Poultry Science

MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY Candidate Gene Expression Analysis of Toxin-Induced Dilated Cardiomyopathy in the Turkey (Meleagris gallopavo) K.-C. Lin,* K. Gyenai,* R. L. Pyle,† T. Geng,* J. Xu,* and E. J. Smith1 *Department of Animal and Poultry Sciences, and †Department of Small Animal Clinical Sciences, Virginia Tech, Blacksburg 24061 ABSTRACT Dilated cardiomyopathy (DCM), a heart disease, affects many vertebrates including humans and poultry. The disease can be either idiopathic (IDCM) or toxin-induced (TIDCM). Although genetic and other studies of IDCM are extensive, the specific etiology of TIDCM is still unknown. In this study, we compared mRNA levels of cardiac troponin T (cTnT) and phospholamban (PLN) in turkeys affected and unaffected by TIDCM. Cardiac TnT and PLN were chosen because their altered expression has been observed in IDCM-affected

birds. A total of 72 birds, 44 affected and 28 unaffected with TIDCM, were used. Differences in the mRNA levels of cTnT and PLN between affected and unaffected turkeys were significant only for cTnT. The sequence of the turkey PLN showed significant similarity at the nucleotide level to the reference chicken sequence and to those of other species. In addition to implicating cTnT in TIDCM, the present work describes a partial turkey PLN coding sequence that could be useful for future studies.

Key words: turkey, cardiomyopathy, cardiac troponin T, phospholamban, reverse transcription-polymerase chain reaction 2006 Poultry Science 85:2216–2221

INTRODUCTION To meet consumer demand, turkeys have been selected for rapid growth and higher average BW at market age. This has led to the speculation that, as in other animals, increased physiological abnormalities and other health problems such as circulatory disturbances may be a result of this rapid growth of the turkey (http://www.eat turkey.com/consumer/stats/stats.html and http:// www.census.gov/Press-Release/www/2005/cb05ff-182; Paxton et al., 2005). In commercial turkeys, a prevalent circulatory problem is dilated cardiomyopathy (DCM; Frame et al., 1999). Dilated cardiomyopathy is a myocardial disease characterized by enlarged ventricles, cavity dilatation, and systolic and diastolic dysfunction (Fatkin and Graham, 2002). Affected young poults have ruffled feathers, drooping wings, and unthrifty appearance (Czarnecki et al., 1973). Clinical symptoms of DCM including dyspnea, weakness, and edema have been reported to be associated with heart failure, which may cause sudden death if severe, resulting in economic loss to producers (Fatkin and Graham, 2002). In commercial turkeys, it has been estimated that DCM causes early death at a rate of 2 to 4% as well as weight

2006 Poultry Science Association, Inc. Received May 22, 2006. Accepted July 27, 2006. 1 Corresponding author: [email protected]

loss in birds between 2 and 4 wk of age (Frame et al., 1999; Zepeda and Kooyman, 2002). Although the etiology of DCM is poorly understood, factors that have been implicated in the incidence and severity of DCM can be either genetic or environmental. The environmental factors include nutrition, management, pathogens, stress, and toxins (Frame et al., 1999; Poller et al., 2005). Furazolidone (Fz), a drug normally used to treat enteritis and diarrhea, has been shown to induce DCM in turkeys younger than 5 wk of age at toxic levels (Ali, 1989; White, 1989). When fed diets containing 700 ppm of Fz for 2 to 3 wk, poults between 2 and 4 wk of age develop DCM (Genao et al., 1996). Characteristics of affected birds include increased heart volumes, left ventricular dilation, and fractional shortening as well as altered membrane transport (Hajjar et al., 1993). In gross morphology, these characteristics are similar to those observed in birds and humans affected by idiopathic DCM (IDCM). Additional similarities include altered Ca2+ metabolism and alterations to the β receptor-adenylyl cyclase signaling system. Investigations of the genetic basis of IDCM have included identifying candidate genes. From these investigations, at least 18 genes have been reported (Durand, 1999) to influence spontaneous DCM including phospholamban (PLN) and cardiac troponin T (cTNT). Phospholamban is involved in regulating calcium uptake in the sarcoplasmic reticulum. Mutations in PLN, as expected, have been reported to affect calcium transport in cells leading

