FOODBORNE PATHOGENS AND DISEASE Volume 2, Number 3, 2005 © Mary Ann Liebert, Inc.
Prevalence of Antimicrobial Resistance Genes in Listeria monocytogenes Isolated from Dairy Farms V. SRINIVASAN, H.M. NAM, L.T. NGUYEN, B. TAMILSELVAM, S.E. MURINDA, and S.P. OLIVER
ABSTRACT Antimicrobial resistance of Listeria monocytogenes (n 38) isolated from the four dairy farms to 15 antimicrobial agents was evaluated. All 38 L. monocytogenes isolates from the four farms evaluated were resistant to more than one antimicrobial in different combinations. All L. monocytogenes isolates evaluated were resistant to cephalosporin C (minimum inhibitory concentration [MIC] 512 g/mL), streptomycin (MIC 32) and trimethoprim (MIC 512). Most L. monocytogenes isolates were resistant to ampicillin (92%, MIC 2), rifampicin (84%, MIC 4), rifamycin (84%, MIC 4), and florfenicol (66%, MIC 32) and some were resistant to tetracycline (45%, MIC 16), penicillin G (40%, MIC 2) and chloramphenicol (32%, MIC 32). All L. monocytogenes isolates were susceptible to amoxicillin, erythromycin, gentamicin, kanamycin and vancomycin. Susceptibility of L. monocytogenes to the antimicrobials evaluated was quite consistent among the dairy farms evaluated. However, some variability in antimicrobial susceptibility among dairy farms was noted. Nineteen of 38 L. monocytogenes isolates contained more than one antimicrobial resistance gene sequence. A high frequency of floR (66%) was found in L. monocytogenes followed by penA (37%), strA (34%), tetA (32%), and sulI (16%). Other tetracycline resistance genes (tetB, tetC, tetD, tetE, and tetG) and other antimicrobial resistance genes (cmlA, strB, aadA, sulI, vanA, vanB, ampC, ermB, ereA, and ereB) were not found in any of the L. monocytogenes isolates from the four dairy farms. Results of the present study demonstrated that L. monocytogenes isolated from the dairy farm environment were resistant to many antimicrobials and contained one or more antimicrobial resistance genes.
INTRODUCTION
L
ISTERIA have become the leading cause of zoonotic enteric infections in developed and developing countries world-wide (White et al., 2002). Listeria spp. are ubiquitous bacteria that are widely distributed in the environment and can be found in soils, decaying vegetation, animal feces, sewage, silage and water and are frequently carried in the intestinal tract of humans and animals including cattle, poultry and pigs. The widespread distribution of L. monocytogenes and other Listeria spp. in natural environments is probably related to their ability to grow and survive in extreme conditions (Margolles et al., 2001). Among the seven
species of Listeria, only L. monocytogenes is commonly pathogenic for humans and can cause serious infections such as meningitis or septicemia in newborns, immunocompromized patients, and the elderly or lead to abortion (Godreuil et al., 2003). Listeriosis differs from most foodborne diseases by its high fatality rate (20–30% of cases), despite the administration of appropriate antimicrobials (Hof et al., 1997). The first L. monocytogenes strains resistant to antimicrobials were detected in 1988 (PoyartSalmeron et al., 1990). Listeria monocytogenes is generally susceptible to a wide range of antibiotics but resistant to cephalosporins and fosfomycin (Hof et al., 1997). However, an in-
Food Safety Center of Excellence, University of Tennessee, Knoxville, Tennessee.
201
202
creasing number of strains resistant to one or more antibiotics have been reported (PoyartSalmeron et al., 1992; Charpentier and Courvalin, 1999). Other Listeria spp. isolated from food, the environment, or in sporadic cases of human listeriosis resistant to one or several antimicrobials have also been described (Charpentier et al., 1995). Antimicrobial resistance in Listeria spp. and acquisition of mobile genetic elements from other bacteria were reviewed by Charpentier and Courvalin (1999). The concern for L. monocytogenes has increased because of the frequent isolation of antimicrobial resistant strains in humans and animals. Aaerstrup and Wegener (1999) indicated that development of antimicrobial resistance in zoonotic bacteria appeared to be associated primarily with use of antimicrobials in animals. Veterinary use of antimicrobials includes use in pets, farm animals, and fish. In food-producing animals, antimicrobials are used commonly for disease therapy and prophylaxis and to increase animal growth and feed efficiency. The main infectious diseases treated with antimicrobials in food-producing animals are enteric and pulmonary infections, skin and organ abscesses, and mastitis. Many foodborne pathogens and opportunistic bacteria have habitats in food-producing animals (e.g., in the skin and intestinal tract). These pathogens can enter meat and milk products during slaughter, at milking, or contaminate raw vegetables when soil is fertilized with animal excrement (McEwen and Fedorka-Cray, 2002). The exact role of foodborne pathogens in transmission of antimicrobial resistance is a topic of considerable current research interest. The importance of studying bacterial growth, and antimicrobial resistance responses that may develop extends beyond the role of simply halting the spread of infectious diseases. These studies are necessary to evaluate the role of environmental samples and foodborne pathogens in dissemination of antimicrobial resistance to other bacterial populations and to the environment. Objectives of the present study were to evaluate antimicrobial susceptibility and antimicrobial resistance gene patterns in L. monocytogenes isolated from dairy farm environments.
