Pro

Veterinary Immunology and Immunopathology 113 (2006) 305–312 www.elsevier.com/locate/vetimm

Identification of two allelic forms of ovine CD4 exhibiting a Ser183/Pro183 polymorphism in the coding sequence of domain 3 R. Boscariol a,b,1, J. Pleasance c,1, D.M. Piedrafita c, H.W. Raadsma d, T.W. Spithill a,b,* a

Institute of Parasitology, McGill University, 21111 Lakeshore Road, Ste-Anne-de-Bellevue, Que´. H9X3V9, Canada b Centre for Host-Parasite Interactions, McGill University, Ste-Anne-de-Bellevue, Que´. H9X3V9, Canada c Center for Animal Biotechnology, University of Melbourne, Parkville 3050, Australia d Reprogen, University of Sydney, Camden 2570, Australia Received 27 February 2006; accepted 24 May 2006

Abstract The ovine CD4 cDNA sequence from four sheep sources (Australian Merino, Indonesian Thin Tail, Canadian cross bred, Prealpes du sud) predicts a protein of 455 residues with position 130 in the V2 domain exhibiting a W instead of C suggesting that, like the white whale, dog and cat sequences, sheep CD4 contains only two disulphide bonds. The sequence shows 73% amino acid identity and 83% nucleotide identity to a CD4 sequence from the white whale and significant identity to a partial sequence (314 residues) of bovine CD4 (87% amino acid identity, 93% nucleotide identity). Phylogenetic analysis showed that the ovine CD4 sequence forms a clade with the pig, white whale, dolphin, dog and cat CD4. Two forms of ovine CD4 were identified which differ by a single base pair (T/C) in their cDNA sequence at position 622. This polymorphism is also present in sheep genomic DNA in Hardy–Weinberg equilibrium, suggesting that at least two alleles of CD4 exist in the ovine genome with no selection for a particular allele. This polymorphism changes the first codon position of amino acid 183 and results in a Pro/Ser substitution in the N-terminal region of domain 3 of the CD4 protein. # 2006 Elsevier B.V. All rights reserved. Keywords: Sheep; Ovine; CD4; cDNA sequence; Polymorphism; CD4 domain 3; Pyrosequencing

1. Introduction The CD4 molecule is a cell-surface glycoprotein comprised of four extracellular, immunoglobulin-like domains joined in a rod-like structure, a hydrophobic transmembrane domain and a cytoplasmic tail (Kwong

* Corresponding author. Tel.: +1 514 398 8668; fax: +1 514 398 7857. E-mail address: [email protected] (T.W. Spithill). 1 They contributed equally to this study. 0165-2427/$ – see front matter # 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2006.05.015

et al., 1990; Maddon et al., 1985, 1987). Although found on the surface of many cells of the immune system such as B cells, macrophages and granulocytes (Maddon et al., 1987), CD4 is most well characterized on the surface of thymocytes and a subset of mature T cells where it plays a crucial role as a co-ligand and a coreceptor in T cell development (Swain, 1983) and the generation of both cellular and humoral immune responses. Extracellularly, CD4 interacts with the invariant regions of the major histocompatibility complex class II molecule (Konig et al., 1992; Swain, 1983), increasing the binding affinity of the T cell