2216

GENE EXPRESSION AND DILATED CARDIOMYOPATHY

to abnormal myocardial function (Liew and Dazu, 2004; Schmitt et al., 2003). Schwinger et al. (1995) used Western and Northern blot analyses to compare protein and transcripts levels of PLN in human nonfailing and failing heart tissues, respectively. They reported that in DCMaffected hearts, PLN transcripts but not protein levels were lower. Like PLN, cTnT is a candidate gene for DCM because of its role in myofibril calcium sensitivity. Mutations in cTnT change the sensitivity of myofilaments to calcium. In both turkey and human hearts, abnormal splicing of multiple exons of cTnT has been associated with the incidence of DCM (Biesiadecki et al., 2004). The primary objective of the current study was to examine the differences between normal and Fz-induced affected turkey poults in mRNA levels of cTnT and PLN genes.

2217

was no turkey gene or cDNA sequence, sequences from multiple species were compared using CLUSTAL-W. Primers were obtained from MWG (High Point, NC) and optimized for annealing temperature and reaction conditions using the FailSafe PCR PreMix Selection kit (Epicentre Inc., Madison, WI). The optimization of PCR for the chicken PLN-derived primers was carried out in a total volume of 25 ␮L containing 100 ng of genomic DNA, 50 pmol of each primer, 12.5 ␮L of FailSafe PCR 2X Pre Mix, and 1.25 units of FailSafe PCR Enzyme Mix. The optimization of the cycling reactions were as follows: denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 45 s, annealing temperature of between 52 and 62°C for 45 s, and extension at 70 C for 45s. The PCR products were analyzed on a 2% agarose gel and stained with SYBR green.

MATERIALS AND METHODS Birds and Tissue Collection Eighty 1-d-old turkeys were used. The birds were randomly assigned to treatment (n = 50) and control (n = 30) groups at 1 d of age. Both groups of poults were fed ad libitum. The poults in the treatment group were fed a standard diet (from d 1) containing 700 ppm of Fz according to Czarnecki et al. (1973) and Gyenai (2005). Birds were scanned each week for DCM by echocardiography as described by Gyenai (2005). Birds were selected for tissue collection based on left ventricular end diastolic and systolic dimensions. These parameters have previously been shown to be consistent indicators of DCM (Gyenai, 2005). Both heart and liver from control and treatment birds were collected at 7 and 14 d of age. Once the tissues were collected, they were washed in PBS and snap-frozen in liquid nitrogen followed by storage at −80°C before use for RNA isolation.

Total RNA Isolation Total RNA from both heart and liver tissue samples was extracted by using the RNeasy Midi kit according to the manufacturer’s recommended protocol (Qiagen Inc., Valencia, CA). The RNA concentrations were determined using the Agilent BioAnalyzer 2100 and RNA quality was verified by electrophoresis on 1% formaldehyde agarose gel. The RNA samples were treated with DNase (Qiagen Inc.) to break down genomic DNA.

Primer Design and Selection To develop primers, we used the turkey cTnT and chicken PLN (Toyofuku and Zak, 1991) mRNA GenBank sequences with accession numbers of AF005139 and NM_205410, respectively. Turkey β-actin (GenBank accession number NM_205518) was used as a housekeeping gene. Primers were designed using the web-based computer program Primer 3 (Rozen and Skaletsky, 1997). To maximize the use of exons to design primers that do not bind to genomic DNA, particularly PLN for which there

Reverse Transcription PCR and Sequence Analysis Total RNA (1 ␮g) was transcribed to cDNA using the BioRad I-script cDNA synthesis kit (BioRad, Hercules, CA) in a total volume of 20 ␮L. Negative controls were processed with the samples to test for nonspecific reverse transcription or amplification. Reactions consisted of 300 nM sense and antisense primers (Table 1). The PCR amplification was initiated by heating at 95°C for 3 min, followed by 40 cycles of the following conditions: 10 s at 95°C, 15 s at annealing temperature (Table 1), and 20 s at 72°C. A standard curve was developed for β-actin, the reference gene, and for each of the 2 genes evaluated. The relative amount of the PLN and cTnT transcripts was computed using the slope of each curve. Products from reverse transcription PCR (RT-PCR) were analyzed on a 2% agarose gel containing ethidium bromide. To validate the RT-PCR, all amplicons were sequenced using standard BigDye Termination cycle sequencing procedure (Applied Biosystems, Foster City, CA). The cDNA sequences were compared with database information using BLAST.

