Preliminary characterization of complement in a ...

Developmental and Comparative Immunology 46 (2014) 430–438

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Preliminary characterization of complement in a colonial tunicate: C3, Bf and inhibition of C3 opsonic activity by compstatin Nicola Franchi ⇑, Loriano Ballarin Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35100 Padova, Italy

a r t i c l e

i n f o

Article history: Received 9 April 2014 Revised 19 May 2014 Accepted 20 May 2014 Available online 27 May 2014 Keywords: Comparative immunobiology, Complement Evolution Immune response Invertebrates Phagocytosis

a b s t r a c t The complement system is a fundamental effector mechanism of the innate immunity in both vertebrates and invertebrates. The comprehension of its roots in the evolution is a useful step to understand how the main complement-related proteins had changed in order to adapt to new environmental conditions and life-cycles or, in the case of vertebrates, to interact with the adaptive immunity. Data on organisms evolutionary close to vertebrates, such as tunicates, are of primary importance for a better understanding of the changes in immune responses associated with the invertebrate-vertebrate transition. Here we report on the characterization of C3 and Bf transcripts from the colonial ascidian Botryllus schlosseri (BsC3 and BsBf, respectively), a reliable model organism for immunobiological research, and present a comparative analysis of amino acid sequences of C3s and Bfs suggesting that, in deuterostomes, the structure of these proteins remained largely unchanged. We also present new data on the cells responsible of the expression of BsC3 and BsBf showing that cytotoxic immunocytes are the sole cells where the relative transcripts can be found. Finally, using the C3 specific inhibitor compstatin, we demonstrate the opsonic role of BsC3 in accordance with the idea that promotion of phagocytosis is one of the main function of C3 in metazoans. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction As a key component of both innate and adaptive immune response, the complement system of vertebrates plays an important role in host defense and in the clearance of apoptotic cells (Kohl, 2006; Korb and Ahearn, 1997; Sjöberg et al., 2009, 2008). It is a highly sophisticated immune machinery in which more than 30 different proteins act together to face potential pathogens having entered the host circulation (Sarma and Ward, 2011); in addition it is the orchestrator of hundreds of factors involved in non-self recognition and clearance (Dunkelberger and Song, 2010; Molina et al., 1996; Qu et al., 2009; Riley-Vargas et al., 2005). In vertebrates, three complement activation pathways are known: the classical, the lectin and the alternative pathway. Each of them include at least one molecule able to recognize and bind the microbial surface and an associated serine-protease which, once activated, cleaves C3 into C3a and C3b. C3 represents the ‘‘heart’’ of the complement system for its capacity to exert an opsonizing role through the direct binding of C3b to microbial surfaces, but it is also able to recruit immunocytes to the infection site through the release of C3a and, eventually, activate the lytic ⇑ Corresponding author. Tel.: +39 0498276196; fax: +39 0498276199. E-mail address: [email protected] (N. Franchi). http://dx.doi.org/10.1016/j.dci.2014.05.014 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

pathway that leads to the formation of the membrane attack complex (MAC) on the microbial surface with the final lysis of the foreign cells. In the alternative pathway, C3b requires the interaction with the B factor (Bf) protease to form the C3 convertase which enhances the formation of C3b and C3a. The binding of C3b to the active convertase changes the substratum specificity of the enzyme complex which starts to cleave C5 to C5a and C5b, the latter initiating the formation of the MAC. The lectin pathway starts with the recognition of sugars on the microbial surface by collectins such as the mannose-binding lectins (MBLs) or the ficolins which, in turn, activate the MBL-associated serine proteases (MASPs); the latters, then, cleave C3 to C3b and C3a (Wallis, 2007). The classical pathway, unlike the lectin and the alternative ones, starts with the recognition of microbes by antibodies; they interacts with C1q which is associated with two serine proteases (C1r and C1s), found only in Vertebrates (Walport, 2001). In recent years the interest of the comparative immunobiologist towards the evolution of the complement system and its activation pathways has progressively increased and, today, members of the complement system are known in all the Eumetazoan phyla and component of the alternative and lectin pathways have been founds also in basal metazoans such as Cnidarians (Dishaw et al., 2005; Kimura et al., 2009).