306

R. Boscariol et al. / Veterinary Immunology and Immunopathology 113 (2006) 305–312

receptor for the peptide: MHC class II complex (Gay et al., 1986). Within the cell, the cytoplasmic tail of CD4 is associated with the protein tyrosine kinase p56lck, potentiating the signalling of the T cell receptor (Rudd et al., 1989; Veillette et al., 1989). In humans, CD4 also serves as the primary cellular receptor for human immunodeficiency virus 1 (HIV-1) (Dalgleish et al., 1984; Klatzmann et al., 1984). Overall, the CD4 molecule seems highly conserved among different species. Variability within species has largely been examined at the protein level examining the antigenicity of CD4 using monoclonal antibodies, which showed that limited heterogeneity could be identified. In the well-studied human CD4 protein, a single nucleotide polymorphism (T–C) was identified which results in the substitution of a tryptophan residue for an arginine residue at position 240 in domain 3 of the mature protein (Hodge et al., 1991). This amino acid substitution results in a loss of reactivity with the monoclonal antibody, OKT4 (Lederman et al., 1991). Similarly, a polymorphism in bovine CD4 was initially identified by the failure of one of the forms of the protein to react with the monoclonal antibody CC26 (Morrison et al., 1991). Further study revealed the existence of three alleles of CD4 in cows encoding two CD4 species of different molecular weight due to differential glycosylation patterns. The higher molecular weight species did not react with CC26 (CC26 Mrhigh ) while the lower molecular weight species could be subdivided into those which also did (CC26+ Mrlow ) or did not (CC26 Mrlow ) demonstrate reactivity with the CC26 antibody (Morrison et al., 1994). Similarly, in miniature swine, failure of CD4 to react with the monoclonal antibody 74-12-4 (Sundt et al., 1992) was determined to be due to 13 nucleotide differences resulting in 11 amino acid substitutions in domain 1 of the protein (Gustafsson et al., 1993). In addition to the CD4 sequences of human (Maddon et al., 1985) and mouse (Tourveille et al., 1986), the sequences of the CD4 molecules of many species have previously been reported or submitted to Genbank: pig (Genbank AY515292), rat (Clark et al., 1987), cat (Norimine et al., 1992), dog (Gorman et al., 1994), whale (Romano et al., 1999) and chicken (Koskinen et al., 1999). A partial bovine CD4 sequence has been annotated from genomic DNA (Genbank XM_588150). The full amino acid sequence of sheep CD4 has not, until now, been elucidated although partial amino acid and DNA sequences have been reported (Classon et al., 1986; Genbank AJ535323). We have recently shown that ovine CD4 is the target of cathepsin L proteases secreted by the liver fluke Fasciola hepatica and that

loss of CD4 from the surface of ovine T cells results in suppression of T cell proliferation in vitro (Prowse et al., 2002). In order to further define the interaction of Fasciola cathepsins with ovine CD4 we cloned cDNAs encoding the CD4 sequence from several sheep breeds and present data from a direct examination of the ovine CD4 sequence, at both the genomic DNA and RNA levels. We also report a single nucleotide polymorphism present in both DNA and RNA, which leads to an amino acid substitution within the protein of potential functional importance. 2. Materials and methods 2.1. RNA extraction and RT-PCR Total RNA was extracted by Trizol (Invitrogen) from sheep PBMC pellets and hepatic lymph node tissue according to manufacturer’s instructions. RNA used to obtain the initial 50 end sequence was adapted using the FirstChoiceTM RLM-RACE kit (Ambion) as per manufacturer’s instructions. RNA was stored at 80 8C until use. To generate total cDNA, RNA was reverse transcribed using MMLV reverse transcriptase (Invitrogen) as per manufacturer’s instructions. Total cDNA was stored at 20 8C. 2.2. Cloning ovine CD4 cDNA and sequence homology analysis A 1368 bp fragment of the CD4 cDNA sequence was amplified from the total cDNA template using the forward primer 50 -TTTAGGCACTTGCTTCTGGTGC30 and the reverse primer 50 -CTGGCAGGTCTTCTTCTCACTG-30 : these primers encode conserved sequences in the CD4 sequence of several species. Adapted cDNA was amplified by nested PCR using forward primers specific for the adapted RNA; 50 CGCGATGGCGATGAATGAACACTG and 50 -CGC GGATCCGAACACTGCGTTTGCTGGCTTTGATG and the respective gene-specific reverse primers; 50 GCGGTGCCAGCATTTAACACAGA and 50 -TCAGCAGACACTGCCACATC. All PCR reactions were performed using Platinum1 Pfx DNA polymerase (Invitrogen) and reaction conditions were as follows: 2 min at 94 8C (one cycle), 15 s at 94 8C, 30 s at 57– 60 8C, 90 s at 72 8C (33–40 cycles) and 10 min at 72 8C. Clones were also generated using Vent DNA Polymerase (Invitrogen) under the following reaction conditions: 3 min at 95 8C (one cycle), 45 s at 95 8C, 30 s at 60.2 8C, 90 s at 72 8C (38 cycles) and 10 min at 72 8C. PCR products were A-tailed and ligated into the