SRINIVASAN ET AL.
MATERIALS AND METHODS Sample collection Samples from four dairy farms in east Tennessee were collected at monthly intervals during 2002 and every other month in 2003. Swab, liquid, and solid environmental samples (fecal slurry, fecal swabs from calves, bedding material, silage/feed, drinking water, water from lagoon, bulk tank milk, and in-line milk filters) were collected. Samples were collected into sterile containers using aseptic techniques, transported to the lab and stored overnight at 5°C for analysis using procedures described by Murinda et al. (2004). Swab samples were placed in screw-cap tubes containing 6 mL buffered peptone water (0.1%, vol/vol). Fecal slurry/pats (100 g) were collected from at least 6 locations using sterile spatulas and composited. Liquid samples were collected using ladles equipped with screw caps. Bulk samples (100 g) such as feed and bedding (sand, wood shavings or straw) were collected into sterile plastic bags using sterile gloves from at least 6 locations and composted. Solid samples were comminuted, then stomacher or hand-blended for 60 sec in enrichment media. In-line milk filters were collected after milking, placed in a sterile plastic bag, and prepared for bacteriological analysis by stomaching in 400 mL of buffered peptone water. The resulting suspensions were added to enrichment broth (11/99 mL). Isolation and identification of L. monocytogenes Listeria monocytogenes isolated from dairy farm environmental samples were identified using procedures essentially as described in the Food and Drug Administration Bacteriological Analytical Manual (FDA, 1998). Aliquots of samples were inoculated into Listeria enrichment broth (LEB; Difco, Detroit, MI) and incubated at 35°C for 48 h. Following incubation, one ml of culture was transferred to Fraser broth (Difco) and incubated at 35°C for 48 h, streaked onto Oxford agar (Difco) and polymyxin acriflavine lithium chloride ceftazidime esculin mannitol (PALCAM, Difco) agar plates, and incubated at 35°C for 24–48 h. More than five esculin-positive presumptive colonies from each plate were subcultured onto
ANTIMICROBIAL RESISTANCE IN LISTERIA MONOCYTOGENES
203
tryptic soy agar containing 6% yeast extract for further testing. Tests performed on all isolates included Gram stain, catalase and oxidase tests, motility, and -hemolysis on sheep blood agar (BBL: Becton Dickinson Micro Systems, Cockeysville, MD). Organisms were identified to the species level using the API Listeria identification System (BioMerieux Vitek, Inc., Hazelwood, MO).
25923 and Enterococcus faecalis ATCC 29212 (American Type Culture Collection, Rockville, MD) were used as quality control bacteria for MIC as recommended by NCCLS (2004). Experiments were repeated twice to confirm results.
Antimicrobial compounds evaluated
Oligonucleotide sequences and predicted sizes for polymerase chain reaction (PCR) amplification of different antimicrobial resistance genes from L. monocytogenes are listed in Table 1. Presence of antimicrobial resistance genes in L. monocytogenes encoding for the tetracycline efflux pump (tetA, tetB, tetC, tetD, tetE, and tetG); streptomycin phosphotransferases (strA and strB); aminoglycoside adenyltransferase (aadA); penicillin binding protein gene (penA); chloramphenicol transporter nonenzymatic chloramphenicol-resistance protein (cmlA); florfenicol export protein (floR); vanillate o-demethylase oxygenase subunit (vanA and vanB); dihydropteroate synthetase type I (sulI); dihydropteroate synthetase type II (sulII); adenine methylase which confers resistance to erythromycin (ermA); erythromycin resistance methylase (ermB); erythromycin esterase type II (ereB); and beta lactamase–ampicillin resistance gene (ampC) was determined. Primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). Amplification of target genes for all bacteria was performed using a DNA thermal cycler (BioRad Laboratories, Pittsburgh, PA) and the Taq polymerase kit (Promega, Madison, WI) in 0.5 mL of 96-well PCR plates (Fisher Scientific Co., Pittsburgh, PA). The reaction mixture (50 L total volume) consisted of 30 L of sterile water, 5 L of 10 PCR buffer (100 mM Tris-HCl [pH 8.3], 500 mM KCl), 2 L of 15 mM MgCl2, 2 L of deoxyribonucleoside triphosphates (2.5 mM each dATP, dTTP, dGTP and dCTP), 1.0 L of each primer (stock concentration, 25 M), 1–10 L of template, and 0.5 L (5 U/L) of Taq DNA polymerase. After overlaying with sterile seal tape (Fisher Scientific Co.), samples were subjected to PCR amplification. Preincubation was at 94°C for 4 min. Thirty PCR cycles were run under the following conditions: denaturation at 94°C for 45 sec, primer anneal-
Antimicrobials (n 15) were obtained as laboratory standard powders (Sigma Chemicals, St. Louis, MO). Amoxicillin, ampicillin, cephalosporin C, chloramphenicol, erythromycin, florfenicol, gentamicin sulphate, kanamycin, penicillin G, rifamycin SV sodium salt, rifampicin, streptomycin, tetracycline, trimethoprim, and vancomycin were used. Antimicrobials were dissolved in appropriate solvents to prepare stock solutions and then further diluted in sterile, distilled water according to methods recommended by the National Committee for Clinical Laboratory Standards (NCCLS, 2001, 2004). Minimal inhibitory concentration determination Minimal inhibitory concentrations (MICs) of L. monocytogenes isolates to 15 antimicrobials were determined by microdilution method and results were interpreted according to the NCCLS (2001, 2004). Concentrations of 0.25– 512 g/mL were tested for all antimicrobials. Antimicrobial-free plates were included as controls. Inocula were prepared by diluting overnight cultures in buffered saline to a McFarland turbidity density of 0.5. Fifty microliters of adjusted inocula were added to each well of the microplate containing 50 L of two-fold diluted antimicrobials. Microplates were incubated for 24 h at 35°C, and observed visually for growth. Breakpoints used for the microdilution broth method were those recommended by NCCLS (2001, 2004) for Grampositive microorganisms, except for ampicillin (MIC 2) and penicillin G (MIC 2) where specific Listeria breakpoints are defined. The resistance breakpoint of chloramphenicol (MIC 32) was also used for florfenicol. For all antimicrobials, Staphylococcus aureus ATCC
Polymerase chain reaction amplification of antimicrobial resistance genes
204
SRINIVASAN ET AL. TABLE 1.
