May 1, 1992 - Malone et al.,â. 1986. Liwnicz et a/.,'. 1985. Potish et al.,â. 1985. McWhirter et al.,â ..... Meadows AT, Baum E, Fossati-Bellani F et al. Second ...
2385
Primitive Neuroectodermal Tumors After Prophylactic Central Nervous System Irradiation in Children Association With an Activated K-ras Gene Oliver Brusfle, MD,* Hiroko Ohgaki, DVM, PhD,* Horst P. Schmift, MD,t Gerhard F. Walter, MD,$ Helmut Osterfag, MD,§ and Paul Kleihues, MD*
Three patients had supratentorial malignant brain tumors 7 to 9 years after prophylactic central nervous system (CNS) treatment for acute lymphocytic leukemia or malignant T-cell lymphoma. Therapy was administered at the age of 3 to 8 years and included cranial irradiation (total dose, 1800 to 2400 cGy) and intrathecal methotrexate. The brain tumors had histologic and immunohistochemical features of primitive neuroectodermal tumors (PNET), including neuroblastic rosettes, rhythmic arrangement of tumor cells, and immunohistochemical expression of glial, and in one patient neuronal, marker proteins. Using polymerase chain reaction-mediated DNA amplification from paraffin-embedded tissues and subsequent DNA sequence analysis, an activating point mutation was detected in the K-ras protooncogene in one tumor. This mutation was a G to A transition in position 2 of codon 12, substituting aspartate (GAT) for glycine (GGT). This type of mutation has not been observed before in human brain tumors, but it is frequent in radiation-induced murine lymphomas. These observations suggest that PNET can be induced after completion of the embryonal and fetal development of the human CNS. Oncogene-activating point mutations may represent a pathoFrom the *Laboratory of Neuropathology, Institute of Pathology, University of Zurich, Zurich, Switzerland; the tInstitute of Neuropathology, University of Heidelberg, Heidelberg, Germany; and the $Institute of Neuropathology, University of Hannover, and the §Institute of Pathology, Krankenhaus Nordstadt, Hannover, Germany. Supported in part by the Swiss National Science Foundation, Bern, Switzerland. The authors thank Dr. D. Zimmermann, University of Zurich, for synthesizing the PCR and sequencing primers. Clinical data were provided by Professors H. Riehm and M. Samii, Hannover; H. Bickel and S. Kunze, Heidelberg; and D. Stolke, Essen, Germany. Address for reprints: Paul Kleihues, MD, Institute of Pathology, University Zurich, Schmelzbergstrasse 12, CH-8091 Zurich, Switzerland. Accepted for publication August 1, 1991.
genetic mechanism involved in the genesis of radiationinduced brain tumors. Cancer 1992; 69:2385-2392.
Induction of tumors in the human central nervous system (CNS) by radiation is well documented.',' In most of the reported cases, radiation therapy was administered for treatment of cranial tumors unrelated to the radiation-induced malignancy or of fungal disease such as tinea capitis.' Radiation doses varied from 140 to 14500 cGy. Among the resulting second primary malignant lesions (SPM), meningiomas, sarcomas, and gliomas were most frequent and appeared after latent periods ranging from l to 47 years.' For the past few years, another group of suspected radiation-induced brain tumors has been observed in children which received prophylactic CNS treatment for acute lymphocytic leukemia (ALL) or lymphoma in early childhood.'-21 The therapy consisted of cranial irradiation and intrathecal methotrexate. Most of these SPM were classified as gliomas, with only four exceptions: a meningioma," a meningeal melanocytoma,"j a fibrosarcoma,' and a primitive neuroectodermal tumor (PNET).19A genetic link was suggested by several authors to explain the close association of ALL and gliorna~.~'-'~ We report the cases of three children who had malignant brain tumors after prophylactic CNS treatment for ALL (Patients 2 and 3) and malignant T-cell lymphoma (Patient 1).Morphologically and immunohistochemically,these neoplasms resembled PNET, i.e., embryonal childhood tumors thought to originate from multipotent precursor cells. Because, in animal models, mutational activation of the K-ras, and less frequently the N-ras, protooncogenes has been described in radlation-induced thymo-
2386
CANCER Ma y 1, 2992, Volume 69, No. 9
mas,25-27we used the polymerase chain reaction (PCR) and direct sequencing to screen for rus mutations. One of the three brain tumors showed an activating point mutation in codon 12 of the K-rus gene, resulting in a substitution of glycine (GGT) by aspartate (GAT).
