BIOLOGY OF REPRODUCTION 55, 47-53 (1996)
Porcine SRY Gene Locus and Genital Ridge Expression' I. Daneau, J-F. Ethier, J.G. Lussier, and D.W. Silversides2 Centre de Recherche en Reproduction Animale, Department of Veterinary Biomedicine, Faculty of Veterinary Medicine, University of Montreal, St.-Hyacinthe, Qu6bec, Canada J2S 7C6 has been studied biochemically and has been shown to recognize the specific DNA sequence (A/T)AACAAT [8], to cause bending of DNA by binding within the minor groove [9, 10], and to contain a nuclear translocation signal [11]. Homology to SRY HMG box sequences has defined a new family of HMG box genes named SRY box-related genes (SOX genes [6]). SOX genes represent nuclear proteins that can be expressed developmentally and/or can, in the adult, contain transcriptional activation domains but (with the possible exception of Sox9) do not appear to be involved in sex determination [12, 13]. Further studies of SRY/Sry have revealed surprises. For a key molecule in the developmentally important process of mammalian sex determination, it seemed reasonable to assume that there would be highly conserved sequence homologies between mammalian species; experimentally this was found not to be the case [6, 14]. Although HMG box sequences of SRY are reasonably conserved between the mammalian species studied to date, sequences outside the HMG box display a notable lack of sequence conservation. In mouse Sry, the coding sequence to the HMG box domain is extensive; it encodes a His/Gin-rich putative transcriptional activation domain that is seen in other HMG box proteins and steroid hormone receptors but is notably lacking in the human and bovine SRY molecules. Even between closely related species of primates, sequence comparisons outside the HMG box indicate active mutational change [14], and similar findings have been shown between mouse species [15]. Structurally the mouse Sry gene locus is unusual in that it contains large flanking inverted repeat sequences [16], a feature not shared with the human SRY gene locus. Furthermore, evolutionary studies of different mouse species have revealed that the single copy gene seen in the laboratory mouse is by no means the rule; multiple copies of Sry have now been described in Old World mouse populations and in the rat [17]. Thus mouse Sry gene, like mouse zinc finger Y gene [18], can exist in one or two copies depending on the strain. Studies of mammalian sex determination are hampered by a lack of experimental model systems besides the mouse, and structural and functional comparisons of the SRY gene from additional eutherian mammalian species are now required. Conventional cloning of the SRY from other species has been hindered by the lack of sequence homology outside the HMG box region and also by the presence of SOX genes [6]. We and others have recently cloned and characterized the bovine SRY gene [19-21]. We have provided preliminary reports of cloning 1.6 kb of porcine SRY genomic locus including the complete open reading frame (ORF) [19], while Ge et al. [22] have recently reported 155 bp of porcine SRY sequence located within the HMG box.
ABSTRACT Porcine SRY gene locus was cloned through use of a strategy of anchored polymerase chain reaction (PCR) amplification from a male pig genomic DNA size-selected library constructed in a plasmid vector as well as 3' reverse transcription (RT)-PCR amplification of porcine genital ridge SRYtranscripts. In total, 1664 bp of genomic DNA and 106 bp of 3' cDNA are presented. The open reading frame of porcine SRY consists of 624 bp representing 208 amino acids (aa) with a centrally located HMG box domain of 79 aa, an amino-terminal region of 59 aa, and a carboxy terminal of 70 aa. Structurally, porcine SRY resembles human and bovine SRY more closely than it does mouse Sry, and it lacks the carboxy-terminal activation domain seen in the mouse Sry molecule. Similar to human and bovine testicular SRY transcripts, the porcine SRY genital ridge transcript has a relatively short 3' untranslated region (UTR), in contrast to the extended UTR of the mouse genital ridge Sry transcript. The porcine SRY gene is expressed within the cells of the genital ridge of the developing male pig embryo between Days 21 and 26 (e21-e26) of gestation, during which time the primitive gonads are bipotential, but not on Day e31, by which time male testis determination is histologically evident. INTRODUCTION Our current understanding of the mechanisms of mammalian sex determination has been shaped by three seminal observations. First, when gonads were surgically removed from embryonic rabbits, the female phenotype resulted regardless of genotype; thus testicles were equated with the male phenotype [1, 2]. Secondly, evidence from karyotype analysis in humans correlated the Y chromosome with the male phenotype [3]: males are heterogametic (XY) while females are homogametic (XX). These findings led to the proposal that a genetic locus, the "testis-determining factor" (TDF), is present on the Y chromosome. Thirdly, in 1990, a candidate gene for TDF, namely, sex-determining region Y gene (SRY in humans, Sry in mice), was described in humans, rabbits, and mice [4, 5]. Evidence from mutational analysis of sex-reversed patients in the human population and the patterns of natural and transgenic expression in the mouse have provided strong evidence that SRY is the TDF, i.e., the genetic developmental switch for the male phenotype in mammals (for reviews see [6, 7]). Structurally the SRY gene consists of a small, intronless gene coding for a protein containing a centrally located "high mobility group" domain or HMG box. The HMG box shows sequence conservation with a functionally diverse group of nuclear proteins including DNA-binding and transcriptional activation proteins. The HMG box of SRY Accepted February 26, 1996. Received December 22, 1995. 'Funding provided by NSERC Canada, Agriculture Canada, and Ontario Pork. The porcine SRY gene sequences reported herein have been submitted to Genbank and given the accession number U49860. 2Correspondence. FAX: (514) 778-8301; e-mail:
[email protected]
MATERIALS AND METHODS Southern Analysis Genomic DNA was derived from white blood cells of commercial crossbred male pigs with use of procedures that 47
48
DANEAU ET AL.