PRIMERS USED
FOR IN
DETECTION OF GENES ENCODING RESISTANCE TO DIFFERENT ANTIMICROBIALS L. MONOCYTOGENES ISOLATED FROM DAIRY FARMS
Gene
Primer
Nucleotide sequence (5–3)
tet A
TetA F TetA R TetB F TetB R TetC F TetC R TetD F TetD R TetE F TetE R TetG-F TetG-R FloR F FloR R CmlA F CmlA R StrA F StrA R StrB F StrB R PenA F PenA R AadA F AadA R SulI-F SulI-R SulII-F SulII-R VanA-F VanA-R VanB-F VanB-R AmpC-F AmpC-R ErmB-F ErmB-R EreA-F EreA-R EreB-F EreB-R
GGCCTCAATTTCCTGACG AAGCAGGATGTAGCCTGTGC GAGACGCAATCGAATTCGG TTTAGTGGCTATTCTTCCTGCC TGCTCAACGGCCTCAACC AGCAAGACGTAGCCCAGCG GGATATCTCACCGCATCTGC CATCCATCCGGAAGTGATAGC TCCATACGCGAGATGATCTCC CGATTACAGCTGTCAGGTGGG CAGCTTTCGGATTCTTACGG GATTGGTGAGGCTCGTTAGC TATCTCCCTGTCGTTTCCAG AGAACTCGCCGATCAATG CCGCCACGGTGTTGTTGTTATC CACCTTGCCTGCCCATCATTAG CTTGGTGATAACGGCAATTC CCAATCGCAGATAGAAGGC ATCGTCAAGGGATTGAAACC GGATCGTAGAACATATTGGC ATCGAACAGGCGACGATGTC GATTAAGACGGTGTTTTACGG GTGGATGGCGGCCTGAAGCC AATGCCCAGTCGGCAGCG GTGACGGTGTTCGGCATTCT TCCGAGAAGGTGATTGCGCT CGGCATCGTCAACATAACCT TGTGCGGATGAAGTCAGCTC CATGACGTATCGGTAAAATC ACCGGGCAGRGTATTGAC CATGATGTGTCGGTAAAATC ACCGGGCAGRGTATTGAC TTCTATCAAMACTGGCARCC CCYTTTTATGTACCCAYGA GAAAAGGTACTCAACCAAATA AGTAACGGTACTTAAATTGTTTAC AACACCCTGAACCCAAGGGACG CTTCACATCCGGATTCGCTCGA AGAAATGGAGGTTCATACTTACCA CATATAATCATCACCAATGGCA
tet B tet C tet D tet E tet G floR cmlA strA strB penA aadA sulI sulII vanA vanB ampC ermB ereA ereB
ing at optimum temperature for 45 sec, and DNA extension at 72°C for 45 sec in each cycle. After the last cycle, PCR tubes were incubated for 7 min at 72°C and then at 4°C. The annealing temperature was optimized with all primer sets. Salmonella typhii G8518 CDC (ACCuST) and Salmonella typhimurium DT104 and DT193 were used as positive controls in all PCR reactions. With the exception of template DNA, sterile distilled water was used as the reagent control in the reaction mixture. Twenty microliters of the reaction mixture were analyzed by standard
Size (bp) 372 228 379 436 442 844 399 698 548 509 500 525 779 721 885 882 550 639 420 546
Reference Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Guillame et al., 2000 Gebreyes and Altier, Gebreyes and Altier, Keyes et al., 2000 Keyes et al., 2000 Gebreyes and Altier, Gebreyes and Altier, Gebreyes and Altier, Gebreyes and Altier, Gebreyes and Altier, Gebreyes and Altier, Antignac et al., 2001 Antignac et al., 2001 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Lanz et al., 2003 Okamoto et al., 2002 Okamoto et al., 2002 Sutcliffe et al., 1996 Sutcliffe et al., 1996 Sutcliffe et al., 1996 Sutcliffe et al., 1996
2002 2002 2002 2002 2002 2002 2002 2002
submarine agarose (1.5%) gel electrophoresis (Cambrex Bio Science, Rockland, ME) with Trisborate-EDTA buffer system. Reaction products were visualized by staining with ethidium bromide (0.5 g/mL in the running buffer). DNA sequence analysis A subset of PCR products (tetA n 4, floR n 8, strA n 4, penA n 5, and sulI n 2) was purified with QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) and sequenced
ANTIMICROBIAL RESISTANCE IN LISTERIA MONOCYTOGENES
at The University of Tennessee Molecular Biology Resource Facility, Knoxville, TN. The resulting DNA sequence data were compared to data in GenBank database by using the BLAST algorithm available at the National Center for Biotechnology Information web site www.ncbi.nlm.nih.gov.