Table 1. Sequences of Primer Oligonucleotides Used for Amplification and Sequencing of the K-ras and N-ras Protooncogenes PCR primers
Materials and Methods
Histologic and Immunohistochemical Examinations Biopsy specimens were fixed in formalin 10% and embedded in paraffin. Sections (4 pm) were stained with hematoxylin and eosin (H&E)and reticulin stain. Immunohistochemical analysis was done using the immunoperoxidase method with antibodies to glial fibrillary acidic protein (GFAP, diluted 1:250), neuron-specific enolase (NSE, 1:100),synaptophysin (l:lOO), leukocyte common antigen (1:lOO) and S-100 protein (1:200). All antibodies were obtained from Dakopatts (Copenhagen, Denmark).
Polymerase Chain Reaction The DNA was extracted and amplified from 8-pm paraffin-embedded sections. Regions of interest identified in a consecutive H&E-stained section were scraped off with an autoclaved spatula while avoiding contamination with nontumor tissue. For deparaffinization, probes were incubated in xylene for 30 minutes at room temperature in a 1.5-ml Eppendorf tube (Hamburg, Germany). After centrifugation for 10 minutes at 14,000 rpm, the pellet was washed in absolute ethanol and dried at room temperature. The samples were incubated in 50 mmol/l tris (pH 8.5), 1 mmol/l ethylenediamine tetraacetic acid, and Tween 20 0.570, containing 200 pg/ml of proteinase K at 55°C for 3 hours. After inactivation of proteinase K at 95°C for 10 minutes, the samples were centrifuged for 30 seconds at 14,000 rpm, and the supernatant underwent 40 cycles of PCR amplification. Oligomers flanking codon 12/13 of the Kyas gene and codon 61 of the N-ras gene were synthesized using the phosphoramidite methods on a Model 391 PCR-MATE ET DNA synthesizer (Applied Biosystems, Foster City, CA), purified by spun-column chromatography on a Sephadex G-25 column (Boeringer, Mannheim, Germany), and used as PCR primers. The primer sequences corresponded to those previously reported (Table 1)'' For annealing, genomic DNA and 50 picomoles of each primer were incubated in a 75-p1 volume at 95°C for 7 minutes and cooled on ice. The PCR buffer (10 mmol/l tris [pH 8.3],50 mmol/l KCl, and 2.5 mmol/l MgCl,), 0.1 mmol/l of each of the four deoxyribonucleoside triphosphates, and 2.5 units of Taq polymerase (Amplitaq, Perkin Elmer Cetus, Norwalk, CT) were added, resulting in a reaction volume of 100 pl.
K-ras codon 12/13 N-ras codon 61
Sequencing Primers
K-ras codon 12/13 N-ras codon 61
5' 3' GACTGAATATAAACTTGTGG* CTATTGTTGGATCATATTCGT TCTTACAGAAAACAAGTGGT* ATACACAGAGGAAGCCTTCGt TCTGAATTAGCTGTATCGTCT GGTGAAACCTGTTTGTTGGA*
PCR: polymerase chain reaction
* Sense.
t Antisense.
The samples were overlaid with 50 pl of mineral oil and underwent PCR using an automated thermal cycler (Perkin Elmer Cetus). The cycling parameters were 1 minute of denaturing at 94"C, 1 minute of annealing at 45"C, and 1.5 minutes of polymerization at 72°C. Amplified 107 and 109-base pair sequences were identified by agarose gel electrophoresis. D N A Sequencing Bands of amplified DNA were excised and electroeluted from a low-melting agarose 4% gel (150 V for 1.5 hours in 0.5X 45 mmol/l Tris base, 45 mmol/l boric acid, 2 mmol/l EDTA [TBE buffer]). The DNA was purified using an ELUTIP-D column (Schleicher & Schuell, Dassel, Germany) and subsequent ethanol precipitation. The pellet was dried at room temperature and resuspended in 12 pl of 10 mmol/l Tris base, 1 mmol/l EDTA (TE buffer). One third of this sample was sequenced by an earlier modifiedz9using the Sequenase kit (USB, Cleveland, OH). Sequencing primers were synthesized and purified as described. For primer annealing, a volume of 10 pl, containing 10 picomoles of sequencing primer, 4 pl of amplified DNA, 1 pl of Sequenase reaction buffer (200 mmol/l tris HCI [pH 7.51, 100 mmol/l MgCl,, and 250 mmol/l NaCl), and 1 pl of dimethylsulfoxide, was incubated at 95°C for 7 minutes and immediately cooled in ethanol and dry ice. After adding 1 pl of 0.1 mol/l dithiothreitol, 5 pCi of (alpha35S)-deoxyadenosinetriphosphate, and 4 units of Sequenase version 2.0 enzyme, 3.6 pl of this mixture was added to four tubes containing 2.5 11.1 of the four dideoxynucleoside termination mixtures (80 pmol/l of each deoxynucleoside triphosphate, 8 pmol/l of each dideoxynucleoside triphosphate, and 50 mmol/l NaC1) and incubated 10 minutes at 37°C. The reaction was terminated by adding 4 111 of stop solution (formamide 95%, 20 mmol/I ethylenediamine tetraacetic acid, bromophenol blue 0.05%, and xylene cyanol FF 0.05%) to each tube. The samples were incubated at 85°C for 3 minutes and underwent polyacrylamide gel electropho-
PNET After CNS Irradiation/Brustle et al.