431

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

C3 and Bf have been identified in many invertebrates (Brown et al., 2013; Kimura et al., 2009; Sahoo et al., 2013; Zhong et al., 2012): the study of these molecules and their expression in Metazoans is of great interest and can provide clues to understand how, during evolution, they modified their relationships with other complement-related proteins and their role in host defense. In addition, invertebrates phylogenetically close to vertebrates could help to elucidate the evolutionary changes in the complement components associated with the appearance of adaptive immunity. Urochordates or Tunicates are marine animals belonging to the phylum Chordata, representing the sister group of Vertebrates (Delsuc et al., 2006) and, therefore, considered valuable model organisms for the study of the evolutionary changes of immune responses associated with the invertebrate-vertebrate transition. In Tunicates, genes for putative complement components have been identified in the solitary ascidians Ciona intestinalis and Halocynthia roretzi: they include C3 (Marino et al., 2002; Nonaka et al., 1999), Bf (Azumi et al., 2003; Yoshizaki et al., 2005), MBL (Bonura et al., 2009), ficolin (Kenjo et al., 2001) and MASPs (Ji et al., 1997; Melillo et al., 2006). The recombinant fragment C3a of C. intestinalis was shown to exert chemotactic activity towards hemocytes; the use of specific antibodies demonstrated that C3 and C3a are localized in Ciona hemocytes and that their synthesis increased after injection of LPS in the tunic (Giacomelli et al., 2012; Green et al., 2003). Collectins were also identified, by biochemical analysis, in the hemolymph of Styela plicata: even in this case, the use of specific antibodies allowed the localization of these molecules in hemocytes and evidenced an increase in the frequency of immunopositive cells after the injection of zymosan in the body wall (Green et al., 2006). Botryllus schlosseri is a colonial ascidian considered a reliable model organism for the study of immune responses (Ballarin, 2008). In a colony, zooids are grouped in star-shaped systems and connected by a common vasculature, crossing the tunic, which synchronize their development. Cyclical generation changes occur during which old zooids are replaced by their buds that grow to adulthood (Lauzon et al., 2002; Manni et al., 2007). Circulating immunocytes, represented by phagocytes and cytotoxic morula cells (MCs), are the effectors of immune responses in Botryllus (Ballarin et al., 2001). Phagocytes release lectins that reduce the spreading of microbes (Franchi et al., 2011b; Gasparini et al., 2008) whereas MCs produce cytokines able to recruit immunocytes and induce inflammatory reactions (Menin and Ballarin, 2008). Although many papers have dealt with the role of hemolymph and hemocytes in immune responses of B. schlosseri, no data are available, up to date, on complement in this species and its involvement in Botryllus immunity. In the present paper, we report the identification and the characterization of C3 and Bf of B. schlosseri. We studied the transcription of the respective genes, in control conditions and after hemocyte exposure to zymosan, and the localization of B. schlosseri C3 and Bf mRNAs in histological sections and hemocyte smears. In addition, we demonstrated that the C3-inhibitor compstatin interferes with the phagocytosis of yeast cells. 2. Materials and methods 2.1. Animals and zymosan treatment Large colonies of B. schlosseri were collected in the southern Lagoon of Venice, near Chioggia, acclimated in aerated aquaria filled with filtered seawater (FSW) at the constant temperature of 19 °C, for 5 days, fed with Liquifry marine (Liquifry Co., Dorking, UK). Hemolymph was collected with a glass micropipette, after puncturing the tunic vasculature of colonies with a fine tungsten

needle, and equally distributed in 6 vials. Colonies were previously immersed for 5 min in 0.38% Na-citrate in FSW, pH 7.2, to prevent hemocyte clumping. Hemolymph was centrifuged for 10 min at 800 x g and pellets were resuspended in FSW, with or without zymosan (1 mg/ml), to get a final hemocyte concentration of 1.5  106 cells/ml. Two cell batches, resuspended in FSW, were used as controls (0 and 60 min) whereas the other four batches were incubated for 15, 30, 45 and 60 min with zymosan. After the treatments, cells were centrifuged again and pellets were processed for RNA extraction as described below. 2.2. RNA extraction and reverse transcription Total RNA was isolated from the hemocytes of B. schlosseri with the SV Total RNA Isolation System (Promega); its purity was determined by the A260/280 and A260/230 ratio. RNA integrity was determined by visualization of rRNAs in ethidium bromidestained agarose gels (1.5%). The first strand of cDNA was reversetranscribed from 1 lg of total RNA at 42 °C for 1 h in a 20 ll reaction mixture containing 1 ll of ImPromII Reverse Transcriptase (Promega) and 0.5 lg oligo(dT)-Anchor primer or random primers (Promega). 2.3. Amplification, cloning and sequencing Amplification and cloning of transcripts for B. schlosseri C3 (BsC3) and B. schlosseri Bf (BsBf) was achieved with specific primers designed on sequences found in our EST collection and in the database of the B. schlosseri Genome Project (http://genepyramid. stanford.edu/botryllusgenome/). In both cases the obtained EST sequences contained 50 terminal untranslated region and the entire coding region. The 30 rapid amplification of the cDNA ends (RACE) was performed using the 2nd Generation of the 50 /30 RACE Kit (Roche). In order to obtain the 30 sequences of BsC3 and BsBf cDNA, four specific primers, BsC3F1, BsC3F2, BsBfF1 and BsBfF2 (Table 1), were designed for nested PCR with anchor reverse primer according to the manufacturer’s instruction (Roche). To study the location of BsC3 and BsBf through in situ hybridization (ISH), four specific primers, BsC3F3, BsC3R1, BsBfF3 and BsBfR1, were designed. Four additional specific primers, BsC3F4, BsC3R2, BsBfF4 and BsBfR2 (Table 1), were designed to perform the relative RealTime-PCR (rRT-PCR). PCR reactions were carried out in a 25-ll reaction volume containing 100 ng of cDNA from B. schlosseri hemocytes, 2.5 ll of 10 incubation buffer with 15 mM MgCl2 (GeneSpin), 0.25 lM of each primer, 10 mM of each of the deoxynucleotide triphosphates, and 2 units of Taq polymerase (GeneSpin). PCR was performed on a MyCycler (BioRad) thermocycler as follows: 94 °C for 2 min, then

Table 1 PCR primers used. Primer

Sequence 50 –30

BsC3F1 BsC3F2 BsC3F3 BsC3R1 BsC3F4 BsC3R2 BsBfF1 BsBfF2 BsBfF3 BsBfR1 BsBfF4 BsBfR2 BsActF BsActR