included SDS lysis and proteinase K digestion followed by phenol and phenol-chloroform extractions and ethanol precipitation [23]. Ten micrograms of genomic DNA was digested with a selection of restriction enzymes (see Fig. 1), size-fractionated via electrophoresis on a 0.8% agarose gel, and transferred to a nylon membrane (Hybond N; Amersham, Arlington Heights, IL). A digoxigenin-labeled probe was prepared by means of a 523-bp bovine genomic SRY fragment (bSRY.G8; [20]) and a commercially available labeling kit (DIG DNA labeling kit; Boehringer-Mannheim, Montreal, PQ, Canada) used according to the manufacturer's instructions. The membrane was hybridized overnight at 55°C, and washes were performed at a final stringency of 55°C in 0.1% SDS, 0.1% saline-sodium citrate [23]. Hybridizing bands were visualized via digoxigenin detection protocols using lumigen/2,5-diphenyl-1,3,4-oxadiazole reagent as substrate (Boehringer-Mannheim) and after exposure of the membrane to photographic film (XAR-2; Eastman Kodak, Rochester, NY). EcoRI digestion resulted in a hybridizing band of about 1.7 kb, and it was this band that was targeted for cloning. Genomic Cloning Genomic cloning of porcine SRY was performed with use of a method similar to that previously described for the cloning of bovine SRY locus [20]. A preparative EcoRI digestion of 120 jLg of porcine genomic DNA was size-fractionated on a 0.8% agarose gel; the bands between 1.5 kb and 2.0 kb were cut from the gel and purified through use of a glass bead protocol (Prep-a-gene; Pharmacia and Upjohn Inc., Kalamazoo, MI). This fragment was ligated into EcoRI-digested, dephosphorylated Bluescript KS(-) plasmid (Stratagene, La Jolla, CA) with use of T4 DNA ligase (Pharmacia). To clone the 3' flank of the porcine SRY gene locus, an initial polymerase chain reaction (PCR) amplification was performed on a fraction of the ligated material using the heterologous sense primer D (5'-AGATCAGCAAGCAGCTGGGA) and the anchored primer T7 (5'-TAATCGACTCACTATAGGG) and 40 cycles of the following thermal cycling conditions: denaturation at 95°C for 40 sec, annealing at 55°C for 40 sec, and elongation at 72°C for 2 min. Thermal cycling was performed with use of Taq polymerase (Amplitaq; Perkin-Elmer, Irvine, CA) and was initiated with a hot start procedure. One microliter of this reaction was used to initiate a second amplification employing the internal, heterologous sense primer F2 (5'GCCGCGAGATGGCCATTCTTCCAGGAGGG), the anchored primer T7, and a similar PCR cycling profile. An amplified band of about 700 bp was identified and cloned into the plasmid vector pGEM-T (Promega, Madison, WI). Recombinant plasmids were transfected into bacteria (XL1Blue; Stratagene) via the rubidium chloride method [23]. Sequencing was performed on positive clones via the dideoxy chain termination method using 3 5S-dCTP nucleotide (Amersham) and a commercial sequencing kit (T7 sequencing kit; Pharmacia). Three independently isolated bacterial clones were sequenced, and the reported sequence (see Fig. 3) represents the consensus sequence. Cloning of the 5' flank of the porcine SRY gene locus was performed in a similar fashion with use of the heterologous antisense primers 5 (5'-ATAGCCCGGGTATTTGTCTC) and 6 (5'-TAGTAGTCTCTGTGCCTCC), the anchored primer T3 (5'AATTAACCCTCACTAAAGGGAA), and a PCR cycling profile as described above.
Developmental Trial Arrangements were made with local pig producers (see Acknowledgments) to procure pregnant sows of known gestation intervals; pig embryos of embryonic ages 21 days (e21), e23, e26, e31, e36, e41, and e46 were thus provided. Embryos were collected at a local abattoir. Embryonic crown-rump length was measured, and genital ridges were dissected and collected into a guanidium thiocyanate solution. Total RNA was isolated according to the method of Chomczynski and Sacchi [24]. Concurrently an embryonic tissue sample was taken for DNA analysis; this sample was processed as described for white blood cells (above). Embryonic DNA samples (10 RIg) were digested with EcoRI restriction enzyme and analyzed by Southern hybridization using a digoxigenin-labeled hybridization probe representing the ORF of porcine SRY (ORFA-1, Fig. 2). A hybridization signal of 1.8 kb on Southern analysis was interpreted as positive for the male genotype. For a given male RNA sample, half the RNA was retained separately while the other half was pooled with other male samples for that particular gestational time point. RNA poly(A) + was extracted from pooled and individual RNA samples using a magnetic bead extraction protocol (Dynabeads Oligo(dT) 25 ; Dynal Inc., Great Neck, NY). Cloning cDNA and Reverse Transcription (RT)-PCR Developmental Analysis The cDNA of porcine genital ridge SRY was derived by means of an RT-PCR cloning strategy. RT was performed on individual RNA poly(A) + samples derived from 5 VIg of total RNA, recovered from male embryo genital ridges on Days e26, e31, e36, e41, and e46, with use of the primer ADT7T1 7 (5 '-GAATTCTAATACGACTCACTATAGGGTTTTTTTTTTTTTTTTT) and Superscript RT enzyme Pri(Gibco-BRL, Grand Island, NY) in a volume of 20 1Al. mary and nested PCR amplifications were performed on a 1-xLI aliquot of each sample through use of the specific sense primary oligo A (5'-GGAGAGAGGGCACAGAATTT) and the specific nested sense oligo B (5'-GGCAGTACTATGCAGCCAAG) with the nonspecific primer ADT7 (5'-GAATT'CTAATACGACTCACTATAGGG). No amplified bands resulted from these time periods (data not shown). When this procedure was repeated with samples from Days e21 and e23, a major amplified band was obtained for each time period. Cloning