Statistical Analyses The RT-PCR data were normalized to the reference gene (β-actin) and calibrated to the control group by the 2−䉭䉭CT method (Livak and Schmittgen, 2001), where 䉭䉭CT = (CT, Target − CT, β-actin) − (CT, Calibrator − CT, β-actin). The converted data were analyzed using the MIXED procedure of SAS (SAS Institute, 2002–2003). The model included age (7 or 14 d) and group (affected or unaffected) as main effects and test of appropriate 2-way interactions. The results were expressed as mean ± standard deviation. Differences were considered significant if P < 0.05.

RESULTS AND DISCUSSION The echocardiography measurements of the ventricular dimensions of the affected and unaffected birds from

2218

LIN ET AL. Table 1. Sequences of primers used in the reverse transcription PCR (RT-PCR) Accession number

Gene1

Primer2

AY005139

cTnT

Forward: 5′ AAAATCCCCGATGGTGAG 3′ Reverse: 5′ GCTCAATCCTGTCTTTGAGG 3′ Forward: 5′ GAGGAGAGCCTCAACTCTTG 3′ Reverse: 5′ ATACATGTGGCAGGCAGTAA 3′ Forward: 5′ TGATGGTGTTACCCACACTG 3′ Reverse: 5′ TTCTCCAGGGAAGAGCTAGA 3′

NM_205410

PLN

NM_205518

β-actin

Amplicon length (bp)

Tm3 (°C)

154

56

4

292

58.2

246

56

1

Genes: cTnT = cardiac troponin T; PLN = phospholamban. The primers were derived from turkey cTnT and chicken PLN and β-actin sequences in GenBank. 3 Tm represents the optimized annealing temperature at which a single amplicon of the expected size was obtained. 4 The sequence of this amplicon has been submitted to GenBank and assigned accession number DQ388252. The expected size is based on the binding site of the primers to the Gallus gallus sequence. The sequence submitted to GenBank was edited by Consed to remove low quality nucleotides from the ends; thus, the publicly available sequence of the RT-PCR amplicon is 278 bp. The sequence contains 123 of 159 bp of the coding sequence of PLN described for other species. 2

treatment and control groups, respectively, are presented in Table 2. The average difference between the affected and unaffected birds in left ventricle diastolic and systolic dimension as determined by echocardiography was 40 and 120% at 7 and 14 d of age, respectively (Table 2). During necropsy to collect tissue, additional validation of DCM was from visual inspection because affected birds had larger hearts with slight discoloration and congestion. The dimensions observed, indicating affected or unaffected, were consistent with those recently described by Gyenai (2005). The primers used and the optimized conditions for RTPCR are presented in Table 1. The amplicons produced by these primers were estimated to be of expected size using standard agarose gel electrophoresis (Figure 1). Age effect on PLN and cTnT mRNA levels in the heart was significant (P < 0.05). The mRNA levels of cTnT and PLN in the hearts of 14-d-old birds increased about 267 and 231%, respectively, over that in 7-d-old birds on the Fz diet (Table 3). This increase in mRNA also coincides with the age at which the effect of Fz on phenotypes, including dilatation of ventricles, begins to be noticeable (Czarnecki et al., 1973; Gyenai, 2005). These changes with age in mRNA levels in the heart were not observed in the liver. This is not surprising because both PLN and cTnT are considered muscle proteins that would not be expected to be expressed at any significant levels in the liver. The differences in mRNA levels of PLN and cTnT in the heart between affected and unaffected birds were significant only for cTnT (Table 3). The mRNA level of

cTnT in the hearts of affected birds decreased by 61%, whereas that of PLN decreased by only 18%. The sequences of the turkey β-actin and cTnT amplicons showed 99.9 to 100% similarity to the reference sequences in GenBank. The sequence of the chicken PLNbased turkey amplicon showed 98% similarity with the reference chicken PLN cDNA sequence and between 81 and 89% similarity with the PLN mRNA sequence of other species (Table 4). The turkey PLN sequence has been submitted to GenBank and the assigned accession number is DQ_388452. The binding of the primers, the sequence of the RT-PCR amplicon, and the phylogenetic comparisons provide strong evidence that the sequence may be a partial turkey PLN sequence of 124 bp (Table 4). Although several investigations have implicated both cTnT and PLN in the incidence and severity of IDCM, the current work represents the first such implication of these 2 candidate genes in toxin-induced DCM. Similar to PLN expression, cTnT expression has previously been shown to be altered in IDCM-affected animals. Biesiadecki and Jin (2002) reported an abnormal splicing of exon 8 in cTnT of turkeys with inherited DCM. The exclusion of exon 8 results in significant changes in the conformation of cTnT, which alters interactions with other myofilaments and Ca2+ sensitivity of myosin ATPase activity. In IDCM patients, the mRNA level of troponin C, but not cTnT, has been observed to be up-regulated (Grzeskowiak et al., 2003). The PLN gene, implicated in DCM in various species, encodes the PLN protein that regulates the sarcoplasmic