AGAAAGCCAAGTGCCAGAAG CACTACAGGCGTTTTCGTGA CCGAAAAGCCGATAAACATCCC CGTGATCGCCTTCCTTCAAC CACGCCTACTGGTATCAACG TCTCCTGAGTGGGACCAGTC GACGCTGTAGGCATCATCAA ACCCAAAGGAGAGTTGTGGA GACTTGTCGATCAGCGTGAA GACGAGAATGTGTCGCTTGA CCGCCGCTGCCGATATTTCC CAGTCGGTAAAGCCTCGTAAC ACTGGGACGACATGGAGAAG GCTTCTGTGAGGAGGACAGG

432

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

40 cycles of 94 °C for 30 s, 55–60 °C for 30 s, 72 °C for 40 s, and 72 °C for 10 min. The amplicons were analyzed by electrophoresis on 1.5% agarose gel containing ethidium bromide and subsequently cloned into the pGEM-T Easy Vector (Promega). Positively screened clones were sequenced at BMR Genomics (University of Padova) on an ABI PRISM 3700 DNA Analyzer (Applied Biosystems, Carlsbad, CA). 2.4. Sequence alignment and phylogenetic analysis Sequence alignment and phylogenetic analysis were performed on predicted C3 and Bf amino acid sequences of deuterostomes downloaded from GeneBank (Supplementary 1). Full-length protein sequences were aligned by the ClustalX program (Jeanmougin et al., 1998) and the domain structures and organization were predicted with SMART algorithm (Letunic et al., 2012). The Poisson model of amino acid substitutions was used to calculate the genetic distances among the C3 and Bf. The Unweighted Pair Group Method with Arithmetic Mean (UPGMA; Sneath and Sokal, 1973) and other non-distance-based phylogeny reconstruction methods, such as neighbor-joining (NJ; Saitou and Nei, 1987), minimum evolution (ME; Rzhetsky and Nei, 1992) and maximum parsimony (MP; Fitch, 1971), were applied to construct phylogenetic trees with the MEGA 5 software (Tamura et al., 2007). The robustness of tree topologies was tested by the nonparametric bootstrap test (Felsenstein, 1985). Ten thousand replicates were performed in all analyses. 2.5. rRT-PCR The transcription of bsc3 and bsbf was studied by rRT-PCR using the SYBR green method (FastStart Universal SYBR Green MasterROX, Roche). Forward and reverse primers for BsC3 (BsC3F4 and BsC3R2, respectively), BsBf (BsBfF4 and BsBfR2, respectively) and B. schlosseri b-actin (BsActF and BsActR, respectively; Table 1) genes, the latter used as housekeeping gene, were designed and synthesized by Sigma Aldrich. rRT-PCR analysis was performed using Applied Biosystems 7900 HT Fast Real-Time PCR System after extraction of total RNA and retro-transcription as described above. Each set of samples was run three times and each plate contained three cDNA samples and negative controls. The amplification efficiencies of the target and reference genes were approximately equal validating the 2DDCt calculation (Pfaffl, 2001). The amounts of bsc3 and bsbf transcripts in different conditions were normalized to actin in order to compensate for variations in the amounts of cDNA. 2.6. ISH Amplicons obtained with BsC3F3-BsC3R1 and BsBfF3-BsBfR1 primers were cloned as previously described and used as templates for sense and anti-sense RNA probes using T7 and Sp6 RNA polymerase. ISH was performed on entire colony sections and hemolymph. Colonies were fixed in 4% paraformaldehyde in RNase-free PBS at 4 °C for 10–16 h, rinsed in phosphate-buffered saline (PBS: 1.37 M NaCl, 0.03 M KCl, 0.015 M KH2PO4, 0.065 M Na2HPO4, pH 7.2) containing 0.1% Tween 20 (PBST), and if necessary, cut into small pieces. Specimens were then dehydrated in a graded series of ethanol, dewaxed in xylene for 30 min, rehydrated and, after conventional treatment with proteinase K and post fixation, they were hybridized with the digoxigenin (DIG)-labeled antisense RNA probe for 12–14 h at 58 °C. As a negative control, a Dig-labeled sense probe was used. After thorough washing, samples were incubated in the blocking solution (1% skimmed milk in Tris-buffered salt solution (TBS): 50 mM Tris–HCl, 150 mM NaCl, pH 7.4)