resis on a 7 mol/l urea-acrylamide 8% sequence gel. After drying, the gel was exposed to x-ray film. Case Reports
Case 1 This 8-year-old boy had recurrent pain in the epigastrium, coughing, dyspnea, and distention of the jugular veins. Radiography revealed enlargement of the mediastinum and pleural effusion. Cytologic examination of pleural fluid showed non-Hodgkin’s T-cell lymphoma. No further manifestations were detected with the exception of a thymic lymphoma. The boy was treated with polychemotherapy, including cyclophosphamide, vincristine sulfate, prednisone, daunorubicin, asparaginase, cytarabine, methotrexate, and mercaptopurine. In addition, he received 3000 cGy of mediastinal irradiation. Prophylactic CNS treatment included cranial irradiation (total dose, 1800 cGy) and intrathecal application of methotrexate. Complete remission was achieved, and the chemotherapy was stopped after 2 years. Six and one-half years after brain irradiation, the patient had generalized weakness, recurrent headaches, and vomiting. Language dysfunction and a right-sided hemiparesis occurred. Computed tomography revealed an 8-cm cystic lesion in the left parietal region. The neurosurgical biopsy (R-1642) showed a tumor of high cellularity with striking rhythmic architecture (Fig. 1A) and focal formation of Homer-Wright rosettes. Although polymorphism of tumor cells was moderate, its malignant character was evident by the presence of numerous mitoses and endothelial proliferation. The tumor diffusely infiltrated adjacent brain tissue. Immunohistochemically, sparsely scattered GFAP-positive tumor cells were found. No expression of neuronal antigens could be detected. A considerable fraction of tumor cells stained positive with an antibody to S-100 protein. The histopathologic diagnosis was PNET. Postoperative treatment included polychemotherapy and radiation therapy with 3500 cGy to the whole brain and 5000 cGy to the tumor site. Four years after diagnosis of the SPM, the patient is still doing well.
Case 2 A 4-year-old boy had ALL. In addition to polychemotherapy with prednisone, vincristine sulfate, mercaptopurine, and methotrexate, prophylactic CNS treatment was administered (2400 cGy of cranial irradiation and intrathecal methotrexate). Complete remission was achieved, and the chemotherapy was stopped 1.5 years later. Approximately 9 years after the initial diagnosis of ALL, the patient had partial seizures on the left side, a paresis of the left facial nerve, and subsequently, a left-sided hemiparesis. Computed tomography showed a tumor in the right parietal region with perifocal edema. During surgery, a 6-cm cystic neoplasm was found. The surgical biopsy (R-1611) showed a highly cellular tumor, diffusely infiltrating the adjacent brain tissue. The tumor cells contained small round-to-oval nuclei with dark granulated
2387
karyoplasm, surrounded by a small rim of eosinophilic cytoplasm. They were often arranged in long streams or formed neuroblastic rosettes (Fig. 1B). Vascularization was abundant and frequently combined with marked endothelial proliferation. Furthermore, a high mitotic activity and small areas of necrosis were prominent. Immunohistochemically, GFAP-expressing tumor cells were conspicuous (Fig. 1D). Although expression of neuronal antigens was absent, a considerable fraction of tumor cells stained positive with an antibody to S-100 protein. High cellularity, the presence of rhythmic architecture, and the mentioned ;riteria of malignant differentiation prompted the diagnosis of PNET. Surgery was followed by polychemotherapy and cranial irradiation at a dose of 1900 cGy to the head and a tumor dose of 3000 cGy. Currently (4years after removal of the SPM), the patient is in remission with left-sided hemiparesis remaining.