of the Day e21 amplified band into pGEM-T plasmid vector (Promega) followed by sequencing (as described for genomic clones) confirmed it to be porcine SRY sequences. On the basis of the extreme end of this sequence, a hybrid antisense primer, dT)7.pSRY (5' -TTTTTTTTTTTTTTTTTITGCACAAGGGACTG, where I = inosine), was designed and synthesized based on poly(dT) as well as specific porcine SRY sequences. Primer dT) 7.pSRY was used to prime the RT reaction from individual male poly(A) + RNA samples for Days e21 and e23 of gestation and from pooled male poly(A)+ RNA samples from Days e26 and e31 of gestation. Primary and nested PCR amplifications were then performed as described above, with the following changes: antisense primer dT 17.pSRY was used, and the annealing temperature was 58°C for the first PCR amplification and 600C for the nested PCR amplification. A control sample, consisting of poly(A) + RNA from an individual female sample from Day e23, was also included. As a control of RNA quality, poly(A) + RNA from the same time periods was reverse-transcribed using ADT7T17 adapter, and first
PORCINE SRY GENE EXPRESSION
49 FIG. 1. Southern analysis of porcine SRY gene locus. A heterologous probe, representing the HMG box of bovine SRY and incorporating a digoxigenin label, was used for hybridization. Restriction digests included (1) BamHI; (2) BgI II; (3) Cla L; (4) EcoRI; (5) Hindll; (6) Kpn ; (7) Pst I; (8) Sac 1; (9) Xba I; and (10) Xho I. The molecular weight marker (MWt) is lambda phage restricted with Hindlil.
strand cDNA was amplified via PCR using primers GAPDH.A (5'-TCCTGCACCACCAACTGCTTAGC) and GAPDH.1 (5 '-AGGTCCACCACCCTGTTGCTGTA), designed to amplify a 498-bp fragment based on homologous sequences within the rat and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene [25, 26]. Taq polymerase was used with the following thermal cycling profile: 40 cycles of denaturation at 95°C for 45 sec, renaturation at 64°C for 45 sec, and elongation at 72°C for 1 min 30 sec, with a single final cycle including elongation at 72°C for 15 min. RESULTS Southern analysis of male porcine genomic DNA using a heterologous bovine SRY probe is presented in Figure 1; it resulted in the identification of several hybridizing restriction bands. Notably, a band at 6 kb was identified with HindIII digestion, as has previously been reported for the pig [4]. In addition, EcoRI digestion revealed a hybridizing
FIG. 2. Cloning strategy for porcine SRY gene. A) Cloning of a 1.7-kb EcoRI genomic fragment including a 3' flank of 723 bp represented by the fragment F2-T7 and a 5' flank of 974 bp represented by the fragment 6-T3, as well as a genital ridge SRY transcript of 725 bp represented by fragment b-t7t17, which was identical to genomic sequences with an additional 107 bp of 3' sequences. B) Composite map of porcine SRYgene showing EcoRI genomic restriction sites, the 5' UTR, the ATG initiation codon, the TAA transcriptional stop signal, the ORF (rectangle from ATG to TAA), the HMG box domain (diagonal cross-hatched rectangle), and the 3' UTR to the poly(A) + tail (open rectangle) for the porcine genital ridge transcript.
band at about 1.6 kb that was targeted for cloning via previously described methods [20]. As depicted in Figure 2, the genomic cloning of porcine SRY locus was performed in two parts, the 3' flank and then the 5' flank, with use of an anchored PCR amplification of a plasmid-based sizeselected genomic mini-library. Also included are sequences derived via RT-PCR cloning of the end of the porcine SRY genital ridge transcript and the ORF sequences OREA-1, the latter of which served as a hybridization probe for sexing embryos by Southern analysis. The porcine SRY locus contains an ORF of 624 bp representing 208 amino acids (aa); this can be further characterized as containing a central, 237-bp HMG domain, a 177-nt 5' translated flanking sequence, and a 210-nt translated 3' flanking region. Also presented are a 5' promoter region of 615 bp and a 3' untranslated region (3' UTR) of 532 bp. These features along with the deduced amino acid sequence are shown in Figure 3. The percentage homologies of porcine SRY ORF sequences compared to those of other reported mammalian SRY molecules are presented in Table 1. Of note is the reasonable sequence conservation within the HMG box domains but the markedly reduced sequence homology in the 5'-flanking and 3'-flanking coding regions; also notable is the fact that amino acid homologies are almost uniformly less than the corresponding nucleic acid homologies-a situation noted by Whitfield et al. [14]. The amino acid sequences of porcine, human, and bovine SRY are aligned for maximum homology in Figure 4, which shows that even outside of the HMG box domain, homologous patterns can be identified, although at the expense of introducing gaps. To emphasize structural differences seen between porcine, human, and bovine SRY molecules (class I SRY, containing HMG box DNA-binding domain) and two strains of mouse Sry molecules (class II Sry, containing both HMG box domain and Gln/His-rich, putative activation domain), a comparative hydropathy profile of these molecules is presented in Figure 5 (based on [14, 20, 27, 28]). The comparable amino-terminal domain seen in porcine, human, and bovine molecules is absent in the mouse Sry molecules; on the other hand, the extended carboxy terminus, including the Gln/His-rich activation domain seen in both the mouse domesticus and molossinus Sry molecules, is notably missing in the pig, human, and bovine molecules. Pig embryos were sexed via Southern hybridization of
DANEAU ET AL.