containing 0.1% Tween 20 (TBST) for 6 h in an ice bath, and then treated overnight, with anti-DIG monoclonal antibody labeled with alkaline phosphatase (Roche) on ice. Samples were stained with NBT/BCIP solution, dehydrated, and embedded in Paraplast X-TRA (Sigma Aldhrich). Histological sections were finally mounted with Eukitt (Electron Microscopy Sciences) and observed under an Olympus CX31 light microscope (LM). Hemolymph was collected as described elsewhere (Franchi et al., 2011b) and hemocytes were left to adhere for 30 min on Superfrost Plus (Menzel-Glaser) slides. They were then prehybridized and hybridized as described elsewhere (Ballarin et al., 2012). Briefly, cells were fixed for 30 min in freshly prepared MOPS buffer (0.1 M MOPS, 1 mM MgSO4, 2 mM EGTA, 0.5 M NaCl) and 4% paraformaldehyde. Hemocyte monolayers were prehybridized in Hybridization Cocktail 50% Formamide (Amresco) for 1 h at 60 °C and then hybridized in the same solution overnight at 58 °C with 2 lg/ml biotin-labelled riboprobe. Slides were then mounted with Acquovitrex (Carlo Erba) and observed under the LM at 1250. 2.7. Phagocytosis assay Hemocytes, collected as described above, were left to adhere for 30 min on coverslips and cells were then incubated for 60 min at room temperature with 60 ll of a suspension of yeast (Saccharomyces cerevisiae) cells (yeast:hemocyte ratio = 10:1) in FSW containing 50 and 100 lM compstatin (TOCRIS Bioscience). Hemocyte monolayers were then gently washed several times in FSW to eliminate uningested yeast, fixed in 4% paraformaldehyde in 0.2 M Na-cacodylate buffer containing 1% NaCl and 1% sucrose, washed in PBS, stained with 10% Giemsa and mounted on glass slides with Acquovitrex. Slides were observed under the LM at 1250 and the percentage of phagocytosing cells was evaluated. Control hemocytes were incubated with FSW. 2.8. Hemocyte viability assay To estimate the effects of compstatin on hemocyte viability, after the incubation with the inhibitor, cell monolayers were incubated with 0.25% Trypan Blue in FSW for 5 min at room temperature and observed in vivo under the LM at 1250. The frequency of blue (=dead) cells was finally evaluated. 2.9. Statistical analysis Each experiment was replicated at least three times (n = 3) with three independent blood samples; data are expressed as mean ± SD. At least 300 cells in 10 optical fields at 1250 were counted under the LM for each experiment. Indexes were compared with the v2 test, with the exception of the rRT PCR experiments, the results of which were compared with the Student’s t-test. 3. Results 3.1. Gene and transcript organization The bsc3 transcript is 5512 bp in length and contains a coding sequence (CDS) of 5341 bp, with 50 UTR and 30 UTR regions of 63 bp and 108 bp, respectively. The structure of the gene was analyzed comparing the cDNA and the genomic sequences. It includes 43 exons with the ATG start codon located in the first exon and the TAA stop codon in the last one. All the intron are provided of the canonical GT and AG splicing signal consensus (Supplementary 2). The bsbf transcript is 3666 bp in length and contains a coding sequence (CDS) of 3300 bp, with 50 UTR and 30 UTR regions of 19 bp and 347 bp, respectively. The corresponding gene includes

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

20 exons with the ATG start codon in the first one and the TGA stop codon in the last. All the introns are provided with the canonical GT and AG splicing signal consensus (Supplementary 2).

433

(position 171–240, 292–346, 351–414 and 423–481, respectively), a von Willebrand factor (vWF) type A domain (VWA, position 523–721) and a C-terminal trypsin-like serine protease (Tryp_Spc) domain (position 747–1088) (Fig. 2) .

3.2. Protein organization 3.3. Hemocyte mRNA transcription and localization The in silico translation of bsc3 results in a putative protein of 1779 amino acids that, once aligned with other deuterostome C3s, shows a percentage of identity ranging from 32,6% (C. intestinalis) to 22,8% (Swiftia exserta; Supplementary 1). The result of domain prediction indicates that B. schlosseri C3 has a signal peptide (residues 1–20) followed by two a2-macroglobulin domains at the N-terminal (a2-M N and a2-M N2, at positions 127–225 and 490–625, respectively) typical of the complement protein, one median a2-macroglobulin domain (a2-M M, residues 781–871) the C3/C4/C5 domain with the a-macroglobulin complement component (position 1007–1324), one a-macroglobulin receptor domain (position 1450–1541) and a NTR-like domain similar to the C345C domain of other deuterostomes (position 1611–1736); no C3a anaphylatoxin domains (ANATO; anaphylatoxin homologous domain) are recognized (Fig. 1). By comparing multiple alignment of the predicted amino acid sequence of BsC3 with other deuterostome C3, we were able to recognize the amino acids of the cleavage site that generate the a and b chain of C3b (RKKR, position 240–243) and the two Cys residue that link a and b chain, in position 135 and 376, respectively. The two amino acid residues (RS, position 329–330) responsible of the cleavage sites that generate C3a are fully conserved as well as the amino acids involved in the thioester bond with the microbial surface (PGGCGEQTM, residues 569–577) (Supplementary 3). The in silico translation of bsbf results in a putative protein of 1099 amino acids that, once aligned with other deuterostome Bfs, shows a percentage of identity ranging from 37,1% (C. intestinalis) to 22.2% (Apostichopus japonicus; Supplementary 1). The result of domain prediction showed that BsBf had a signal peptide (position 1–20) followed by 4 complement control protein (CCP) domains

After a gradual increase of mRNA transcription at 15 and 30 min, bsc3 mRNA level reached its maximum level (3 times the T0 control) after 45 min of zymosan incubation and remained unchanged at 60 min (Fig. 3A). The transcription of bsbf showed little fluctuation between 30 and 60 min of zymosan incubation with a peak at 45 min approximately twice the control. The same transcription level was detected in the controls after 60 min (Fig. 3B). The ISH indicated that only MCs are active in the transcription of both bsc3 and bsbf mRNA (Fig. 4). The percentage of cells involved in the basal transcription of bsc3 amounted to 30.1% ± 4.3. This percentage did not change after 60 min of incubation with zymosan, and reached a maximum of 65.9% ± 19.4 of cells positive to the BsC3 riboprobe after incubation with zymosan and compstatin (Fig. 5). 3.4. Effect of compstatin on hemocytes In the presence of 50 and 100 lM compstatin, the viability of the hemocytes did not change with respect to controls and mortality never exceed the value of 3% (Fig. 6A). Conversely, the fraction of phagocytosing cells amounted to 9.6% ± 1.2 in controls and significantly (p < 0.001) decreased to 2.7% ± 1.3 and 1.7% ± 1.0 in the presence of 50 and 100 lM compstatin, respectively (Fig. 6B). 3.5. Phylogenetic analyses Fig. 7A shows the tree obtained with NJ method rooted with Cnidarians C3s: vertebrate C3s cluster in the right phylogenetic

Fig. 1. Schematic deuterostome domain organization of C3 proteins. a2-M N: N terminal alpha-macroglobulin domain; a2-M N: N terminal alpha-macroglobulin domain 2; ANATO: anaphylatoxin homologous domain; a2-M M: median alpha-macroglobulin domain; a2-M complement: alpha-macroglobulin complement component; a2-M rece: alpha-macroglobulin receptor; NTR/C345C: NTR/C345C domain. Numbers refer to the length of the amino acid sequences.