Case 3 A girl had ALL at the age of 3 years. In addition to polychemotherapy, she received prophylactic cranial irradiation (total dose, 2400 cGy) and intrathecal methotrexate. Within the first year after the diagnosis of ALL, she had psychomotor seizures. Two years later, the diagnosis of a calcifying encephalopathy was made. Eight years after the initial diagnosis of ALL (5 years after cessation of therapy), the patient had impaired consciousness. Computed tomography showed two masses in the left postcentral region, one of them containing a cyst. The biopsy specimen (R-2999) showed a tumor with intermediate-to-high cellularity. Tumor cell nuclei were small to intermediate and polymorphous. The tumor cells produced a fibrillary, slightly eosinophilic matrix, which often appeared microcystic. In some areas, tumor cells were arranged in streams or rosettes (Fig. 1C). Focally, they contained large nuclei with prominent nucleoli, thus strongly resembling neuronal cells. High mitotic activity and prominent endothelial proliferation were present. Immunohistochemically, some tumor cells expressed GFAP. The GFAP-positive cells often showed a striking vacuolar cytoplasm. In addition, immunoreactivity to NSE and synaptophysin was prominent and particularly pronounced in cells with ganglioid appearance (Figs. 1E and 1F). Numerous tumor cells stained positively with an antibody to S-100 protein. The histopathologic features and the evidence of bidirectional glial and neuronal differentiation were compatible with the diagnosis of PNET. The patient received postoperative radiation therapy at a total dose of 7900 cGy at the tumor site. Four months after removal of the brain tumor, hydrocephalus developed and was treated with a ventriculoatrial shunt. Two months later, she had progressive paraparesis and urine bladder dysfunction. Magnetic resonance imaging showed a spinal lesion in the region of the lumbar enlargement. During surgery, a layer of tumor diffusely covered the conus medullaris and cauda equina. The biopsy tissue was compatible with a spinal metastasis of the intracerebral PNET. However, immunohistochemical expression of neuronal antigens was no longer present. Postoperatively, the patient received radiation therapy of the spinal cord (3000 cGy). She died 4 months later at the age of 14 years. No autopsy was done.
2388
CANCER May 1, 1992, Volume 69, No. 9
Figure 1. A-F Histology of brain tumors which developed after prophylactic cranial irradiation. The highly cellular tumors show prominent rhythmic architecture and focal formation of rosettes suggesting neuronal differentiation. (A-C, cases 1-3, H & E, X120). Bidirectional glial/ neuronal differentiation is confirmed by immunohistochemistry for glial fibrillary acidic protein (D, case 2, X360), neuron-specific enolase (E, case 3, X360) and synaptophysin (F, case 3, X360). Notice the occasional ganglioid appearance of tumor cells (F, arrow).
DNA Sequence Analysis
Sequencing of PCR-amplified DNA allowed discrimination of approximately 60 nucleotides surrounding the codons of interest. The analysis of the N-ras sequence including codon 6 1 revealed sequences homologous to
the wild-type reported previously3" in all three tumor specimens. However, when the K-ras codon 12/13 was analyzed, a G to A transition in position 2 of codon 12 was detected in the specimen from Patient 2 (Fig. 2). The mutation was confirmed by repeated sequencing of independently prepared and amplified DNA. The DNA
PNET After CNS Irradiation/Brustle e t al.
Figure 2. Sequence analysis of the K-rus gene reveals a G to A transition in the second position of codon 12 from tumor in Patient 2 (arrow). No mutations were detected in control tissues or DNA from Patients 1 and 3. Notice: the gel shows the antisense sequence.
codon 12
2389
Case 2
Control
Case 1
Case 3
A C G T
A C G T
A C G T
A C G T
c
extracted from normal human brain (autopsy material) was used as a negative control (Fig. 2). No mutations were found in the biopsy specimens of Patients 1and 3.