50 -615 -540 -465 -390 -315 -240
GAATTCCCAATATTGCCCACAGGAAAACTTAACAGAATTTTCAATAGTTC AAGTAGAAGTGAAGAAACAA EcoRI ATTCTTCCTGTGGGC C CGCCTGGCAGGCCACGGCCTGC GAATGACGACTAGCATTCAACTCTATAACATCCGC ATTTACATATG CG AAAGGAAAGGAATCTCTGTGTTAAACATAGC TGAGTGCTCTAATGGC G AT T CTCATAACGATAAACCATTGTCAGATGCTGCTGCACCGTCATCCTTAATTGAGOGATAAAATAAA AACT CTAGAACAGAAAG CAGAGCCTTCAGCA ACTTCGGATTAGAC AAAGTTTCCGG rlA AATAATGAC CAAGCCTTATTATCATAATAAGTAAGCAGTGCTTGAGAATGGGTAGGTTGGTTCGGCTTTGGCTGGCGGCT
-165 GCCTGCCGACCCCAGCGGTTTCCAGGGGAGGTACTGGGGCGGAGAAATTGGTATTTCACTACAAAGATTAGAGT -90 TACTCAAATCTCTGGTGGAAATAAC CTTTAAATAGTGAAGACAAC TTTCAAACGTACGCTTTTGATTTCGCTT -15 CCTCCCCCTTTTCAAATGGTGCAGTCATATGCTTCCTATGTTCAGAGTATTGAAAGCGACGATTACAGCCCA MetValGlnSerTyrAlaSerAlaMetPheArgVa1LeuLysAlaAspAspTyrSerPro 1 61 GCGGCACAGCAGCAAAATATTCTCGCCTTGGGGAAAGGCTCCTCACTATTTCCGACGGACAATCATAGCTCAAAC 20 AlaAlaGlnGlnGl
nAsnIleLeuAlaLeGlyLysGlySerSerLeuPheProThrAspAsnHiSSerSerAsn
136 GATGGACGTGAAACTAGAGGAAGTGGTAGAGAGAGTGGCCAGAC 45 AspGlyArgGluThrArgGlySerGlyArgGluSerGlyGlnApA
TCAA
ACCCATGAAG
ATT
lyArLysArgProMetAsnAlPheIe
211 GTGTGGTCTCGTGATCAAAGGAGAAAAGTGGCTCTAGAGAACCCTCAAATGCAAAACTCAGAGATCAGCAAGTGG 70 Val TrpSerArgAspGlnArgArgLysValAl aLeuGluAsn ProGlnMetGlnAsnerGu IleSerLysTrp AC AGAGGC TAA ACC CAGAACC AA AAAC 286 c TGC 95 LeuGlyCysLysTrpLysMetLeuThrGluAlaGluLysArgProhePheGluGlulaGlnArgLeuGlnAla 361 GTACCG
TACCC
TATCGCAAGGGAGAGAGGGCACAGAATTTCTTCCG o l G ln A sn L e u L eu Pr
120 Va1HisArgAspLysTyrProGlyTyrLysTyrArgProArArgrgLysGlyGluArgA
436 GCAGAGGCGGCAGTACTATGCAGCCAAGTGCGCGTAGAGGAGAGGATGTATCCCTTCACATACACAGTCGCCAAG luGluArgMetTyrProPheThrTyrThrVVaAl1Lys A aVaLeuCyyserGlnVa1ArgValG 145 AlaGluAl1Al 511 GCCAAGTGCTCAGGAACAGAAAGCCAGTTAAGTCACTCACAGCCCATGAACATAACCAGCTCACTTCTGCAACAG 170 AlaLysCysSerGlyThrGluSerGlnLeuSerHisSerGnProMetAsnI leThrSerSerLeuLeuGlnGn 586 GAGGATCGCTGCAACTGGACAGGCCTGTGCACAGTAGGGTAACA2CCACCGGGCAGATCCGCGCCGACTTGCCTT 195 GluAspArgCysAsnTrpThrGlyLeuCysThVGrVa 1Gly* 661
TTCACCGTGGTTACA
CCGGGACTTTCACATTATTCCATA
TTGATTTCCTTTACTGTCGCGAACAGAGG
736 GCCTA.TTCATCTCAGTTTTACTGTTATTTCACCGTGACTTAGTTTCAGATTAAGGCAGATTAACATGTTGACC 811 TATAAAGAATTAGGGCATGCCAATATGACTCAACCTGTCTTTACGACTGCTTAAAAGAGCACTACCTTAATAAGA T T T T T T TATAC 886 AAGTATCTTAAACACAAAACTGCTGATTCGAAAACCATCTGTTCCTTCTAATAGAACAA 961 CTAATTTTAGTTGTTCCCGTGATTAGCCATTAAGTACGTAACAGTATATATAGTATTCTGATAATCCTTAGCAT CTCTTTATCACTGTCAAAACTGTAGTGCTSGGAGCATGCACAAATTTATGATACAGGA 1036 AGCTGATAGAAT 1111
EcoRI ACTTCCATGAAGTATTTGTACCTATAMAGCAGTCCTTGTGCAGAAA Polyadenylation signal
FIG. 4. Comparison of deduced amino acid sequences of SRY proteins with HMG box domains but without activation domains (class I SRY proteins), including porcine (pSRY), human (hSRY), and bovine (bSRY) proteins. Conserved amino acids are shaded, and spaces (-) are introduced to maximize homologies. Numbering is based on the sequence of porcine SRY. The HMG box domain is enclosed, and the end of translation is indicated by (*).