434

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

Fig. 2. Schematic deuterostome domain organization of Bf proteins. CCP: complement control protein; VWA: vWA complement factor; Tryp_SPc: trypsin-like serine protease. Numbers indicate the length of the amino acid sequences.

Fig. 3. Relative expression levels of bsc3 (A) and bsbf (B) in various experimental conditions. Relative gene expression levels are shown with respect to untreated control (FSW 0). Normalization of expression was achieved using endogenous b-actin as housekeeping gene. Each bar of the histograms corresponds to the average of three independent experiments ±SD. Different letters mark significant (p < 0.05) differences.

position, together with the representatives of Monotremes, Amphibians, Teleosts and Cyclostomes: Ornithorhyncus anatinus is in basal position within vertebrates, Xenopus tropicalis is basal to Reptiles, Danio rerio is basal to tetrapods and Lethenteron camtschaticum is basal to Gnathostomes. All Tunicates cluster together, as sister-group of vertebrates, while the other deuterostomes constitute a well-supported group without distinction between Echinoderms and Cephalochordates. Fig. 7B shows the phylogenetic relationships among the most representative deuterostome complement Bfs. Invertebrate deuterostomes are grouped together, with Tunicates well separated from Echinoderms and Cephalochordates. In the vertebrate clade, there are some problems with representatives of Amphibians, Reptiles and Chondrosteans with low scores or unresolved nodes.

Similar topologies have been obtained with all the used phylogenetic inference methods. 4. Discussion In the present work, we have identified two components of the compound ascidian B. schlosseri complement activation cascade: BsC3 and BsBf. They appear similar to the vertebrate components and, in both proteins, the domain structure and organization are fully conserved. In BsC3, all the canonical aminoacids involved in the proteolysis, activation and binding of the different subunits can be found. The only exception is represented by the C3a ANATO domain, which is not recognized in the B. schlosseri sequence as well as in those of C. intestinalis and Strongylocentrotus purpuratus.

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

435

Fig. 4. ISH with riboprobes for bsc3 (A–E) and bsbf (A0 –E0 ) on paraffin sections (A, A0 , B, B0 ) and haemocyte monolayers (C–E, C0 –E0 ). A–B, D–E: bsc3 antisense riboprobe; C: bsc3 sense riboprobe; A0 –B0 , D0 –E0 : bsbf antisense riboprobe; C0 : bsbf sense riboprobe. A, A0 : section of B. schlosseri whole colony at magnification100; B, B0 : section of B. schlosseri whole colony at 400. D, D0 : stained morula cells at 1000. E, E0 ; stained morula cells at 400. Dark arrowheads: morula cells. Open arrowheads: phagocytes. Scale bar: A, A0 : 400 lm; B, B0 , E, E0 100 lm; C, C0 , D, D0 10 lm.

Probably, it is a problem of domain registration since it was demonstrated that C. intestinalis and Pyura stolonifera have a functional C3a with the typical chemo-attractive feature (Pinto et al., 2003; Raftos et al., 2003).

In BsBf, the C-terminal is well conserved with respect to deuterostomes. Conversely, the N-terminal part shows differences between vertebrates and invertebrate deuterostomes, the latter including a higher number of CCP domains.

436

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

Fig. 5. Percentage of hemocytes positive to the BsC3 riboprobe incubated for 60 min in FSW (controls), zymosan-containing FSW and in FSW containing zymosan and 100 lM compsatin. Asterisks mark significant differences with control; ⁄⁄⁄p < 0.001.

Fig. 6. (A) Effects of compstatin on hemocyte mortality; (B) effects of compstatin on phagocytosis. Significant differences with respect to controls (Ctrl) are marked by asterisks. ⁄⁄⁄p < 0.001.