pGEM1-T Easy vector (Promega). The resulting plasmids were used to transform DH5a E. coli, which were selected on LB/ampicillin/IPTG/X-Gal plates. Plasmids were purified using Qiagen miniprep kits and those containing an insert of the correct size were sequenced at the McGill University and Genome Quebec Innovation Centre. Ovine CD4 specific primers spanning 230 bp from the 50 UTR (forward 50 AAAGGAAGAGAGACCCAGGC, reverse 50 -CAGAATCTTGGACTGGGAAGA) were used to amplify the 50 end from unadapted hepatic lymph node cDNA. The gene specific forward primer 50 -GGCTCCTGCATCTTCTGTGT and reverse primer (based on conserved sequence alignments of the 30 UTR) 50 -CCGGCTACATTCATCTGGTC were used to amplify the 30 end of ovine CD4. PCR products were purified and sequenced at the Department of Pathology, University of Melbourne. Ovine CD4 sequence homologues were identified using NCBI BlastN and BlastP. 2.3. Cells and DNA extraction Sheep whole blood was collected from the jugular vein in heparinized vacutainers. PBMC were isolated by Ficoll gradient centrifugation and RBC were lysed in a cold, hypotonic solution of 20 mM Tris–HCl pH 8.0 and 10 mM EDTA. Sheep blood monocyte-derived cell lines, MOCL1 and MOCL7 were a generous gift from Dr. Michel Olivier at the Institut National de la Recherche Agronomique, Lyon, France (Olivier et al., 2001). Nineteen Australian Merino and Indonesian Thin Tail (ITT) sheep genomic DNA samples were obtained by DNA extraction from whole blood. DNA was also extracted from total PBMCs using DNAzol (Invitrogen) as per manufacturer’s instructions and stored at 20 8C until use. 2.4. PCR of genomic DNA for pyrosequencing and restriction digestion A 156 bp fragment of the CD4 gene containing the polymorphic locus, to be used for pyrosequencing, was amplified from total genomic DNA template using a 50 biotinylated forward primer: 50 -CAAGTGTTTGGACTCACCTGGC-30 and the reverse primer: 50 -CGAAGGTGAGTGGGAAGGAAAAC-30 . The reaction was performed using Taq DNA polymerase (Invitrogen) and reaction conditions were as follows: 3 min at 94 8C (one cycle), 45 s at 94 8C, 30 s at 58.2 8C, 30 s at 72 8C (33 cycles) and 10 min at 72 8C. A 30 ml of each of the 156 bp, biotinylated PCR products were added to 3 ml of streptavidin-coated SepharoseTM beads and 40 ml