Poly(A) tail
FIG. 3. Composite nucleotide sequence of porcine SRY gene locus EcoRI genomic fragment as well as genital ridge 3' cDNA fragment. The A of the first ATG of the major ORF is numbered 1 for the nucleotide sequence, while the encoded Met is aa 1. The predicted amino acid sequence is presented underneath the nucleotide sequence of the ORF. The HMG box domain, encompassing bp 178-424, is underlined. The transcriptional stop signal (TAA) is identified by asterisks on the line below it. Genomic EcoRI restriction sites, used in cloning the genomic sequences, are underlined and labeled. The genital ridge UTR is indicated in + italics, while a polyadenylation signal (AATAAA) and the site of poly(A) tail addition are underlined and labeled.
demonstration of one major polyadenylated sequence for the porcine genital ridge transcript. Upon sequencing, the poly(A) + addition was found 16 bp 3' to the first polyadenylation signal (AATAAA) identified after the TAA stop signal. A comparison of the sizes of the UTR transcripts for reported SRY transcripts is as follows: mouse genital ridge transcript, 3481 bp UTR; porcine genital ridge transcript, 532 bp UTR; bovine testicular transcript, major bands at 128 and 201 bp 3' UTR; and human testicular transcript, 137 bp 3' UTR. Thus porcine SRY genital ridge transcript is relatively short and is similar to the human and bovine testicular transcripts as compared to the mouse genital ridge Sry transcript, which is considerably longer. Porcine genital ridge SRY expression was demonstrated
genomic DNA through use of a probe representing porcine SRY ORF (OREA-1). In total, 59 embryos were tested, of which 21 (36%) were classed as male and 38 (64%) as female. Within a given time period and between male and female embryos, no sex-related differences in crown-rump size were observed (data not shown). Figure 6 shows the results of the RT-PCR amplification used to clone the 3' UTR flank of the genital ridge porcine SRY transcript. It should be noted that this RT was performed with use of a poly(dT) primer and resulted in the TABLE 1. Nucleic acid and amino acid homologies (%) of N-terminal, HMG-box, and C-terminal regions of porcine SRY gene compared to bovine and human SRY and mouse (molossinus) Sry sequences.* Region HMG box
C-terminal
Nucleic acid homologies: 73.7% Bovine 65.9% Human 0% Mouse
84.4% 82.7% 75.1%
72.7% 64.4% 54.5%
Amino acid homologies: Bovine 57.7% 44.8% Human 0% Mouse
80.8% 83.3% 70.5%
48.5% 43.8% 0%
N-terminal
*A homology search was performed with MacDNASIS (Hitachi) software, utilizing a Lipman and Pearson search algorithm [541.
FIG. 5. Comparative hydropathy profiles of class I SRY proteins (porcine, bovine, human SRY) and class II Sry proteins (mouse domesticus and molossinus Sry). Calculations were performed via the method of Hopp and Woods [531, with a window frame of 10, using MacDNASIS software (Hitachi, Brisbane, CA). Profiles are aligned to the HMG box domains, which are shaded. The amino and carboxy terminals are also indicated, and the Glu/His-rich region seen in the mouse molecules is indicated via cross-hatching.
PORCINE SRY GENE EXPRESSION
FIG. 6. RT-PCR cloning of porcine 3' genital ridge SRYtranscript. Poly(A), RNA from an individual e21 male embryo was used for the analysis. RT was performed with a nonspecific poly(dT) primer. After nested PCR amplification (see text for details), a major band was identified at about 0.8 kb; cloning and sequencing of this band proved it to be porcine SRY sequences. Molecular weight marker (MWt) was commercially available Phi-X 174 cut with Hae II.
via RT-PCR analysis on male developmental poly(A) + RNA samples (Fig. 7). Note that this time the RT was performed with a hybrid primer including 5' poly(dT) sequences and SRY transcript-specific antisense sequences in order to prevent amplification from genomic DNA templates. Time periods included e21 (embryonic crown-rump length [CRL] was 10 mm), e23 (CRL = 14 mm), e26 (CRL = 18 mm), and e31 (CRL = 25 mm). A band of 712 bp was amplified for time periods e21, e23, and e26, but not for e31 (lane A). To ensure that this band represented SRY sequences, it was digested with EcoRI; this resulted in predicted size restriction fragments of 606 bp and 106 bp (lane B). Amplified bands that were lower than unit length, as seen for the e26 sample, were occasionally observed in both male and female samples; these did not cut with EcoRI and were not further characterized. As a control for RNA quality, the male poly(A) + RNA was also analyzed with use of RT-PCR for GAPDH sequences (lane C). DISCUSSION We have cloned porcine genomic SRY sequences and used these sequences to derive preliminary expression data of the SRY gene within the genital ridge of the male pig embryo. Currently the mouse is the only other species in which the Sry genital ridge transcript and its pattern of expression have been described [28, 29]. Mouse Sry expression is detected within the primitive undifferentiated gonad over a short period of time, from Days elO0.5 to el 1.5, and falls to near zero by e12.5. This expression pattern has provided strong circumstantial evidence equating Sry with TDF [6]. Human genital ridge SRY expression has not been characterized because of the difficulty in obtaining biopsies of known gestational length that are of sufficient quality and quantity to perform analysis. However, human genital ridge SRY transcript is expected to be present around the sixth week of gestation, just before histological testicular
51
FIG. 7. Genital ridge expression of porcine SRY gene at different gestational time points via RT-PCR. Samples include male embryos at ages e21, e23, e26, and e31. Lane A: Genital ridge poly(A)* RNA samples were reverse-transcribed with use of a specific SRY transcript antisense primer. A nested PCR amplification was performed, and amplification products were size-fractionated on a 1.0% agarose gel. Lane B: EcoRI restriction digests of amplified band from lane A. Lane C: GAPDH sequences am+ plified from the same poly(A) RNA stock used in lane A, but reversetranscribed using a poly(dT) antisense primer. Molecular weight marker (MWt) was Phi-X 174 cut with Hae II.
