C. vulgaris Schrad). Cytologia 43:569–574 Stricker BK, Stiling P (2013) Seedlings of the introduced invasive shrub Eugenia uniflora (Myrtaceae) outperform those of its native and introduced non-invasive congeners in Florida. Biol Invasions 15:1973–1987. doi:10.1007/ s10530-013-0425-z Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585–595 Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. doi:10.1093/molbev/ mst197 Vergeer P, Kunin WE (2013) Adaptation at range margins: common garden trials and the performance of Arabidopsis lyrata across its northwestern European range. New Phytol 197:989–1001. doi:10.1111/nph.12060 Villesen P (2007) FaBox: an online toolbox for fasta sequences. Mol Ecol Notes 7:965–968. doi:10.1111/j.1471-8286.2007. 01821.x Ward SM, Reid SD, Harrington J, Sutton J, Beck KG (2008) Genetic variation in invasive populations of yellow toadflax (Linaria vulgaris) in the western United States. Weed Sci 56:394–399. doi:10.1614/ws-07-157.1 Williams PA, Randall R (2002) How weedy are plants recently naturalised in New Zealand? NZ Plant Prot 55:432 Yu JQ, Shou SY, Qian YR, Zhu ZJ, Hu WH (2000) Autotoxic potential of cucurbit crops. Plant Soil 223:149–153. doi:10. 1023/A:1004829512147