RESULTS Listeria monocytogenes (n 38) was isolated from different environmental samples obtained from four dairy farms. Twelve isolates from farm A were isolated from fecal slurry (n 5), feed (n 2), water from the lagoon (n 3), inline milk filter (n 1), and bedding (n 1). Fourteen isolates from farm B were isolated from fecal slurry (n 4), feed (n 1), drinking water (n 1), bedding (n 6), and bird droppings (n 2). On farm C, 11 L. monocytogenes were isolated from fecal slurry (n 3), feed (n 1), bedding (n 6), and a calf fecal swab (n 1). On farm D, only one L. monocytogenes was isolated from a bedding sample. Antimicrobial susceptibility using MIC determination All 38 L. monocytogenes isolated from the four farms evaluated were resistant to more than one antimicrobial in different combinations (Table 2). All were resistant to cephalosporin C (MIC 512 g/mL), streptomycin (MIC 32) and trimethoprim (MIC 512). Most L. monocytogenes isolates (92%) were resistant to ampicillin (MIC 2), rifampicin (84%, MIC 4), rifamycin (84%, MIC 4), and florfenicol (66%, MIC 32) and some were resistant to tetracycline (45%, MIC 16), penicillin G (40%, MIC 2), and chloramphenicol (32%, MIC 32). All L. monocytogenes were susceptible to amoxicillin, erythromycin, gentamicin, kanamycin, and vancomycin (Table 2). Susceptibility of L. monocytogenes to antimicrobials evaluated was quite consistent among the dairy farms evaluated. However, some variability in antimicrobial susceptibility among dairy farms was noted (Table 2). For example, florfenicol resistance was considerably lower in L. monocytogenes isolated from farm B.
205
Occurrence of antimicrobial resistance genes The prevalence of antimicrobial resistance genes in L. monocytogenes isolated from the four dairy farms was determined with primers shown in Table 1. A subset of PCR amplicons were sequenced and sequences were blasted in NCBI database and confirmed. DNA sequence analysis of the L. monocytogenes tetA gene showed 98% identity to the published GenBank sequences of Acinetobacter baumanii Tn1721 and Salmonella enterica subsp. Enterica serovar typhimurium (AY196695 and AJ634602, respectively). The floR gene showed 98% identity to Vibrio cholerae and Escherichia coli (AY822603 and AJ518835, respectively). The strA gene showed 99% identity to E. coli and Erwinia amylovora (AF321550 and M95402, respectively). The penA gene showed 98% identity to Neisseria meningitides (AY127598), and the sulI gene showed 93% identity to E. coli (AY360321) and Salmonella enterica (AJ628353). Nineteen of 38 L. monocytogenes isolates contained more than one antimicrobial resistance gene sequence. A high frequency of floR (66%) was found in L. monocytogenes followed by penA (37%), strA (34%), tetA (32%) and sulI (16%) (Table 3). Other tetracycline resistance genes (tetB, tetC, tetD, tetE, and tetG) and other antimicrobial resistance genes (cmlA, strB, aadA, sulI, vanA, vanB, ampC, ermB, ereA, and ereB) were not found in any of the L. monocytogenes isolates from the four dairy farms. All L. monocytogenes evaluated in the present study were susceptible to erythromycin and none of these isolates contained antimicrobial resistance genes responsible for erythromycin resistance such as ermB, ereA, and ereB. Among the four farms evaluated, a higher prevalence of antimicrobial resistance genes was found in L. monocytogenes isolates from farm B (79%) followed by farm A (50%) and farm C (18%). Of 14 L. monocytogenes isolated from farm B, 11 isolates (79%) carried more than one antimicrobial resistance gene. A high frequency of floR, strA and penA was found in the 11 isolates (79%), tetA in five isolates (36%), and sulI was in two isolates (14%). Among 12 isolates from farm A, six isolates (50%) carried more than one antimicrobial resistance gene and contained floR (n 9), tetA (n 6), sulI
L.
MICb range 1–128 0 –512 2–64 0.25–0.5 4–256 1–4 8–16 1–64 16–128 8–64 64–128 4–64 –512 3–4
2 4 16 32 1 32 8 32 2 4 4 32 16 16 32
bMIC,
number of isolates. minimal inhibitory concentration (g/mL). cNumber of resistant isolates. dPercentage of resistant isolates.