307

binding buffer in a total volume of 80 ml and were vortexed for 10 min. The PCR product was denatured and the non-biotinylated strand was washed away using the Vacuum Prep Tool. A 2 ml of the 10 mM sequencing primer (50 -TCACATAGACTGTTTCGG-30 ), in 40 ml of annealing buffer, was allowed to anneal to the singlestranded (+strand) PCR product at 83 8C for 3 min before analysis using the PSQTM 96 pyrosequencing system. As the sequencing primer binds to the coding strand, output in this assay is sequence corresponding to the reverse () strand of the ovine CD4 gene. For restriction enzyme digestion, genomic DNA or Plasmid DNA (5 ml) was incubated with 1 ml Eco147I (StuI) (Promega) in the presence of the appropriate buffer. Following incubation for 90–120 min at 37 8C the reaction mixtures were visualized on a 1% agarose gel. 2.5. Calculation of Hardy–Weinberg equilibrium Expected genotype frequencies were calculated according to the formula: CC = p2, CT = 2pq and TT = q2, where p = freq (C allele), q = freq (T allele). The Chi-squared test was then used to compare observed genotype frequencies (OBS) and expected genotype P frequencies (EXP) according to the formula: x2 = (OBS EXP)2/EXP and statistical significance was determined by a P-value of P < 0.05. 3. Results and discussion 3.1. Ovine CD4 cDNA sequence homology and phylogenetic analysis We established a 1368 bp ovine CD4 cDNA consensus sequence based upon the alignment of cDNA sequences obtained from several RNA sources (see Genbank DQ407520). Three cDNA clones were obtained from Australian Merino sheep RNA and a further seven sequences were from clones generated from two Merino and four ITT RNA samples. An additional four cDNA sequences for both the 50 and 30 end of ovine CD4 were sequenced from two Merino and two ITT hepatic lymph node RNA sources to obtain the full 1368 bp ovine CD4 gene. A 1368 bp fragment of MOCL CD4 cDNA was also generated by RT-PCR using proofreading DNA polymerases, Vent and Pfx. Nine MOCL CD4 cDNAs were sequenced and all sequences agreed with the 1368 bp consensus sequence obtained from Merino and ITT sheep. The full 1368 bp cDNA sequence translates to a 455 amino acid sequence: based on sequence alignments with other species (Fig. 1) the mature protein is hypothesized to

308


Fig. 1. Alignment of CD4 amino acid sequences. Amino acid sequences of human1, mouse2 and the two species showing highest amino acid identity to the ovine CD4 sequence (white whale3, Delphinapterus leucas) and pig (Sus scrofa4) are shown. Gaps were introduced to maximize sequence homology. Shaded region corresponds to the leader sequence. Amino acid numbering corresponds to that of the postulated mature proteins and is located on the right. The four conserved Cys residues (C16, C86, C300, C342) involved in the formation of disulfide bonds are highlighted. Residue 183 corresponding to the polymorphic locus of ovine CD4 is indicated by a box. JR, joining region; TM, transmembrane domain; (*) residues in that column are identical in all sequences in the alignment; (:) conserved substitutions have been observed; (.) semi-conserved substitutions are observed. NCBI Accession numbers: 1NM_000616, 2X04836, 3AF071799, 4AY515292.


begin with the sequence K26AVV . . . and amino acid numbering below refers to the numbering of the mature protein starting from K26. Interestingly, this sequence shows highest similarity (73% amino acid identity and 83% nucleotide identity) with Delphinapterus leucas, the white whale with the leader sequence, four extracellular domains and the transmembrane domain of the ovine CD4 gene all demonstrating higher amino acid identities to the respective domains from the whale than to human CD4 (Fig. 1). The ovine CD4 sequence exhibits amino acid/nucleotide sequence identity, respectively, as follows: 67 and 80% with pig CD4; 62 and 73% with human CD4 and 51 and 66% with mouse CD4. The ovine sequence also shows 87% amino acid sequence identity (over 314 amino acids) with a partial sequence of bovine CD4 predicted from a genomic sequence (Genbank XM_588150). The cytoplasmic domain remains most highly conserved between species, consistent with its functional importance in signal transduction. When compared with a partial Ovis aries CD4 mRNA sequence deposited in the GenBank database (AJ535323) in 2002, 213/216 base pairs (98.6%) reported in this GenBank sequence are identical to the 1368 bp sequence and the predicted amino acid sequence was identical to that shown here. Additionally, Classon et al. (1986) have reported partial amino acid sequences of tryptic peptides of purified ovine CD4 protein, as determined by Edman degradation, which demonstrated four amino acid differences (in three peptides) with that predicted from the cDNA sequence here: Q11T; S27T; N60W; F67K. It thus appears that at least six amino acid sequence variants of CD4 exist in sheep. While human CD4 contains three intrachain disulfide bonds, one in each of domains 1, 2 and 4 (Maddon et al., 1987), only the cysteine residues in domains 1 and 4 are conserved in the ovine CD4 cDNA sequence, suggesting that ovine CD4 contains only two disulfide bonds, as observed in the white whale, bovine, dog, cat and pig sequences where C132 is replaced by a W residue (Fig. 1). Human CD4 possesses two known Nlinked glycosylation sites: Asn 271 and Asn 300 (Harris et al., 1990), neither of which are present in ovine CD4. However, four potential N-linked glycosylation sites not present in human CD4 exist in the ovine sequence: Asn 125, 206, 238, 318 (Fig. 1) as defined by the N-linked glycosylation consensus motif (N-X-S/T). The cat, dog and whale CD4 proteins are all predicted to exhibit a similar tertiary structure which may be associated with the different immunological features exhibited by these species, including a unique function for MHC II-