The evolutionary reconstruction shows that phylogenetic relationships among the different deuterostome C3s and Bfs fit the known evolution of the different taxa. This evidence reinforces the idea that C3 and Bf did not undergo evolutionary pressures to adapt to new functions. In mammals and teleosts, C3 and Bf are mainly expressed in liver (Alper et al., 1969; Zhou et al., 2012) and immunocytes (Lambris, 1988). Ascidians have no liver, but we have recently demonstrated that, in C. intestinalis, detoxification molecules, such as CiMT-1 and CiSOD1, had unique expression in granular amoebocytes (Ferro et al., 2013; Franchi et al., 2011a, 2012). In the same immunocyte type, Marino and colleagues (2002) localized the expression site of CiC3-1 and CiC3-2, supporting the idea that Urochordates performs detoxification trough the same hemocytes involved in immune response. However, no studies have been carried out, up to now, to identify all C3-producing tissues in ascidians. Our ISH analysis indicates that, in B. schlosseri, hemocytes are the sole source of BsC3 and BsBf mRNA; in addition, analogously to C. intestinalis, we recognized in the compartment immunocytes, known as MCs, the expression site of both bsc3 and bsbf, in accordance with the role of immuno-surveillance of C3 already described in mammals (Holers, 2014) and the immunomodulatory role of Botryllus MCs (Ballarin et al., 2001). The fraction of MCs involved in the expression of bsc3 gene amount to 30% both in controls and in zymosan-exposed hemocytes, whereas a sensible increase of bsc3, but not of bsbf, transcription has been reported by rRT-PCR leading to the idea that, after PAMP recognition, the rise in C3 transcription is due to the same MC population that maintain the basal level of C3. The different behavior of bsc3 and bsbf in the presence of zymosan is probably due to the higher request for C3 that is also required in the lectin pathway: concerning this point, evidences of the existence of MBL and MASP in the genome of the ascidian C. intestinalis have been recently reported (Bonura et al., 2009) as well as in the recent publication of the genome of B. schlosseri (Voskoboynik et al., 2013). In the ascidian H. roretzi, C3 acts as humoral opsonin. In fact, incubation of yeast with hemolymph containing HrC3 leads to a significant increase in phagocytosis activity by hemocytes. This activity is abolished by the anti-HrC3 antibody (Nonaka et al.,

Fig. 7. Evolutionary relationships (NJ) among deuterostome C3s (A) and Bfs (B). Similar topologies were obtained with ME and UPGMA. Bootstrap confidence values are indicated at the left of each branch. Accession numbers reported in Supplementary 1.

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

1999). The use of the C3-specific inhibitor compstatin, a 13-residue cyclic peptide able to inhibit the cleavage of C3 (Sunyer and Tort, 1995), allowed us to demonstrate a similar role of BsC3. At the same concentrations used in other research (Ricklin and Lambris, 2008), the peptide did not result toxic for B. schlosseri hemocytes and significantly decreased the phagocytosis capability of B. schlosseri circulating cells. Unexpectedly, the number of MCs positive to BsC3 antisense riboprobe significantly grows after the addition of compstatin: this can be related to the need to restore the level of available C3 in the hemolymph, in the form of C3a or C3b, as a consequence of the block of C3 activation by compstatin, with consequent triggering of the transcription of the BsC3 gene in a higher number of cells. This suggests a possible feedback control on the levels of C3 trough the interaction with C3a- and/or C3b-receptors. As regards the C3 expression sites, in echinoderms C3 is expressed by phagocytes (Gross et al., 2000), whereas in C. intestinalis C3 mRNA is located in compartment cells (Marino et al., 2002), the same cells responsible of the synthesis of cytokines able to influence the activity of phagocytes (Arizza and Parrinello, 2009). Our data, showing that C3, released by MCs, is able to influence phagocytosis, fit the idea of a cross-talk between MCs and phagocytes which influence the respective activities. In agreement with this idea, in our previous papers, we demonstrated that activated MCs can influence the activity of phagocytes (Menin et al., 2005) and that phagocytes, once activated, can influence MC activity through the release of a rhamnose-binding lectin (Menin and Ballarin, 2008; Franchi et al., 2011b). This is the first report on compstatin activity in an invertebrate. Our results indicate that the compound ascidian B. schlosseri can be considered as a useful tool for the functional investigation of complement and its evolution and adaptation to adaptive immunity. In addition, they represent a first step towards the comprehension of the complexity of the complement system in B. schlosseri and its role in immune responses. Future investigations will be directed to the analysis of the lectin pathway and its related molecules. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dci.2014.05.014. References Alper, C.A., Johnson, A.M., Birtch, A.G., Moore, F.D., 1969. Human C3: evidence for the liver as the primary site of synthesis. Science 163, 286–288. Arizza, V., Parrinello, D., 2009. Inflammatory hemocytes in Ciona intestinalis innate immune response. Invert. Surviv. J. 6, S58–S66. Azumi, K., De Santis, R., De Tomaso, A., Rigoutsos, I., Yoshizaki, F., Pinto, M.R., Marino, R., Shida, K., Ikeda, M., Ikeda, M., Arai, M., Inoue, Y., Shimizu, T., Satoh, N., Rokhsar, D.S., Du Pasquier, L., Kasahara, M., Satake, M., Nonaka, M., 2003. Genomic analysis of immunity in a Urochordate and the emergence of the vertebrate immune system: ‘‘waiting for Godot’’. Immunogenetics 55, 570–581. Ballarin, L., Franchi, N., Schiavon, F., Tosatto, S.C., Micˇetic´, I., Kawamura, K., 2012. Looking for putative phenoloxidases of compound ascidians: haemocyanin-like proteins in Polyandrocarpa misakiensis and Botryllus schlosseri. Dev. Comp. Immunol. 38, 232–242. Ballarin, L., Franchini, A., Ottaviani, E., Sabbadin, A., 2001. Morula cells as the main immunomodulatory haemocytes in ascidians: evidences from the colonial species Botryllus schlosseri. Biol. Bull. 201, 59–64. Ballarin, L., 2008. Immunobiology of compound ascidians, with particular reference to Botryllus schlosseri: state of art. Invert. Surviv. J. 5, 54–74. Bonura, A., Vizzini, A., Salerno, G., Parrinello, N., Longo, V., Colombo, P., 2009. Isolation and expression of a novel MBL-like collectin cDNA enhanced by LPS injection in the body wall of the ascidian Ciona intestinalis. Mol. Immunol. 46, 2389–2394. Brown, T., Bourne, D., Rodriguez-Lanetty, M., 2013. Transcriptional activation of c3 and hsp70 as part of the immune response of Acropora millepora to bacterial challenges. PLoS One 8, e67246. Delsuc, F., Brinkmann, H., Chourrout, D., Philippe, H., 2006. Tunicates and not cephalochordates are the closest living relatives of vertebrates. Nature 439, 965–968.