differentiation is evident [28]. Preliminary developmental expression data in the pig, presented here, suggest that porcine SRY is expressed in the genital ridge over several days including e21 and e23, with faint expression on e26 and an absence of expression by e31. In the developing pig fetus, the gonadal ridge first appears by e21; the gonad remains sexually undifferentiated from Days e21 to e24, whereupon the tunica albuginea, an indication of testis formation, is histologically identifiable by e24 to e27 [30-33]. The porcine genital ridge SRY transcript is probably not strongly expressed on a tissue basis, as a nested RT-PCR procedure was required for detection. Furthermore, as the RT-PCR method used was qualitative, a quantitative analysis of porcine SRY expression will have to await more sophisticated analysis techniques. In general, porcine genital ridge SRY expression correlates developmentally and anatomically with Sry expression in the mouse gonadal ridge [28] and is consistent with the hypothesis that for SRY to be TDE it should be expressed within the gonadal ridge before the time of overt testicular differentiation. The total calculated size of the mouse genital ridge Sry transcript as evidenced by 5' and 3' RT-PCR as well as RNAse protection studies is 4929 bp [28, 29]. The only other polyadenylated SRY transcript of known size is the human testicular transcript, which at 826 bp is much smaller than the mouse genital ridge transcript [34, 35]. Much of this size difference can be accounted for by the size of the 3' UTR: the linear genital ridge mouse Sry transcript has a large 3' UTR of 3481 bp, while linear testicular human SRY 3' UTR is much shorter at 137 bp. Like the human testicular SRY transcript, bovine testicular SRY transcript 3' UTR is relatively short [20]. The porcine genital ridge SRY transcript reported here has a 3' UTR of 531 bp and a single major polyadenylation site and, as such, is more similar to the human testicular transcript than to the mouse genital ridge transcript. A circular Sry transcript is seen in the adult mouse testicle [36]; this is a conformation not described to date in
52
DANEAU ET AL.
other species. The physiological function of adult testicular SRY transcripts, if one exists, remains unknown. Also reported and of unknown function are SRY transcripts within the preimplantation embryo [37-39]. Structural analysis of mammalian SRY molecules suggests that (at least) two classes of SRY may exist. In class I SRY, exemplified by humans and cattle (as well as the sheep, goat, and buffalo), the SRY protein contains only the DNA-binding domain of the HMG box and lacks an activation domain. In class II Sry, exemplified by the mouse, the Sry protein contains both DNA-binding and transcriptional activation domains. In this respect, the porcine SRY molecule belongs to class I SRY, being much closer in overall structure to human and bovine SRY than to mouse Sry. For instance, the amino-terminal region of mouse Sry consists of 2 aa only, as compared to 58, 52, and 59 aa in the human, bovine, and porcine SRY molecules, respectively. The HMG box motif shows the greatest conservation of homology between the species. At the carboxy terminus, the coding sequences for the human, bovine, and porcine SRY molecules are of similar size (coded for by 207, 300, 213 bp, respectively), while the mouse molecule (type Mus musculus molossinus) has an extended carboxy terminus, coded for by 942 bp, that contains the putative transcriptional activation domain [14, 28]. Interestingly, mouse strains of the type Mus musculus domesticus have been described in which the Sry sequence displays a truncated carboxy terminus of 447 bp, due to a premature termination codon in the sequence [27]. This eliminates one half of the putative activation domain and may help to explain the sex reversal seen when the domesticus Y chromosome is put on a molossinus genetic background [40]. The two structural classes of SRY molecules observed allow speculation on the mechanism of action of SRY during testis determination, and two functional models can be proposed: 1) SRY is a DNA-binding protein contributing directly to transcriptional activation (direct transcriptional activation model) and 2) SRY is a DNA-binding protein defining the site of access for other molecules involved in transcriptional activation (site of access model). Class II Sry molecules, as seen in mouse species, contain DNAbinding and transactivation domains covalently linked, and could represent the direct transactivation model. Several HMG box genes, like Sry, contain both a DNA recognition domain and a transcriptional activation domain [8]. The Sry activation domain is functional in in vitro assays [41, 42]; however, evidence for in vivo function of the activation domain of Sry is now required. Class I SRY molecules, as in human, bovine, and porcine SRY, could also function via a direct transactivation mechanism if they bind noncovalently with a transcriptionally activating protein to form an activation complex [28]. This hypothetical "other half" of SRY could be a general transactivating factor or one displaying specific binding to SRY; in either case, its gene would be unlikely to have a Y chromosome location, as TDF is the only Y chromosome gene locus implicated in sex determination at this point in time. Also predicted would be a class of gender reversal mutations within the SRY sequence corresponding to the site of contact with this activating protein. Alternatively, human, bovine, and porcine SRY could function via a site of entry mechanism in which the genetically defined TDF is functionally a DNAbinding domain that allows transcriptional activating proteins access to DNA sites but does not enter into physical contact with these molecules. The site of access model does