although reports on the carcinogenic potential of methotrexate alone are contr~versial.'~ From Table 2, it is apparent that most brain tumors were classified as supratentorial malignant gliomas. A ~ notable exception is the report by Barasch et ~ 1 . ' In Discussion their case, histopathologic examination showed striking similarities with features typically seen in PNET, inIn rare cases, therapeutic or prophylactic cranial irracluding immunoreactivity for glial and neuronal marker diation is followed by the development of malignant antigens. The specimens from our three patients also brain tumors.',' The criteria used for defining a causal had histopathologic findings typical for PNET, ie., relationship between irradiation and the SPM include a highly cellular tumors with hyperchromatic nuclei, long asymptomatic latent period, the location of the scant cytoplasm, and marked mitotic activity.34The SPM in the irradiated area, and histologic findings difpresence of rhythmic architecture and the formation of ferent from that of the primary malignant l e ~ i o n . ' , ' ~ , ~ neuroblastic ~ (Homer-Wright) rosettes indicated a tenOur review of the literature found 31 reported cases of dency for neuronal differentiation. This was confirmed brain tumors after prophylactic CNS treatment for ALL by immunohistochemical studies showing expression or malignant lymphoma in early childhood. Their releof the neuronal marker antigens, NSE and synaptophyvant clinical data and the respective histopathologic sin in the specimen of Patient 3. Although NSE has diagnoses are summarized in Table 2, which also conlimited specificity for neurons, extensive immunohistochemical studies on cerebellar medulloblastomas, ie., tains our three patients. Not included are nine cases mentioned in an abstract by Albo et aL3' because of the infratentorial PNET, revealed that the focal expression lack of detailed clinical and pathologic data. In the docuof this antigen indicates incipient neuronal differentiamented 31 cases, the mean age at cranial irradiation ti01-1.~~ Synaptophysin is a reliable marker for neuronal differentiation in PNET36,37and works well on formawas 4.8years, and the mean latent period was 7.6 years. The similarities concerning the type of primary cancer, lin-fixed paraffin-embedded tissues. The immunoreactivity of PNET to neurofilament proteins is consistently patient age, and the treatment protocol (2400 cGy of cranial irradiation plus intrathecal methotrexate) propresent only in frozen biopsy tissue.37Focal astrocytic vide almost "experimental conditions" for risk evaluadifferentiation was identified immunohistochemically tion and studies on the pathogenesis of these SPM. Nevby expression of GFAP in all three cases. ertheless, some authors" do not consider radiation a It has been proposed that supratentorial PNET origcausative factor. other^'^,'^"^ propose a synergistic efinate from the subependymal matrix cell. Histopathofect of radiation therapy and intrathecal methotrexate, logically, these neoplasms are composed of undiff eren-
ocumented Cases of Brain Tumors After Prophylactic Central Nervous System Treatment of Lymphoid Malignancies in Childhood
ource a l t e r ~ 1979 ,~ hung et al.,4 1981 anders et 0 1 . , ~1982 iberin et 0 1 . , ~ 1984 nderson and T r e i ~1984 ,~ udge et al.,’ 1984 affel et al.,9 1985 alone et a[.,” 1986 alone et al.,” 1986 iwnicz et a/.,’ 1985 otish et al.,” 1985 cWhirter et al.,” 1986 ulhern et 1986 arus et a l . , I 4 1986 ontana et 1987 ontana et ~ l . , ’ ~1987 ontana et a[.,” 1987 imm et al.,I6 1987 imm et a1.,I6 1987 ngram et 1987 alma et al.,” 1988 arasch et 1988 hapiro et a/.,’ 1989 hapiro et a/.,’ 1989 hapiro et al.,’ 1989 hapiro et al.,’ 1989 hapiro et al.,’ 1989 avin et al.,” 1990 avin et ~ l . , ’ ~1990 alvati et a[.,” 1991 alvati et al.,” 1991 urrent study ase 1 ase 2 ase 3 andard deviation
Sex
Primary malignancy
TCL ALL ALL
M M F
ALL ALL ALL ALL ALL ALL ALL ALL ALL BL ALL ALL ALL LL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL ALL
F M F F F F F M F M NS M M M M F M M M M M F M F F M F M F M F
Age at radiation (yr) 3 2 4 2 3 3 6 19 6 5 4 2 2 10 6 6 3 5 3 2 3 3 3 2 5 4 6 1 3 12 10
8 4 3 4.8 k 3.6
Radiation dose (cGy) 2623 2400 2400 + TBI 2200 2400 2400 2400 2516 2400 1800 NS 4800 2400 3200 NI 2400 2400 2400 2400 2400 2000 0 1 2400 2400 4800 2400 2400 2400 2400 2400 2400 2400 2400
+
+
1800 2400 2400
IT-MTX Yes Yes Yes Yes NS Yes Yes Yes Yes Yes NS Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes NS Yes NS NS NS Yes Yes Yes NS Yes Yes Yes
Interval* 6 5 5 7 6 9 7 5 5 5 13 8 8 7 11 10 10 10 6 6 11 10 7 9 6 4 4 9 7 6 11
7 9 8 7.6 f 2.3
Second malignancy Astrocytoma I1 Glioblastoma Glioblastoma Sarcoma of meningeal o r i p Astrocytoma I1 Malignant astrocytoma Anaplastic astrocytoma Astrocytoma I1 Astrocytoma 111 Anaplastic astrocytoma Meningioma Astrocytoma 111 Glioblastoma Malignant glioma IV Glioblastoma Anaplastic astrocytoma Glioblastoma Glioblastoma Meningeal melanocytoma Astrocytoma (no grading) Mixed glioma (no grading) PNET Malignant astrocytoma Gliomatosis cerebri Anaplastic astrocytoma Anaplastic astrocytoma Glioblastoma Glioblastoma Glioblastoma Glioblastoma Glioblastoma PNET PNET PNET
Localization of second mal Left frontal Left parietal Both cerebral hemispheres ( Right frontal Left parietal Right frontoparietal Right cerebellum Bght temporoparietal Right parietal Left cerebral hemisphere ( Parietal Pons Right parietal Right cerebellum Right cerebral hemisphere ( Left frontotemporal Right frontoparietal Left frontotemporal Adjacent to pons NS Right frontoparietal Left frontal Left frontal Both cerebral hemispheres ( NS Left parietal Right temporoparietal Left cerebral hemisphere Left frontoparietal Right frontal/corpus callos Left frontotemporal Left parietal Right parietal Left parietal
lymphatic leukemia; BL: Burkitt’s lymphoma; LL: lymphocytic lymphoma; TCL: T-cell lymphoma, TBI: total body irradiation 1000 cCy; NI: neck irradiation 3000 cCy; 01: orbital irradia rathecal methotrexate; NS: not stated; PNET: primitive neuroectodermal tumor. r radiation to second malignancy in years.