Table 2. Mean and standard error of echocardiographic measurements of treatment and control birds at 7 and 14 d of age Left ventricular end-diastolic dimension Group Treatment (n = 11) Control (n = 7)

7d

Left ventricular end-systolic dimension

14 d

0.72 ± 0.32 0.43 ± 0.14a a

7d

1.12 ± 0.41 0.47 ± 0.14b a

14 d

0.74 ± 0.21 0.42 ± 0.11a a

Measurements in the same column with the same superscript are not different (P > 0.05).

a,b

1.05 ± 0.30a 0.49 ± 0.16b

2219

GENE EXPRESSION AND DILATED CARDIOMYOPATHY

Figure 1. Agarose gel patterns of turkey amplicons produced by primers specific for turkey cardiac troponin T (cTnT), chicken phospholamban (PLN), and chicken β-actin. The sizes of the amplicons, as shown on the gel, are approximated based on the predicted primer binding sites in the turkey (cTnT and β-actin) and chicken (PLN) sequences in GenBank. The amplicons shown here were amplified from 7-d-old birds.

reticulum Ca2+ pump and controls the size of the sarcoplasmic reticulum Ca2+ store during diastole. Our use of the Gallus gallus PLN sequence to evaluate the mRNA level of this gene in the turkey is similar to studies in humans and other species previously described by McTiernan et al. (1999). These investigations relied on regions of the PLN gene that are conserved in many species (Koss and Kranias, 1996). This conservation has made it easier to evaluate PLN in many species, including the dog as recently described by Stabej et al. (2005). Their work showed no association between PLN expression and DCM in dogs. That PLN expression was not found to be significant also appears to be consistent with previous reports of inconsistent association between PLN expression and DCM. For example, overexpression of cardiac PLN in transgenic mice was shown by Dash et al. (2001) to lead to a late-onset type of cardiomyopathy. In humans, however, mRNA expression of PLN decreased significantly (67%) in failing hearts caused by idiopathic DCM. In affected individuals, low levels of PLN mRNA were observed in smooth muscle organs and little or no expression in nonmuscle organs (Schwinger et al., 1995).

Cardiac TnT encodes a protein that is the central subunit of the troponin complex in the thin filament. This protein plays an important role in the sensitivity of the myofilaments to Ca2+ during striated muscle contraction. Abnormalities of this protein caused by mutations disrupt the Ca2+ kinetics in the cell, thus causing myopathy (Venkatraman et al., 2005). Biesiadecki and Jin (2002) reported that an unusually low molecular weight cTnT protein in IDCM-affected turkeys was due to a mutation that causes aberrant splicing in exon 8 of the gene. In summary, the present work describes the first investigation of levels of PLN and cTnT mRNA in TIDCMaffected turkeys. Our results suggest that the mRNA level of cTnT, but not PLN, is altered in turkeys with Fz-induced DCM. The results and the partial PLN sequence produced in this study provide a foundation for future investigations into DCM in the turkey. Additionally, because the cTnT gene encodes a protein that is a component of the cellular cytoskeleton, it suggests a molecular mechanism similar to that in IDCM. Although the mRNA level of PLN was not different in TIDCM, the sudden death syndrome and arrhythmia observed in TIDCM make this

Table 3. Phospholamban (PLN) and cardiac troponin T (TnT) mRNA abundance relative to β-actin in the hearts of turkeys affected and unaffected with dilated cardiomyopathy at 7 and 14 d of age PLN Group Affected (n = 11) Unaffected (n = 7)

7d

TnT 14 d

0.48 ± 0.46 0.51 ± 0.16a a

7d

1.12 ± 0.75 1.47 ± 0.82a a

14 d

0.65 ± 049 0.95 ± 0.33a a

Measurements in the same column with the same superscript are not different (P > 0.05).