aTotal
Ampicillin Amoxicillin Cephalosporin C Chloramphenicol Erythromycin Florfenicol Gentamicin Kanamycin Penicillin G Rifampicin Rifamycin Streptomycin Tetracycline Trimethoprim Vancomycin
Antimicrobial
OF
11 0 12 4 0 9 0 0 5 12 12 12 4 12 0
NRc 92 0 100 33 0 75 0 0 42 100 100 100 33 100 0
%d 1–128 0 –512 4–64 0.25–0.5 8–128 0.5–4 8–16 1–64 2–64 2–128 32–128 8–64 –512 2–16
MICb range 13 0 14 2 0 6 0 0 6 11 9 14 5 14 0
NRc 93 0 100 14 0 43 0 0 43 79 79 100 36 100 0
%d
TO
0.5–64 0 –512 8–128 0 4–256 0.5–4 8–16 0.5–64 1–64 2–256 64–128 8–64 –512 2–4
MICb range
10 0 11 5 0 9 0 0 3 8 10 11 7 1 0
NRc
91 0 100 46 0 82 0 0 27 73 72 100 64 100 0
%d
64 0 512 64 0 256 2 16 16 32 64 32 64 512 8
1 0 1 1 0 1 0 0 1 1 1 1 1 1 0
NRc
Farm D (na 1) MICb range
15 ANTIMICROBIALS
Farm C (na 11)
DAIRY FARM ENVIRONMENTAL SAMPLES
Farm B (na 14)
MONOCYTOGENES ISOLATED FROM
Farm A (na 12)
SUSCEPTIBILITY
Breakpoint (g/mL)
TABLE 2.
100 0 100 100 0 100 0 0 100 100 100 100 100 100 0
%d
207
ANTIMICROBIAL RESISTANCE IN LISTERIA MONOCYTOGENES TABLE 3. L.
OCCURRENCE
OF
ANTIMICROBIAL RESISTANCE GENES IN DAIRY FARM ENVIRONMENTAL SAMPLES
MONOCYTOGENES ISOLATED FROM
No. (%) of positive isolates Farm
Sample type
A
Fecal slurry Feed Water from Lagoon Inline milk filter Bedding Total Fecal slurry Feed Drinking water Bedding Bird dropping Total Fecal slurry Feed Bedding Calf fecal swab Total Bedding Total
B
C
D Total
Number isolated
tetA
floR
strA
penA
5 2 3 1 1 12 4 1 1 6 2 14 3 1 6 1 11 1 1 38
4 1 0 0 1 6 3 1 0 1 0 5 0 0 1 0 1 0 0 12
3 2 2 1 1 9 4 1 1 3 2 11 0 0 4 1 5 0 0 25
0 0 1 0 0 1 4 1 0 4 2 11 0 1 0 0 1 0 0 13
1 0 0 0 0 1 (8) 4 1 1 4 1 11 (79) 1 0 0 0 1 (9) 1 1 (100) 14 (37)
(n 3), strA (n 1), and penA (n 1). Listeria monocytogenes isolates from farm C contained a low frequency of antimicrobial resistance genes and only two of 11 isolates (18%) were multidrug resistant and carried floR (n 5), tetA (n 1), strA (n 1), penA (n 1), and sulI (n 1). One isolate from bedding material of farm D carried penA but no other antimicrobial resistance genes.
DISCUSSION Most studies on antimicrobial susceptibility of L. monocytogenes have been conducted using clinical human, animal and food isolates (Facinelli et al., 1991; Charpentier and Courvalin, 1999). To our knowledge, this is the first study that specifically evaluated antimicrobial resistance of L. monocytogenes isolated from the dairy farm environment. Results of this study demonstrated that L. monocytogenes isolated from the environment of four dairy farms were resistant to a wide range of antimicrobials. Furthermore, most of the L. monocytogenes isolates in this study carried one or more antimicrobial resistance genes that may function as an an-
(50)
(36)
(9) (32)
(75)
(79)
(46) (66)
(8)
(79)
(9) (34)
sulI 2 1 0 0 0 3 1 0 1 0 0 2 0 0 0 1 1 0 0 6
(25)
(14)
(9) (16)
timicrobial resistance gene pool for other commensal and pathogenic bacteria in the dairy farm environment. Since the first report of antibiotic-resistant strains of L. monocytogenes (Poyart-Salmeron et al., 1990), there has been an increase in the emergence of antimicrobial resistant strains of L. monocytogenes isolated from a variety of sources (Charpentier et al., 1995; Hofer et al., 1999). Based on data published thus far, the prevalence of antimicrobial resistance in L. monocytogenes appears to vary considerably. In the present study, all 38 L. monocytogenes isolates from the four farms evaluated were resistant to more than one antimicrobial in different combinations, and resistance of L. monocytogenes to most antimicrobials evaluated was quite consistent among the dairy farms evaluated. All L. monocytogenes isolates were resistant to cephalosporin C, streptomycin and trimethoprim. Most L. monocytogenes isolates were resistant to ampicillin (92%, MIC 2 g/mL), rifampicin (84%, MIC 4), rifamycin (84%, MIC 4), and florfenicol (66%, MIC 32) and some were resistant to tetracycline (45%, MIC 16), penicillin G (40%, MIC 2), and chloramphenicol (32%, MIC 32). All L. monocytogenes isolates were
208
susceptible to amoxicillin, erythromycin, gentamicin, kanamycin and vancomycin. Results from other studies reported multidrug resistance in L. monocytogenes isolated from food and animals to chloramphenicol, erythromycin, gentamicin, kanamycin, streptomycin, and rifampin (Charpentier et al., 1995; Walsh et al., 2001). In the present study, chloramphenicol resistance (MIC 32) was observed in 32% of L. monocytogenes. However, Godreuil et al. (2003) reported that only five of 488 clinical isolates of L. monocytogenes were susceptible to chloramphenicol and vancomycin (Walsh et al., 2001). Slade and Collin-Thompson (1990) reported that only one L. monocytogenes among 195 Listeria spp. isolated from human samples, food and the environment was resistant to streptomycin. Conversely, MacGowan et al. (1990) and Margolles et al. (2001) reported that all L. monocytogenes isolates were resistant to streptomycin (MIC 32), which is consistent with results of the present study. We found that 94% of L. monocytogenes isolates were resistant to ampicillin (MIC 2) and 40% of L. monocytogenes isolates were resistant to penicillin G (MIC 2). Results of the present study are consistent with Pollock et al. (1986) who reported ampicillin and penicillin resistance in L. monocytogenes isolated from cases of meningitis. Conversely, all L. monocytogenes isolated from cheese were susceptible to ampicillin and penicillin (Marco et al., 2000; Margolles et al., 2001). Results of the present study revealed that all L. monocytogenes were resistant to high levels of trimethoprim (512 g/mL). This observation is consistent with reports of Charpentier et al. (1995) and Charpentier and Courvalin (1999), who found trimethoprim resistance in foodborne strains of L. monocytogenes. A high percentage of tetracycline resistant strains of L. monocytogenes from animal origin have been reported in dairy and meat products (Facinelli et al., 1991; Rota et al., 1996), which could be due to selective use of antimicrobials in food producing animals (Vela et al., 2001). In the present study, about 45% of L. monocytogenes isolated from dairy farms were resistant to tetracycline (MIC 16). In the United States, tetracycline resistance was reported in Listeria spp. isolated from food (Charpentier et al.,
SRINIVASAN ET AL.