309

restricted immune responses and possibly mechanisms for T cell activation; sheep may thus exhibit immune characteristics more common to these species than human or mice (reviewed in Romano et al., 1999). The conserved serine residues implicated in CD4 endocytosis are also conserved within the cytoplasmic tail of the ovine CD4 molecule. Phylogenetic analysis classified fourteen full length CD4 sequences (from the rat, mouse, green monkey, chimpanzee, rhesus macque, human, common squirrel monkey, rabbit, dolphin, pig, cat, dog, whale and sheep) into three major monophyletic groups (Supplementary Fig. S1). Ovine CD4 was clustered into one clade with the pig, dog, cat, whale and dolphin CD4, which could further be subdivided into three monophyletic lineages. Whale, dolphin and ovine CD4 formed a monophyletic tree distinct from other CD4 molecules. The human CD4 sequence is removed from the ovine CD4 sequence by one major phylogenetic clade, while the mouse is even further separated by two major clades. 3.2. Identification of a T/C polymorphism at position 622 in ovine CD4 cDNA and genomicDNA Analysis of CD4 cDNA sequences obtained from different sources of PBMC RNA (Merino, ITT, Canadian cross bred, Prealpes du sud) has identified a polymorphism in the DNA sequence at position 622 where the existence of both cytosine and thymine nucleotides were present in multiple clones. This polymorphism was identified in cDNA generated from RNA from all four breeds of sheep, suggesting that it may have been evolutionarily conserved. The T/C polymorphism in ovine lymphocyte CD4 alters the first codon of amino acid 183 in the mature protein resulting in the incorporation of a serine residue while the CCC codon leads to the incorporation of the structurally distinct proline. This amino acid change maps to the N-terminal region of domain 3 of the CD4 protein, adjacent to the flexible hinge region (Fig. 1). To determine if the T/C polymorphism observed in cDNA was present in the ovine genome and not an artefact of RT-PCR cloning, we performed pyrosequencing over the locus of interest on 24 genomic samples from various sources: 10 Merino sheep, 9 ITT sheep (4 from Sumatra; 5 from Garut, West Java), 3 Canadian sheep of unknown origin (Mtl1, Mtl2, Mtl3) and 2 monocyte derived cell lines (MOCL1, MOCL7) derived from Prealpes du sud sheep in France. Of the 24 genomic samples, 11 were determined to be C/C homozygotes, 11 C/T heterozygotes and 2 T/T homozygotes (Supplementary Table S1).

310


Fig. 2. Representative results of StuI restriction digest of the 156 bp PCR amplified fragment of sheep genomic DNA visualized on an ethidium bromide stained 12% acrylamide gel. The C/C, T/T and C/T genotypes are indicated above the lanes. Lanes A contain undigested control DNA; lanes B contain DNA digested with StuI.The last lane contains 100 bp ladder marker DNA.