not necessarily exclude mouse Sry, as the molecule's activation domain may not have functional activity in vivo. Elucidation of SRY/Sry function based on these structural classifications must await further studies. Upstream and downstream genes that interact with SRY are not defined, although several additional candidate genes implicated in sex determination now exist. SF-I is a gene that was first described as a transactivating binding factor for genes involved with steroidogenesis; knockout experiments revealed an additional role in gonad and adrenal gland formation [43]. SF-I is expressed in the primitive gonads in both sexes around the time of sex determination and continues to be expressed developmentally only in the male gonads [44]. Thus SF-1 may represent a factor that is necessary and permissive to gonad development, including testis determination, and is involved in male sex differentiation possibly by activation of genes such as the steroidogenic acute regulatory (StAR) protein gene [45] and others involved in steroidogenesis. Miillerian inhibitory hormone (MIH) is the first detectable secreted protein of developing testis and probably plays a role in sex differentiation in both sexes [46]. Control of the MIH gene is controversial: some studies suggest a direct role of SRY [47], while others suggest a role for intermediate molecules such as SF-I [48]. Other candidate genes for involvement in sex determination include Sox9 [12], WTI [49], and DAX-1 [50]. Further genetic, molecular, and physiological studies are now required to determine temporal and causal relationships between the expression of these factors. To this end, the domestic pig represents a potentially useful physiological model system for the study of mammalian sex determination and differentiation because it is a polytocous species and staged embryos are relatively easily available. Since the porcine SRY molecule is structurally more similar to the human SRY than to the mouse Sry, the pig may represent a more relevant model for the study of human sex determination than the mouse. Intersex pigs have been described by several authors [51, 52], and these animals should represent a hitherto untapped resource for genetic and molecular studies of mammalian sex determination and differentiation. ACKNOWLEDGMENTS The authors would like to acknowledge the valuable contributions of Daniel Godbout, G6netiporc Inc. (Quebec), and Marcel Morrisette and Dr. Ghislain Pelletier of the Agriculture Canada Research Station, Lennoxville, Quebec. The enthusiastic help of Donald C6t6, R6n6 Verroneau, and Dr. Pierre Hdlie is also noted and appreciated.
REFERENCES 1. Jost A. Problems of fetal endocrinology: the gonadal and hypophyseal hormones. Recent Prog Horm Res 1953; 8:379-418. 2. Jost A, Vigier B, Prepin J, Perchellet JP Studies on sex differentiation in mammals. Recent Prog Horm Res 1973; 29:1-41. 3. Jacobs PA, Strong JA. A case of human intersexuality having a possible XXY sex-determining mechanism. Nature 1959; 183:302-303. 4. Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf A-M, Lovell-Badge R, Goodfellow PN. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 1990; 346:240244. 5. Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Miinsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 1990; 346:245-250. 6. Goodfellow PN, Lovell-Badge R. SRY and sex determination in mammals. Annu Rev Genet 1993; 27:71-92. 7. Hawkins JR. Sex determination. Hum Mol Gen 1994; 3:1463-1467.
PORCINE SRY GENE EXPRESSION 8. Harley VR, Goodfellow PN. The biochemical role of SRY in sex determination. Mol Reprod Dev 1994; 39:184-193. 9. VanDeWetering M, Clevers H. Sequence-specific interaction of the HMG box proteins TCF-I and SRY occurs within the minor groove of a Watson-Crick double helix. EMBO J 1992; 11:3039-3044. 10. Pontiggia A, Whitfield S, Goodfellow PN, Lovell-Badge R, Bianchi ME. Evolutionary conservation in the DNA-binding and -bending properties of HMG-boxes from SRY proteins of primates. Gene 1995; 154:277-280. 11. Poulat F, Girard F, Chevron M-P, Goz6 C, Rebillard X, Calas B, Lamb N, Berta P Nuclear localization of the testis determining gene product SRY. J Cell Biol 1995; 128:737-748. 12. Wagner T, Wirth J, Meyer J, Zabel B, Held M, Zimmer J, Pasantes J, Dagna Bricarelli F, Keutel J, Hustert E, Wolf U, Tommerup N, Schempp W, Scherer G. Autosomal sex reversal and camptomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell 1994; 79:1111-1120. 13. Foster JW, Sominguez-Steglich MA, Guioli S, Kwok C, Weller PA, Stenanovic M, Weissenbach J, Mansour S, Young ID, Goodfellow PN, Brook JD, Schafer AJ. Camptomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 1994; 372: 525-530. 14. Whitfield LS, Lovell-Badge R, Goodfellow PN. Rapid sequence evolution of the mammalian sex-determining gene SRY. Nature 1993; 364:713-715. 15. Tucker PK, Lundrigan BL. Rapid evolution of the sex determining locus in Old World mice and rats. Nature 1993; 364:715-717. 16. Gubbay J, Vivian N, Economou A, Jackson D, Goodfellow P, LovellBadge R. Inverted repeat structure of the Sry locus in mice. Proc Natl Acad Sci USA 1992; 89:7953-7957. 17. Nagamine CM. The testis-determining gene, SRY, exists in multiple copies in Old World rodents. Genet Res Camb 1994; 64:151-159. 18. Mardon G, Page DC. The sex-determining region of the mouse Y chromosome encodes a protein with a highly acidic domain and 13 zinc fingers. Cell 1989; 56:765-770. 19. Daneau I, Houde A, Ethier J-F, Lussier JG, Silversides DW. SRY gene in bull and boar show greater similarity to human than to mouse gene. Biol Reprod 1994; 50(suppl 1): abstract 412. 20. Daneau I, Houde A, Ethier J-F, Lussier JG, Silversides DW. Bovine SRY gene locus: cloning and testicular expression. Biol Reprod 1995; 52:591-599. 21. Payen EJ, Cotinot CY. Sequence evolution of SRY gene within Bovidae family. Mamm Genome 1994; 5:723-725. 22. Ge BS, Xu HH, Liu DM, Zhou DN, Zhu YD, Shen XZ. Molecular cloning and sequencing of the SRY gene from pig. Chin Sci Bull 1995; 40:1384-1388. 23. Sambrook J, Tritsch EE Maniatis T. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. 24. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156-159. 25. Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res 1985; 13:1431-1442. 26. Tokunaga K, Nakamura Y, Sakata K, Fujimori K, Ohkubo M, Sawada K, Sakiyama S. Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res 1987; 47: 5616-5619. 27. Coward P, Nagai K, Chen D, Thomas HD, Nagamine CM, Lau Y-FC. Polymorphism of a CAG trinucleotide repeat within Sry correlates with B6.YDom sex reversal. Nature Gen 1994; 6:245-250. 28. Koopman P, Minsterberg A, Capel B, Vivian N, Lovell-Badge R. Expression of a candidate sex-determining gene during mouse testis differentiation. Nature 1990; 348:450-452. 29. Hacker A, Capel B, Goodfellow P, Lovell-Badge R. Expression of SRY, the mouse sex determining gene. Development 1995; 121:16031614. 30. Pelliniemi LJ. Ultrastructure of gonadal ridge in male and female pig embryos. Anat Embryol 1975; 147:19-34.