437

Dishaw, L.J., Smith, S.L., Bigger, C.H., 2005. Characterization of a C3-like cDNA in a coral: phylogenetic implications. Immunogenetics 57, 535–548. Dunkelberger, J.R., Song, W.C., 2010. Complement and its role in innate and adaptive immune responses. Cell Res. 20, 34–50. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Ferro, D., Franchi, N., Mangano, V., Bakiu, R., Cammarata, M., Parrinello, N., Santovito, G., Ballarin, L., 2013. Characterization and metal-induced gene transcription of two new copper zinc superoxide dismutases in the solitary ascidian Ciona intestinalis. Aquat. Toxicol. 140–141, 369–379. Fitch, W.M., 1971. Towards defining the course of evolution: minimum change for a specific tree topology. Syst. Zool. 20, 406–416. Franchi, N., Boldrin, F., Ballarin, L., Piccinni, E., 2011a. CiMT-1, an unusual chordate metallothionein gene in Ciona intestinalis genome: structure and expression studies. J. Exp. Zool. 315A, 90–100. Franchi, N., Ferro, D., Ballarin, L., Santovito, G., 2012. Transcription of genes involved in glutathione biosynthesis in the solitary tunicate Ciona intestinalis exposed to metals. Aquat. Toxicol. 114–115, 14–22. Franchi, N., Schiavon, F., Carletto, M., Gasparini, F., Bertoloni, G., Tosatto, S.C., Ballarin, L., 2011b. Immune roles of a rhamnose-binding lectin in the colonial ascidian Botryllus schlosseri. Immunobiology 216, 725–736. Gasparini, F., Franchi, N., Spolaore, B., Ballarin, L., 2008. Novel rhamnose-binding lectins from the colonial ascidian Botryllus schlosseri. Dev. Comp. Immunol. 32, 1177–1191. Giacomelli, S., Melillo, D., Lambris, J.D., Pinto, M.R., 2012. Immune competence of the Ciona intestinalis pharynx: complement system-mediated activity. Fish Shellfish Immunol. 33, 946–952. Green, P., Luty, A., Nair, S., Radford, J., Raftos, D., 2006. A second form of collagenous lectin from the tunicate, Styela plicata. Comp. Biochem. Physiol. 144B, 343–350. Green, P.L., Nair, S.V., Raftos, D.A., 2003. Secretion of a collectin-like protein in tunicates is enhanced during inflammatory responses. Dev. Comp. Immunol. 27, 3–9. Gross, P.S., Clow, L.A., Smith, L.C., 2000. SpC3, the complement homologue from the purple sea urchin, Strongylocentrotus purpuratus, is expressed in two subpopulations of the phagocytic coelomocytes. Immunogenetics 51, 1034– 1044. Holers, V.M., 2014. Complement and its receptors: new insights into human disease. Annu. Rev. Immunol. 32, 433–459. Jeanmougin, F., Thompson, J.D., Gouy, M., Higgins, D.G., Gibson, T.J., 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23, 403–405. Ji, X., Azumi, K., Sasaki, M., Nonaka, M., 1997. Ancient origin of the complement lectin pathway revealed by molecular cloning of mannan binding proteinassociated serine protease from a urochordate, the Japanese ascidian, Halocynthia roretzi. Proc. Natl. Acad. Sci. USA 94, 6340–6345. Kenjo, A., Takahashi, M., Matsushita, M., Endo, Y., Nakata, M., Mizuochi, T., Fujita, T., 2001. Cloning and characterization of novel ficolins from the solitary ascidian, Halocynthia roretzi. J. Biol. Chem. 276, 19959–19965. Kimura, A., Sakaguchi, E., Nonaka, M., 2009. Milty-component complement system of Cnidaria: C3, Bf and MASP genes expressed in the endodermal tissues of a sea anemone, Nematostella vectensis. Immunobiology 214, 165–178. Kohl, J., 2006. The role of complement in danger sensing and transmission. Immunol. Res. 34, 157–176. Korb, L.C., Ahearn, J.M., 1997. C1q binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J. Immunol. 158, 4525–4528. Lambris, J.D., 1988. The multifunctional role of C3, the third component of complement. Immunol. Today 9, 387–393. Lauzon, R.J., Ishizuka, K.J., Weissman, I.L., 2002. Cyclical generation and degeneration of organs in a colonial urochordate involves crosstalk between old and new: a model for development and regeneration. Dev. Biol. 249, 333–348. Letunic, I., Doerks, T., Bork, P., 2012. SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res. 40, D302–D305. Manni, L., Zaniolo, G., Cima, F., Burighel, P., Ballarin, L., 2007. Botryllus schlosseri: a model ascidian for the study of asexual reproduction. Dev. Dyn. 236, 335– 352. Marino, R., Kimura, Y., De Santis, R., Lambris, J.D., Pinto, M.R., 2002. Complement in urochordates: cloning and characterization of two C3-like genes in the ascidian Ciona intestinalis. Immunogenetics 53, 1055–1064. Melillo, D., Sfyroera, G., De Santis, R., Graziano, R., Marino, R., Lambris, J.D., Pinto, M.R., 2006. First identification of a chemotactic receptor in an invertebrate species: structural and functional characterization of Ciona intestinalis C3a receptor. J. Immunol. 177, 4132–4140. Menin, A., Ballarin, L., 2008. Immunomodulatory molecules in the compound ascidian Botryllus schlosseri: evidence from conditioned media. J. Invertebr. Pathol. 99, 275–280. Menin, A., Del Favero, M., Cima, F., Ballarin, L., 2005. Release of phagocytosisstimulating factor(s) by morula cells in a colonial ascidian. Mar. Biol. 148, 225– 230. Molina, H., Holers, V.M., Li, B., Fung, Y., Mariathasan, S., Goellner, J., StraussSchoenberger, J., Karr, R.W., Chaplin, D.D., 1996. Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2. Proc. Natl. Acad. Sci. USA 93, 3357–3361. Nonaka, M., Azumi, K., Ji, X., Namikawa-Yamada, C., Sasaki, M., Saiga, H., Dodds, A.W., Sekine, H., Homma, M.K., Matsushita, M., Endo, Y., Fujita, T., 1999. Opsonic complement component C3 in the solitary ascidian, Halocynthia roretzi. J. Immunol. 162, 387–391.