To confirm the pyrosequencing results, the PCR amplified genomic DNA was digested with the restriction enzyme StuI, which cleaves the sequence AGGCCT. Since the sequence preceding and including the polymorphism in ovine CD4 is AGGCCT/C, StuI will cleave the T form and not the C form of ovine CD4. Thus, we expect a different cleavage pattern for C/C homozygotes, C/T heterozygotes and T/T homozygotes when the PCR products of these individuals are digested and visualized on agarose gel. In each case, the StuI digest confirmed the genotype obtained from pyrosequencing (Fig. 2 and data not shown). We also compared the sequences at the polymorphic locus, of both genomic DNA and cDNA from the same individual sheep. DNA and RNA were extracted from Ficoll gradient-purified PBMC of live Canadian sheep or from the sheep blood monocyte-derived cell lines, MOCL1 and MOCL7. RNA was reverse transcribed and small fragments containing the polymorphic locus were PCR amplified to be analysed by pyrosequencing. The sequence at the polymorphic locus of CD4 was identical in cDNA and genomic DNA samples from the same individual confirming that the polymorphism identified in cDNA reflects the genotype (data not shown). Similar digests were also performed with multiple cDNA clones from both ITT and Merino samples which also confirmed the T/C polymorphism in these cDNA sequences (data not shown). As both the T and C forms of CD4 were observed at position 622 in the genomic sequences of 24 individual sheep, we conclude that at least two alleles of ovine CD4 exist in the ovine genome. Although CD4 is considered to be largely monomorphic, polymorphisms similar to the one which we report here, which result in a change of protein structure, have been identified in several species (Hodge et al., 1991; Morrison et al., 1994; Gustafsson et al., 1993). Since both the 622T and 622C forms of CD4 were found in cDNA from different animals and from multiple cDNA sequences, it appears that both forms of the CD4 sequence are transcribed to

RNA and, therefore, are presumably expressed at the protein level. A Pro residue at position 183 is also observed in the pig and bovine CD4 sequences whereas a Ser residue is observed in the whale, human, dog and cat sequences (Fig. 1) (Norimine et al., 1992; Gorman et al., 1994). 3.3. Genetic analysis Calculations of Hardy–Weinberg equilibrium for the T/C polymorphism were performed on the 24 genomic DNA samples and no significant deviation from equilibrium (P = 0.7439) was observed in our 24 samples, suggesting that the T/C polymorphism is randomly distributed within the population and there is no preference for one homozygote or the heterozygote over any other genotype. Calculations of Hardy– Weinberg equilibrium were also performed on the ITT (P = 0.6108) and Merino (P = 0.7542) breeds as well as males (P = 0.2943) and females (P = 0.7823) and each subgroup was also found to exist in Hardy– Weinberg equilibrium. This suggests that there is no correlation between genotype and sex or breed at this locus. The expression of two different forms of ovine CD4 protein may have functional consequences, particularly as the amino acid change occurs near the flexible hinge region of the protein and involves two structurally dissimilar amino acid residues, proline and serine. The hinge region of CD4 plays an important role in maintaining the overall conformation of the protein for signal transduction and oligomerization (Hendrickson et al., 1992). Indications of an extended flexible structure in CD4 have been reported based upon analysis of CD4 crystals (Wu et al., 1997). High solvent content and weak diffraction indicated conformational heterogeneity due to intrinsic flexibility within the crystallized CD4 molecule (Kwong et al., 1990). This evidence supports previous proteolytic digest studies (Ibegbu et al., 1989; Healey et al., 1990) suggesting the presence of a flexible region between domains 2 and 3 of CD4, analogous to the hinge region of immunoglobulins (Kwong et al., 1990). Studies by Huang et al. (1997) have suggested that the hinge region located in the D2–D3 junction may have a functional importance since abrogation of class II binding was observed upon the introduction of certain single amino acid substitutions in human CD4. CD4 alanine mutants in residues 175–177 had a decreased ability to function as a coligand while mutations in residues 175–177 or 180–181 showed a reduced function in a co-receptor role on the surface of T cells. This group suggested that such