53
31. Pelliniemi LJ. Ultrastructure of the early ovary and testes in pig embryos. Am J Anat 1975; 144:89-112. 32. Pelliniemi LJ. Ultrastructure of the indifferent gonad in male and female pig embryos. Tissue Cell 1976; 8:163-174. 33. Noden DM, DeLahunta A. The Embryology of Domestic Animals: Developmental Mechanisms and Malformations. Baltimore, MD: Williams and Wilkins; 1985: 322-342. 34. Clepet C, Schafer AJ, Sinclair AH, Palmer MS, Lovell-Badge R, Goodfellow PN. The human SRY transcript. Hum Mol Genet 1993; 2: 2007-2012. 35. Su H, Lau Y-FC. Identification of the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, using a reverse genetic approach. Am J Hum Genet 1993; 52:24-38. 36. Capel B, Swain A, Nicolis S, Hacker A, Walter M, Koopman P, Goodfellow P, Lovell-Badge R. Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell 1993; 73:1019-1030. 37. Zwigman T, Erickson RP, Boyer T, Ao A. Transcription of the sexdetermining region genes Sry and Zfy in the mouse preimplantation embryo. Proc Natl Acad Sci USA 1993; 90:814-817. 38. Boyer TR, Erickson RP Detection of circular and linear transcripts of Sry in pre-implantation mouse embryos: differences in requirement for reverse transcriptase. Biochem Biophys Res Commun 1994; 198: 492-496. 39. Fiddler M, Abdul-Rahman B, Rappolee DA, Pergament E. Expression of SRY transcripts in preimplantation human embryos. Am J Med Genet 1995; 55:80-84. 40. Lee C-H, Taketo T Normal onset, but prolonged expression, of Sry gene in the B6.YDOM sex-reversed mouse gonad. Dev Biol 1994; 165:442-452. 41. Dubin RA, Ostrer H. Sry is a transcriptional activator. Mol Endocrinol 1994; 8:1182-1192. 42. Dubin RA, Coward P, Yun-Fai Christian, Ostrer H. Functional comparison of the Mus musculus molossinus and Mus musculus domesticus Sry genes. Mol Endocrinol 1995; 9:1645-1654. 43. Luo X, Ikeda Y, Parker KL. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 1994; 77:481-490. 44. Ikeda Y, Shen W-H, Ingraham HA, Parker KL. Developmental expression of mouse steroidogenic factor-1, and essential regulator of the steroid hydroxylases. Mol Endocrinol 1994; 8:654-662. 45. Clark BJ, Soo S-C, Caron KM, Ikeda Y, Parker KL, Stocco DM. Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol Endocrinol 1995; 9:1346-1355. 46. Minsterberg A, Lovell-Badge R. Expression of the mouse anti-Millerian hormone gene suggests a role in both male and female sexual differentiation. Development 1991; 113:613-624. 47. Haqq CM, King C-Y, Ukiyama E, Falsafi S, Haqq TN, Donahoe PK, Weiss MA. Molecular basis of mammalian sexual determination: activation of Miillerian inhibiting substance gene expression by SRY. Science 1994; 266:1494-1500. 48. Shen W-H, Moore CCD, Ikeda Y, Parker KL, Ingraham HA. Nuclear receptor steroidogenic factor 1 regulates the Miillerian inhibiting substance gene: a link to the sex determination cascade. Cell 1994; 77: 651-661. 49. Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D, Jaenisch R. WT-1 is required for early kidney development. Cell 1993; 74:679-691. 50. Zanaria E, Muscatelli F, Bardoni B, Strom TM, Guioli S, Guo W, Lalli E, Moser C, Walker AP, McCabe ERB, Meitinger T, Monaco AP, Sassone-Corsi P, Camerino G. An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 1994; 372:635-641. 51. Hunter RHF, Baker TG, Cook B. Morphology, histology and steroid hormones of the gonads in intersex pigs. J Reprod Fertil 1982; 64: 217-222. 52. Halina WG, Barrales DW, Partlow GD, Fischer KRS. Intersexes in swine: a problem in descriptive anatomy. Can J Comp Med 1984; 48: 313-321. 53. Hopp TP, Woods KR. Prediction of protein antigenic determinants from amino acid sequences. Proc Natl Acad Sci USA 1981; 78:38243828. 54. Lipman DJ, Pearson WR. Rapid and sensitive protein similarity searches. Science 1985; 227:1435-1441.