1995) whereas a few studies indicated that L. monocytogenes isolates were susceptible to tetracycline (Franco Abuin et al., 1994; Margolles et al., 2001). Although L. monocytogenes was noted to be relatively susceptible to a wide range of antimicrobials as few as 15 years ago, a number of more recent reports (Vela et al., 2001; Walsh et al., 2001; Godreuil et al., 2003) and results of the current study suggest that the rate of antimicrobial resistance in L. monocytogenes is increasing. The wide variation of antimicrobial resistance patterns between L. monocytogenes isolated from dairy farms and other origins may be due to their exposure to different antimicrobials in different geographical regions during different time periods. The high level of antimicrobial resistance in L. monocytogenes isolated from the dairy farm environment suggests that antimicrobial resistance could be a growing problem in the dairy industry. However, additional research is required to substantiate this hypothesis. Resistance can emerge from use of antimicrobials in animals and subsequent transfer of antimicrobial resistance genes and bacteria among animals, animal products and the environment (McEwen and Fedorka-Cray, 2002). Genetic methods may confirm the presence of specific genes conferring antimicrobial resistance, however, the presence of antimicrobial resistance genes alone does not necessarily imply that bacteria are resistant, as it is possible that resistance genes may not be expressed (Michalova et al., 2004). In the present study, all L. monocytogenes that carried antimicrobial resistance genes were also resistant to these antibiotic(s). The presence of tetracycline resistance determinants, tetM and tetS, was reported in L. monocytogenes isolated from humans, animals (Charpentier et al., 1995) and food (Pourshaban et al., 2002). Poyart-Salmeron et al. (1992) reported that 24 of 25 clinical isolates of L. monocytogenes carried the tetM gene and tetL was detected in one strain. In the present study, 12 L. monocytogenes carried only the tetracycline resistant determinant tetA, and none contained tetB, tetC, tetD, tetE, or tetG. The floR gene was detected in 25 of 38 (66%) L. monocytogenes isolates, penA in 14 (37%) isolates and sulI in six
ANTIMICROBIAL RESISTANCE IN LISTERIA MONOCYTOGENES
(16%) isolates. Listeria monocytogenes may have acquired antimicrobial resistance genes by antimicrobial selection pressure or from other bacteria in the dairy farm environment through various gene transfer mechanisms. For example, studies have shown conjugative transfer of antibiotic resistance, that is, receipt of enterococcal and streptococcal plasmids into the genus Listeria spp. and subsequent transfer of such plasmids within the genus including transfer to L. monocytogenes (Charpentier and Courvalin, 1999). Fifty percent of L. monocytogenes isolated from the dairy farm environment in this study were multidrug resistant and carried different combinations of antimicrobial resistance genes. About 66% of L. monocytogenes isolates in the present study were resistant to florfenicol and an equivalent percentage contained the floR gene. About 50% of floR-positive isolates also conferred resistance to chloramphenicol (MIC 32). However, florfenicol and chloramphenicol co-resistance conferred by floR was observed in gram-negative bacteria, including Pasteurella piscicida (Kim and Aoki, 1996) and E. coli (Keyes et al., 2000; White et al., 2000), and reported that most (98%) florfenicol resistant bacteria were also resistant to chloramphenicol. Likewise, 40% of L. monocytogenes were resistant to penicillin G, and 37% carried penA. All L. monocytogenes isolates in the present study were susceptible to erythromycin and vancomycin and did not carry cmlA, ereA, ereB, vanA, and vanB. DNA sequence analysis of antimicrobial resistance genes from L. monocytogenes demonstrated that they might have acquired these genes from a variety of gramnegative bacteria as reviewed by Courvalin (1994). However, further work is needed to demonstrate and confirm this hypothesis. Conversely, some of the L. monocytogenes isolates in the present study displayed phenotypic resistance to multiple antimicrobials but did not contain antimicrobial resistance genes as evaluated by PCR. For example, all L. monocytogenes isolates were phenotypically resistant to streptomycin, however, only 34% of isolates carried strA and none contained the other streptomycin resistance genes (strB and aadA) evaluated. Likewise, 92% of L. monocytogenes were phenotypically resistant to ampicillin but
209
none of the isolates carried ampC. Thus, the presence of different antimicrobial resistance genes did not always correlate with phenotypic antimicrobial resistance exhibited by foodborne pathogens. This suggests that other mechanisms also contribute to antimicrobial resistance phenotypes such as decreased outer membrane permeability (Farmer et al., 1992), activation of efflux pump (Charvalos et al., 1995) or a mutation in a ribosomal protein gene (Yan and Taylor, 1991). In summary, a high percentage of multidrugresistant L. monocytogenes was isolated from dairy farm environmental samples. Since L. monocytogenes are ubiquitous, they may be exposed to a wide variety of antimicrobial compounds on dairy farms. Multidrug-resistant L. monocytogenes can serve as a pool of resistance genes, which can be transferred to other commensal and pathogenic bacteria in other environments. Further studies are needed to confirm the presence and exact nature of mobile genetic elements such as integrons and plasmids in this important foodborne pathogen.