a,b

0.8 ± 0.67a 1.9 ± 0.52b

2220

LIN ET AL. Table 4. BLAST-based percentage similarity between the putative partial turkey phospholamban (PLN) cDNA sequence and GenBank PLN sequences Species

Accession no./bp1

Gallus gallus mRNA Homo sapiens mRNA Pig mRNA Dog PLN complete cDNA Rabbit PLN, partial exon 2 Rat

NM_205410.1/3,109 NM_002667/1,712 X15075.1/737 Y00399.1/2,614 M63601.1/858 L03382.1/1,786

Percentage identity (turkey/GenBank)2 98 84 89 87 80 76

(276/279) (84/99) (57/64) (56/64) (80/99) (94/123)

1

Accession number and length (bp) of matched PLN sequences in GenBank. Percentage sequence identity between the partial turkey PLN sequence and the GenBank-matched sequence. The lengths of the turkey/GenBank PLN sequence in the matched region are presented in parentheses. The matched region of the GenBank sequence also corresponds with the coding region, which ranged from 158 to 160 bp for the species included. As expected, the 76 to 90% sequence identity between the partial turkey coding sequence and that of the mammalian species was consistent with that between the chicken PLN coding sequence and those of the 5 mammalian species presented above. 2

gene an important candidate for further investigations. The cDNA sequence first described here provides an opportunity to evaluate PLN, a gene involved in calcium transport by coding for a calcium channel, in both IDCM and TIDCM in the turkey.

ACKNOWLEDGMENTS We would like to acknowledge the staff of the Virginia Tech Turkey Farm for help with the birds. Thanks also to Xiaojing Guan for editorial suggestions. Suggestions by 3 anonymous reviewers resulted in significant improvement of the manuscript from an earlier version. Partial funding for this project was provided by the NHGRI, Virginia Ag. Council, and the USDA Hatch program. The work was in partial fulfillment of the MS degree program by Kuan-Chin Lin.

REFERENCES Ali, B. H. 1989. Pharmacology and toxicity of furazolidone in man and animals: Some recent research. Gen. Pharmacol. 20:557–563. Biesiadecki, B. J., and J. P. Jin. 2002. Exon skipping in cardiac troponin T of turkeys with inherited dilated cardiomyopathy. J. Biol. Chem. 277:18459–18468. Biesiadecki, B. J., K. L. Schneider, Z. Yu, S. M. Chong, and J. Jin. 2004. An R111c polymorphism in wild turkey cardiac troponin I accompanying the dilated cardiomyopathy-related abnormal splicing variant of cardiac troponin T with potentially compensatory effects. J. Biol. Chem. 279:13825– 13832. Czarnecki, C. M., E. F. Jankus, and B. D. Hultgren. 1973. Effects of furazolidone on the development of cardiomyopathies in turkey poults. Avian Dis. 18:125–133. Dash, R., V. Kadambi, A. G. Schmidt, N. M. Tepe, D. Biniakiewicz, M. J. Gerst, A. M. Canning, W. T. Abraham, B. D. Hoit, S. B. Liggett, J. N. Lorenz, G. W. Dorn, and E. G. Kranias. 2001. Interactions between phospholamban and beta-adrenergic drive may lead to cardiomyopathy and early mortality. Circulation 103:889–896. Durand, J. B. 1999. Genetic basis of dilated cardiomyopathy. Curr. Opin. Cardiol. 14:225–233. Fatkin, D., and R. M. Graham. 2002. Molecular mechanisms of inherited cardiomyopathies. Physiol. Rev. 82:945–980. Frame, D. D., R. E. Buckner, and G. L. Anderson. 1999. Causes and control of spontaneous cardiomyopathy or roundheart