438

N. Franchi, L. Ballarin / Developmental and Comparative Immunology 46 (2014) 430–438

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Pinto, M.R., Chinnici, C.M., Kimura, Y., Melillo, D., Marino, R., Spruce, L.A., De Santis, R., Parrinello, N., Lambris, J.D., 2003. CiC3-1a-mediated chemotaxis in the deuterostome invertebrate Ciona intestinalis (Urochordata). J. Immunol. 171, 5521–5528. Qu, H., Ricklin, D., Lambris, J.D., 2009. Recent developments in low molecular weight complement inhibitors. Mol. Immunol. 47, 185–195. Raftos, D.A., Robbins, J., Newton, R.A., Nair, S.V., 2003. A complement component C3a-like peptide stimulates chemotaxis by hemocytes from an invertebrate chordate-the tunicate, Pyura stolonifera. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 134, 377–386. Ricklin, D., Lambris, J.D., 2008. Compstatin: a complement inhibitor on its way to clinical application. Adv. Exp. Med. Biol. 632, 273–292. Riley-Vargas, R.C., Lanzendorf, S., Atkinson, J.P., 2005. Targeted and restricted complement activation on acrosome-reacted spermatozoa. J. Clin. Invest. 115, 1241–1249. Rzhetsky, A., Nei, M., 1992. Statistical properties of the ordinary least- squares, generalized least-squares, and minimum-evolution methods of phylogenetic inference. J. Mol. Evol. 35, 367–375. Sahoo, S., Murugavel, S., Devi, I.K., Vedamurthy, G.V., Gupta, S.C., Singh, B.P., Joshi, P., 2013. Glyceraldehyde-3-phosphate dehydrogenase of the parasitic nematode Haemonchus contortus binds to complement C3 and inhibits its activity. Parasite Immunol. 35, 457–467. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sarma, J.V., Ward, P.A., 2011. The complement system. Cell Tissue Res. 343, 227– 235. Sjöberg, A.P., Nyström, S., Hammarström, P., Blom, A.M., 2008. Native, amyloid fibrils and beta-oligomers of the C-terminal domain of human prion protein

display differential activation of complement and bind C1q, factor H and C4bbinding protein directly. Mol. Immunol. 45, 3213–3221. Sjöberg, A.P., Trouw, L.A., Blom, A.M., 2009. Complement activation and inhibition: a delicate balance. Trends Immunol. 30, 83–90. Sneath, P., Sokal, R., 1973. Numerical Taxonomy. Freeman, San Francisco. Sunyer, J.O., Tort, L., 1995. Natural hemolytic and bactericidal activities of sea bream Sparus aurata serum are effected by the alternative complement pathway. Vet. Immunol. Immunopathol. 45, 333–345. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Voskoboynik, A., Neff, N.F., Sahoo, D., Newman, A.M., Pushkarev, D., Koh, W., Passarelli, B., Fan, H.C., Mantalas, G.L., Palmeri, K.J., Ishizuka, K.J., Gissi, C., Griggio, F., Ben-Shlomo, R., Corey, D.M., Penland, L., White, R.A., Weissman, I.L., Quake, S.R., 2013. The genome sequence of the colonial chordate, Botryllus schlosseri. Elife 2, e00569. Wallis, R., 2007. Interactions between mannose-binding lectin and MASPs during complement activation by the lectin pathway. Immunobiology 212, 289–299. Walport, M.J., 2001. Complement. First of two parts. N. Engl. J. Med. 344, 1058– 1066. Yoshizaki, F.Y., Ikawa, S., Satake, M., Satoh, N., Nonaka, M., 2005. Structure and the evolutionary implication of the triplicated complement factor B genes of a urochordate ascidian, Ciona intestinalis. Immunogenetics 56, 930–942. Zhong, L., Zhang, F., Chang, Y., 2012. Gene cloning and function analysis of complement B factor-2 of Apostichopus japonicus. Fish Shellfish Immunol. 33, 504–513. Zhou, Z., Liu, H., Liu, S., Sun, F., Peatman, E., Kucuktas, H., Kaltenboeck, L., Feng, T., Zhang, H., Niu, D., Lu, J., Waldbieser, G., Liu, Z., 2012. Alternative complement pathway of channel catfish (Ictalurus punctatus): molecular characterization, mapping and expression analysis of factors Bf/C2 and Df. Fish Shellfish Immunol. 32, 186–195.