CONCLUSION The present study reports the presence of antimicrobial resistance genes in different combinations conferring multiple resistance phenotypes among L. monocytogenes isolated from dairy farms. Foodborne pathogens isolated from dairy farms can serve as carriers of antimicrobial resistance determinants. Other water-borne and soil-borne bacteria in the dairy farm environment, adjacent areas, and even inside the cow can potentially acquire these determinants. These determinants can also potentially be acquired by human pathogens and passed into the human food chain through food contaminated by multidrug-resistant foodborne pathogens. To reduce the dissemination of antimicrobial resistant foodborne pathogens, the appropriate antimicrobial selection pressures must be diminished. Although research has linked the use of antimicrobials in agriculture to the emergence of antimicrobial resistant foodborne pathogens, debate still continues whether this role merits further regulation or restriction. A better understanding of how an-
210
SRINIVASAN ET AL.
timicrobial resistance genes are acquired and transmitted among bacterial pathogens in the dairy production environment will undoubtedly lead to the creation of management practices that will minimize both the prevalence of multidrug resistant bacterial pathogens and potential animal health and public health impacts.
ACKNOWLEDGMENTS This study was supported by the University of Tennessee Food Safety Center of Excellence; the Tennessee Agricultural Experiment Station; and the University of Tennessee, College of Veterinary Medicine, Center of Excellence Research program in Livestock Diseases and Human Health.
REFERENCES Aarestrup, F.M., and H.K. Wegener. 1999. The effects of antimicrobial usage in food animals on the development of antimicrobial resistance in importance for humans in Campylobacter and Escherichia coli. Microbes Infect. 1:639–644. Antignac, A., P. Kriz, G. Tzanakaki, et al. 2001. Polymorphism of Neisseria meningitidis penA gene associated with reduced susceptibility to penicillin. J. Antimicrob. Chemother. 47:285–296. Charpentier, E., and P. Courvalin. 1999. Antimicrobial resistance in Listeria spp. Antimicrob. Agents Chemother. 43:2103–2108. Charpentier, E., G. Gerbaud, C. Jacquet, et al. 1995. Incidence of antimicrobial resistance in Listeria spp. J. Infect. Dis. 172:277–281. Charvalos, E., Y. Tselentis, M.M. Hamzehpour, et al. 1995. Evidence for an efflux pump in multidrug-resistant Campylobacter jejuni. Antimcrob. Agents Chemother. 39:2019–2022. Courvalin, P. 1994. Transfer of antibiotic resistance genes between gram-positive and gram-negative bacteria. Antimicrob. Agents Chemother. 38:1447–1451. Facinelli, B., E. Giovanetti, P.E. Varaldo, et al. 1991. Antimicrobial resistance in foodborne listeria. Lancet 338:1272. Farmer, S., Z. Li, and R.E.W. Hancock. 1992. Influence of outer membrane mutations on susceptibility of Escherichia coli to the dibasic macrolide azithromycin. J. Antimicrob. Chemother. 29:27–33.