PNET After CNS Irradiation/BrustIe et al.
tiated round cells that, similar to nontransformed matrix cells, have the potential for neuronal and glial differentiati~n.~~ From this definition of the PNET as an embryonal tumor, we would expect prenatal initiation of malignant transformation. Induction of this tumor type by postnatal irradiation appears less likely. No embryonal tumors were found among 208 radiation-associated SPM.23Our observations and those of otherslgof PNET after cranial irradiation might suggest the persistence of a pool of undifferentiated precursor cells capable of bidirectional glial and neuronal differentiation that is susceptible to neoplastic transformation after the completion of fetal development. There is also a possibility that neoplastic transformation of these embryonal precursor cells is initiated prenatally, e.g., through loss or mutational inactivation of one allele of a tumor-suppressor gene. Deletion of the short arm of chromosome 17 is a common finding in medulloblastoma,38 and chromosome 17p harbors the p53 suppressor gene l o c u ~ .Recently, ~ ~ , ~ ~germ-line transmission of p53 mutations was reported to underlie the Li-Fraumeni cancer ~ y n d r o m e . ~This ~ , ~disorder ’ predisposes the patient to brain tumors in addition to breast cancer, sarcomas, leukemias, and various other malignant lesions.43 Because affected patients usually have tumors in the second and third decade, it is assumed that additional genetic alterations are required for tumorigenesis. A similar mechanism could be operative in the pathogenesis of brain tumors after cranial irradiation. Again, the long intervals from primary lesion to SPM indicate that radiation-induced carcinogenesis is a multistep process in which different genetic alterations, e.g., activation of protooncogenes and/or loss of suppressor genes, are required. A genetic predisposition was suggested by several a ~ t h o r s ~ to ~ -explain ’~ the occasional association of lymphoid malignant lesions and gliomas. This was supported by the observation of gliomas as primary cancers, followed by the development of lymphoma” or of gliomas as SPM after ALL without prophylactic CNS treatment.44The cases of two young siblings, one with glioblastoma and non-Hodgkin’s lymphoma and the other with glioma and acute leukemia, were described.45 Point mutations in ras genes have been detected in radiation-induced murine thymic lymphoma^.*^-*^ Most frequent are GGT to GAT transitions in codon 12 of the K-ras gene. This mutation was identified by PCR and direct DNA sequencing in the specimen from Patient 2, suggesting that, in humans, K-ras mutations also are involved in radiation-associated tumorigenesis. To our knowledge, this is the first report on a mutationally activated K-ras gene in a human brain tumor. Loss of mutated ras genes during tumor progression could explain the absence of mutated ras genes in the other
2391
two biopsy specimens. It is known that these mutations are not essential to maintain the malignant phenotype.46We also looked for mutations in the N-ras protooncogene activated in the SK-N-SH human neuroblastoma cell line by a point mutation located in codon 61.30,47 Recently, it was reported that activated N-ras genes were found in 2 of 15 investigated primary neurob l a ~ t o m a sAll . ~ ~three tumor specimens we studied had normal sequences for the N-ras gene in and around codon 61. In conclusion, PNET appear to be a rare complication after prophylactic cranial irradiation and intrathecal methotrexate. The inducibility of PNET after completion of embryonal and fetal development suggests the persistence of pluripotent precursor cells after birth. Our findings indicate that mutational activation of the K-ras gene is one of several genetic alterations involved in the pathogenesis of radiation-associated brain tumors. Molecular genetic studies may reveal whether, and to what extent, there is a genetic predisposition for the development of SPM in the nervous system. References 1. Liwnicz BH, Berger TS, Liwnicz RG, Aron BS. Radiation-associated gliomas: A report of four cases and analysis of postradiation tumors of the central nervous system. Neurosurgery 1985; 17:436-445. 2. Shapiro S, Mealey J, Sartorius C. Radiation-induced intracranial malignant gliomas. Neurosurg 1989; 71:77-82. 