disease in Utah turkeys. http://extension.usu.edu/files/ publications/publication/AG_506.pdf Accessed Mar. 2006. Genao, A., K. Seth, U. Schmidt, M. Carles, and J. K. Gwathmey. 1996. Dilated cardiomyopathy in turkeys: An animal model for the study of human heart failure. Lab. Anim. Sci. 46:399–404. Grzeskowiak, R., H. Witt, M. Drungowski, R. Thermann, S. Hennig, A. Perrot, K. J. Osterziel, D. Klingbiel, S. Scheid, and R. Spang. 2003. Expression profiling of human idiopathic dilated cardiomyopathy. Cardiovasc. Res. 59:400–411. Gyenai, K. B. 2005. Genetic analysis of toxin-induced dilated cardiomyopathy in the turkey (Meleagris gallopavo). MS Thesis. Virginia Tech, Blacksburg. Hajjar, R. J., R. Liao, J. B. Young, F. Fuleihan, M. G. Glass, and J. K. Gwathmey. 1993. Pathophysiological and biochemical characterization of an avian model of dilated cardiomyopathy: Comparison to findings in human dilated cardiomyopathy. Cardiovasc. Res. 27:2212–2221. Koss, K. L., and E. G. Kranias. 1996. Phospholamban: A prominent regulator of myocardial contractility. Circ. Res. 79:1059–1063. Liew, C., and V. J. Dazu. 2004. Molecular genetics and genomics of heart failure. Nature 5:811–825. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using Real-Time quantitative PCR and the 2−䉭䉭CT Method. Methods 25:402–408. McTiernan, C. F., C. S. Frye, B. H. Lemster, E. A. Kinder, M. L. Ogletree-Hughes, C. S. Moravec, and A. M. Feldman. 1999. The human phospholamban gene: Structure and expression. J. Mol. Cell. Cardiol. 31:679–692. Paxton, C. N., M. E. Pierpont, and D. L. Kooyman. 2005. Identification of AFLP markers associated with round heart syndrome in turkeys. Int. J. Poult. Sci. 4:133–137. Poller, W., U. Kuhl, C. Tschoepe, and M. Pauschinger. 2005. Genome-environment interactions in the molecular pathogenesis of dilated cardiomyopathy. J. Mol. Med. 83:579–586. Rozen, S., and H. J. Skaletsky. 1997. Primer3. Code available at http://frodo.wi.mit.edu/cgi-bin/primer3/ primer3_www.cgi Accessed Feb. 2005. SAS Institute. 2002–2003. SAS software. Version 9.1. SAS Institute, Inc., Cary, NC. Schmitt, J. P., M. Kamisago, M. Asahi, G. H. Li, F. Ahmad, U. Mende, E. G. Kranias, D. H. MacLennan, J. G. Seidman, and C. E. Seidman. 2003. Dilated cardiomyopathy and heart failure caused by a mutation in phospholamban. Science 299:1410–1413. Schwinger, R. H. G., M. Bohm, U. Schmidt, P. Karczewski, U. Bavendiek, M. Flesch, E. Krause, and E. Erdmann. 1995. Unchanged protein levels of SERCA II and phospholamban but reduced Ca2+ uptake and Ca2+-ATPase activity of cardiac sarcoplasmic reticulum from dilated cardiomyopathy pa-

GENE EXPRESSION AND DILATED CARDIOMYOPATHY tients compared with patients with non-failing hearts. Circulation 92:3220–3228. Smith, E. J., T. Geng, E. Long, F. W. Pierson, D. P. Sponenberg, C. Larson, and R. Gogal. 2005. Molecular analysis of the relatedness of five domesticated turkey strains. Biochem. Genet. 43:35–48. Stabej, P., P. A. Leegwater, A. A. Stokhof, A. Domanjko-Petric, and B. A. van Oost. 2005. Evaluation of the phospholamban gene in purebred large-breed dogs with dilated cardiomyopathy. Am. J. Vet. Res. 66:432–436. Toyofuku, T., and R. Zak. 1991. Characterization of cDNA and genomic sequences encoding a chicken phospholamban. J. Biol. Chem. 266:5375–5383.

2221

Venkatraman, G., A. V. Gomes, W. G. L. Kerrick, and J. D. Potter. 2005. Characterization of troponin T dilated cardiomyopathy mutations in the fetal troponin isoform. J. Biol. Chem. 280:17584–17592. White, A. H. 1989. Absorption, distribution, metabolism, and excretion of Furazolidone. Scand. J. Gastroenterol. 169:4–10. Wu, D., J. Lin, Y. Chiu, C. Cheng, C. Shyu, K. Ueng, and C. Huang. 2003. Pathological and biochemical analysis of dilated cardiomyopathy of broiler chickens—An animal model. Chin. J. Physiol. 46:19–26. Zepeda, E. A., and D. L. Kooyman. 2002. Breeding trial based on RAPD analysis of turkey spontaneous cardiomyopathy. Plant, Anim., Microbe Genomes X Conf., San Diego, CA. Scherago Int. Inc., Jersey City, NJ.