FDA (Food and Drug Administration). 1998. Detection and enumeration of Listeria monocytogenes in foods [Online]. In: Bacteriological Analytical Manual. Available: http://www.cfsan.fda.gov/ebam/bam-10.html. Franco Abuin, C.M.E.J. Quinto Fernandez, C. Fente Sampayo, et al. 1994. Susceptibilities of Listeria species isolated from food to nine antimicrobial agents. Antimicrob. Agents Chemother. 38:1655–1657. Gebreyes, W.A., and C. Altier. 2002. Molecular characterization of multidrug-resistant Salmonella enterica subsp. enterica serovar Typhimurium isolates from swine. J. Clin. Microbiol. 40:2813–2822. Godreuil, S., M. Galimand, G. Gerbaud, et al. 2003. Efflux Lde is associated with fluoroquinolone resistance in Listeria monocytogenes. Antimicrob. Agents Chemother. 47:704–708. Guillaume, G., D. Verbrugge, M.L. Chasseur-Libotte, et al. 2000. PCR typing of tetracycline resistance determinants (Tet A-E) in Salmonella enterica serotype Hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol. Ecol. 32:77–85. Hof, H., T. Nichterlein, and M. Kretschmar. 1997. Management of listeriosis. Clin. Microbiol. Rev. 10:345–357. Hofer, C.B., C.E.A. Melles, and E. Hofer. 1999. Listeria monocytogenes in renal transplant recipients. Rev. Inst. Med. Trop. S. Paulo 41:375–377. Keyes, C., C. Hudson, J.J. Maurer, et al. 2000. Detection of florfenicol resistance genes in Escherichia coli isolated from sick chickens. Antimicrob. Agents Chemother. 44:421–424. Kim, E., and T. Aoki. 1996. Sequence analysis of the florfenicol resistance gene encoded in the transferable R-plasmid of a fish pathogen, Pasteurella piscicida. Microbiol. Immunol. 9:605–669. Lanz, R., P. Kuhnert, and P. Boerlin. 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91:73–84. MacGowan, A.P., D.S. Reeves, and J. McLauchlin. 1990. Antimicrobial resistance in Listeria monocytogenes. Lancet 336:513–514. Marco, F., M. Almela, J. Nolla-Sales et al. 2000. In vitro activities of 22 antimicrobial agents against Listeria monocytogenes strains isolated in Barcelona, Spain. Diagnos. Microbiol. Infect. Dis. 38:259–261. Margolles, A., B. Mayo, and C.G. de los Reyes-Gavilan. 2001. Susceptibility of Listeria monocytogenes and Listeria innocua strains isolated from short-ripened cheeses to some antibiotics and heavy metal salts. Food Microbiol. 18:67–73. McEwen, S.A., and P.J. Fedorka-Cray. 2002. Antimicrobial use and resistance in animals. Clin. Infect. Dis. 34:S93–106.
ANTIMICROBIAL RESISTANCE IN LISTERIA MONOCYTOGENES Michalova, E., P. Novotna, and J. Schlegelova. 2004. Tetracyclines in veterinary medicine and bacterial resistance to them. Vet. Med. Czech. 49:79–100. Murinda, S.E., L.T. Nguyen, H.M. Nam, et al. 2004. Detection of sorbitol-negative and sorbitol-positive shiga toxin–Producing Escherichia coli, Listeria monocytogenes, Campylobacter jejuni and Salmonella spp. in dairy farm environmental samples. Foodborne Path. Dis. 1:97–104. NCCLS (National Committee for Clinical Laboratory Standards) 2001. Performance Standards for Antimicrobial Susceptibility Testing—Tenth Informational Supplement. M100-S11. NCCLS, Wayne, PA. NCCLS (National Committee for Clinical Laboratory Standards) 2004. Performance Standards for Antimicrobial Susceptibility Testing—Fourteenth Informational Supplement. M2-A8 and M7-A6. NCCLS, Wayne, PA. Okamoto, K., N. Gotoh, and T. Nishino. 2002. Extrusion of Penem antimicrobials by multicomponent efflux systems MexAB-OprM, MexCD-OprJ, and MexXY-OprM of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 46:2696–2699. Pollock, S.S., T.M. Pollock, and M.J. Harrison. 1986. Ampicillin-resistant Listeria monocytogenes meningitis. Arch. Neurol. 43:106. Pourshaban, M., A.M. Ferrini, V. Mannoni, et al. 2002. Transferable tetracycline resistance in Listeria monocytogenes from food in Italy. J. Med. Microbiol. 51: 564–566. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, et al. 1992. Genetic basis of tetracycline resistance in clinical isolates of Listeria monocytogenes. Antimicrob. Agents Chemother. 36:463–466. Poyart-Salmeron, C., V. Carlier, P. Trieu-Cuot, et al. 1990. Transferable plasmid-mediated antimicrobial resistance in Listeria monocytogenes. Lancet 335:1422–1426. Rota, C., J. Yanguela, D. Blanco, et al. 1996. High prevalence of multiple resistance to antibiotics in 144 Listeria
211
isolates from Spanish dairy and meat products. J. Food Prot. 59:938–943. Slade, P.J., and D.L. Collins-Thompson. 1990. Listeria, plasmids, antibiotic resistance, and food. Lancet 336:1004. Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but susceptible to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817–1824. Vela, A.I., J.F. Fernandez-Garayzabal, M.V. Lat, et al. 2001. Antimicrobial susceptibility of Listeria monocytogenes isolated from meningoencephalitis sheep. Int. J. Antimicrob. Agents 17:215–220. Walsh, D., G. Duffy, J.J. Sheridan, et al. 2001. Antibiotic resistance among Listeria, including Listeria monocytogenes, in retail foods. J. Appl. Microbiol. 90:517–522. White, D.G., C. Hudosn, J.J. Maurer, et al. 2000. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. J. Clin. Microbiol. 38:4593–4598. White, D.G., S. Zhao, S. Simjee, et al. 2002. Antimicrobial resistance of foodborne pathogens. Microb. Infect. 4:405–412. Yan, W., and D.E. Taylor. 1991. Characterization of erythromycin resistance in Campylobacter jejuni and Campylobacter coli. Antimicrob. Agents Chemother. 35: 1989–1996.
Address reprint requests to: S.P. Oliver, Ph.D. Food Safety Center of Excellence University of Tennessee 59 McCord Hall Knoxville, TN 37996 E-mail:
[email protected]