3. Walters TR. Childhood acute lymphocytic leukemia with a second primary neoplasm. Am IPediatr Hematol Oncol 1979; 1:285287. 4. Chung CK, Stryker JA, Cruse R, Vannuci R, Towfighi J. Glioblastoma multiforme following prophylactic cranial irradiation and intrathecal methotrexate in a child with acute lymphocytic leukemia. Cancer 1981; 47:2563-2566. 5. Sanders J, Sale GE, Ramberg R, Clift R, Buckner CD, Thomas ED. Glioblastoma multiforme in a patient with acute lymphoblastic leukemia who received a marrow transplant. Transplant Proc 1982; 14:770-774. 6. Tiberin P, Maor E, Zaizov R et al. Brain sarcoma of meningeal o r i p after cranial irradiation in childhood acute lymphocytic leukemia. 1 Neurosurg 1984; 61:772-776. 7. Anderson JR, Treip CS. Radiation-induced intracranial neoplasms. Cancer 1984; 53:426-429. 8. Judge MR, Eden OB, O’Neill P. Cerebral glioma after cranial prophylaxis for acute lymphoblastic leukemia. Br Med ] 1984; 289:1038-1039. 9. Raffel C, Edwards MSB, Davis RL, Ablin AR. Postirradiation cerebellar glioma. Neurosurg 1985; 62:300-303. 10. Malone M, Lumley H, Erdohazi M. Astrocytoma as a second malignancy in patients with acute lymphoblastic leukemia. Cancer 1986; 57:1979-1985. 11. Potish RA, Dehner LP, Haselow RE, Kim TH, Levitt SH, Nesbit M. The incidence of second neoplasms following megavoltage radiation for pediatric tumors. Cancer 1985; 56:1534-1537. 12. McWhirter WR, Pearn JH, Smith H, O’Regan P. Cerebral astrocytoma as a complication of acute lymphoblastic leukaemia. M e d 7 Aust 1986; 145:96-97.
2392
CANCER May 1, 1992, Volume 69, No. 9
13 Mulhem RK, Wasserman AL, Kovnar EH, Williams JM, Ochs JJ. Serial neuropsychological studies of a child with acute lymphoblastic leukemia and subsequent glioblastoma multiforme. Neurology 1986; 36:1534-1538. 14. Marus G, Levin CV, Rutherfoord GS. Malignant glioma following radiotherapy, for unrelated primary tumors. Cancer 1986; 58:886-894. 15 Fontana M, Stanton C, Pompili A et al. Late multifocal gliomas in adolescents previously treated for acute lymphoblastic leukemia. Cancer 1987; 60:1510-1518. 16. Rimm IJ, Li FC, Tarbell NJ, Winston KR, Sallan SE. Brain tumors after cranial irradiation for childhood acute lymphoblastic leukemia. Cancer 1987; 59:1506-1508. 17. Ingram L, Mott MG, Mann JR, Raafat F, Darbyshire PJ, Jones PHM. Second malignancies in children treated for non-Hodgkin’s lymphoma and T-cell leukaemia with the UKCCSG regimens. Br J Cancer 1987; 55:463-466. 18. Palma L, Vagnozzi R, Annino L, Clapetta P, Maleci A. Post-radiation glioma in a child. Childs N e w Syst 1988; 4:296-301. 19. Barasch ES, Altieri D, Decker RE, Ahmed S, Lin J. Primitive neuroectodermal tumor presenting as a delayed sequela to cranial irradiation and intrathecal methotrexate. Neurology 1988; 4:375-378. 20. Cavin LW, Dalrymple GV, McGuire EL, Maners AW, Broadware JR. CNS tumor induction by radiotherapy: A report of four new cases and estimate of dose required. Int J Radiat Oncol Biol Phys 1990; 18:399-406. 21. Salvati M, Artico M, Caruso R, Rocchi G, Orlando ER, Nucci F. A report on radiation-induced gliomas. Cancer 1991; 67392397. 22. Meadows AT, DAngio GJ, Mike V et al. Patterns of second malignant neoplasms in children. Cancer 1977; 40:1903-1911. 23. Meadows AT, Baum E, Fossati-Bellani F et al. Second malignant neoplasms in children: An update from the late effects study group. ] Clin Oncol 1985; 3:532-538. 24. Farwell J, Flannery JT. Cancer in relatives of children with central nervous system neoplasms. N Engl J Med 1984; 311:749753. 25. Guerrero I, Villasante A, Corces V, Pellicer A. Activation of a c-K-ras oncogene by somatic mutation in mouse lymphomas induced by gamma radiation. Science 1984; 225:1159-1162. 26. Guerrero I, Villasante A, Diamond L et al. Oncogene activation and surface markers in mouse lymphomas induced by radiation and nitrosomethylurea. Leuk Res 1986; 10:851-858.. 27. Newcomb EW, Diamond LE, Sloan SR, Corominas M, Guerrero I, Pellicer A. Radiation and chemical activation of ras oncogenes in different mouse strains. Environ Health Perspect 1989; 81:3337. 28. Tada M, Omata M, Ohto M. Analysis of ras gene mutations in human hepatic malignant tumors by polymerase chain reaction and direct sequencing. Cancer Res 1990; 50:1121-1124. 29. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chainterminating inhibitors. PYOCNail Acad Sci U S A 1977; 74:54635463.
30. Taparowsky E, Shimizu K, Goldfarb M, Wigler M. Structure and activation of the human N-ras gene. Cell 1983; 34581-586. 31. Cahan WG, Woodard HQ, Higinbotham NL, Stewart FW, Coley BL. Sarcoma arising in irradiated bone. Cancer 1948; 1:3-29. 32. Albo V, Miller D, Leiken S, Sather H, Hammond D. Nine brain tumors as a late effect in children “cured” of acute lymphoblastic leukemia (ALL) from a single protocol study (Abstr). Proc A m Soc Clin Oncol 1985; 4:172. 33. Hams CC. Immunosuppressive anticancer drugs in man: Their oncogenic potential. Radiology 1975; 114:163-166. 34. Rorke LB. The cerebellar medulloblastoma and its relationship to primitive neuroectodermal tumors. ] Neuropathol Exp Neurol 1983; 42:1-15. 35. Burger PC, Grahmann FC, Bliestle A, Kleihues P. Differentiation in the medulloblastoma: A histological and immunohistochemical study. Acta Neuropathol (Bed) 1987; 73:115-123. 36. Schwechheimer K, Wiedenmann B, Franke KK. Synaptophysin: A reliable marker for medulloblastomas. Virchows Arch [A] 1987; 411:53-59. 37. Gould VE, Jansson DS, Molenaar WM et al. Primitive neuroectodermal tumors of the central nervous system: Patterns of expression of neuroendocrine markers, and all classes of intermediate filament proteins. Lab Invest 1990; 62:498-509. 38. Raffel C, Gilles FE, Weinberg KI. Reduction to homozygosity and gene amplification in central nervous system primitive neuroectodermal tumors of childhood. Cancer Res 1990; 50:587591. 39. McBride OW, Merry D, Givol D. The gene for human p53 cellular tumor antigen is located on chromosome 17 short arm (17~13). Proc Nail Acad Sci U S A 1986; 83:130-134. 40. Baker SJ, Fearon ER, Nigro JM et al. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 1989; 244:217-221. 41. Srivastava S, Zou 2, Pirollo K, Blattner W, Chang EH. Gem-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 1990; 348:747-749. 42. Malkin D, Li FP, Strong LC et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas and other neoplasms. Science 1990; 250:1233-1238. 43. Li FP, Fraumeni JF. Soft-tissue sarcomas, breast cancer, and other neoplasms: A familial syndrome? A n n Intern Med 1969; 711747-752. 44. Tefft M, Vawter GF, Mitus A. Second primary neoplasms in children. AJR 1968; 103:800-822. 45. Li FP, McIntosh S, Peng-Whang J. Double primary cancers in 2 young sibs, leukemia in another, and dextrocardia in a fourth. Cancer 1977; 39:2633-2636. 46. Fan CJ, Saiki RK, Erlich HA, McCormick F, Marshall CJ. Analysis of ras gene mutations in acute myeloid leukemia by polymer-. ase chain reaction and oligonucleotide probes. Proc Nat[ Acad Sci U S A 1988; 85:1629-1633. 47. Shimizu K, Goldfarb M, Suard Y, Pemcho M, Li Y, Wigler MH. Three human transforming genes are related to the viral ras oncogenes. Proc Natl Acad Sci U S A 1983; 80:2112-2116. 48. Ireland CM. Activated N-ras oncogenes in human neuroblastoma. Cancer Res 1989; 495530-5533.