mutations may induce conformational changes in CD4 that affect the docking of TCR/CD4, rather than CD4/ MHC class II interactions directly: TCR/CD4 coclustering is essential for T cell activation and occurs during antigen recognition (Huang et al., 1997). In this context, the Pro/Ser polymorphism at position 183 in ovine CD4 may have functional effects. Further biochemical and immunological studies on the two forms of ovine CD4 will illuminate this question. Acknowledgements This work was supported by Monash University; the University of Sydney; the Australian Center for International Agricultural Research (Canberra, Australia); the Natural Sciences and Engineering Research Council (Canada); the Canada Research Chair program; McGill University; the FQRNT Center for Host-Parasite Interactions. T. Spithill is a recipient of a Canada Research Chair in Immunoparasitology. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.vetimm.2006.05.015. References Clark, S.J., Jeffries, W.A., Barclay, A.N., Gagnon, J., Williams, A.F., 1987. Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains. Proc. Natl. Acad. Sci. U.S.A. 84, 1649–1653. Classon, B.J., Tsagaratos, J., McKenzie, I.F.C., Walker, I.D., 1986. Partial primary structure of the T4 antigens of mouse and sheep: assignment of intrachain disulfide bonds. Proc. Natl. Acad. Sci. U.S.A. 83, 4499–4503. Dalgleish, A.G., Beverley, P.C.L., Clapham, P.R., Crawford, D.H., Greaves, M.F., Weiss, R.A., 1984. The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature 312, 763–767. Gay, D., Coeshott, C., Golde, W., Kappler, J., Marrack, P., 1986. The major histocompatibility complex-restricted antigen receptor on T cells. IX. Role of accessory molecules in recognition of antigen plus isolated IA. J. Immunol. 136, 2026–2032. Gorman, S.D., Frewin, M.R., Cobbold, S.P., Waldmann, H., 1994. Isolation and expression of cDNA encoding the canine CD4 and CD8a antigens. Tissue Antigens 42, 184–188. Gustafsson, K., Germana, S., Sundt, T.M., Sachs, D.H., LeGuern, C., 1993. Extensive allelic polymorphism in the CDR2-like region of the miniature swine CD4 molecule. J. Immunol. 151, 1365–1370. Harris, R.J., Chamow, S.M., Gregory, T.J., Spellman, M.W., 1990. Characterization of a soluble form of human CD4. Peptide analyses confirm the expected amino acid sequence, identify glycosylation sites and demonstrate the presence of three disulfide bonds. Eur. J. Biochem. 188, 291–300.

311

Healey, D., Dianda, L., McDougal, J.S., Moore, J.P., Moore, M.J., Estess, P., Kwong, P.D., Buck, D., Beverley, P.C.L., Sattentau, Q.J., 1990. Novel anti-CD4 monoclonal antibodies separate human immunodeficiency virus infection and fusion of CD4+ cells from virus binding. J. Exp. Med. 172, 1233–1242. Hendrickson, W.A., Kwong, P.D., Leahy, D.J., Ryu, S.E., Yamaguchi, H., Fleury, S., Sekaly, R.P., 1992. Structural aspects of CD4 and CD8 involvement in the cellular immune response. Cold Spring Harb. Symp. Quant. Biol. 57, 549–556. Hodge, T.W., Sasso, D.R., McDougal, J.S., 1991. Humans with OKT4-epitope deficiency have a single nucleotide base change in the CD4 gene, resulting in substitution of TRP240 for ARG240. Hum. Immunol. 30, 99–104. Huang, B., Yachou, A., Fleury, S., Hendrickson, W.A., Sekaly, R.P., 1997. Analysis of the contact sites on the CD4 molecule with class II MHC molecule. J. Immunol. 158, 216–225. Ibegbu, C.C., Kennedy, M.S., Maddon, P.J., Deen, K.C., Hicks, D., Sweet, R.W., McDougal, J.S., 1989. Structural features of CD4 required for binding to HIV. J. Immunol. 142, 2250–2256. Klatzmann, D., Champagne, E., Chamaret, S., Gruest, J., Guetard, D., Hercend, T., Gluckman, J.C., Montagnier, L., 1984. T-lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV. Nature 312, 767–768. Konig, R., Huang, L.Y., Germain, R.N., 1992. MHC class II interaction with CD4 mediated by a region analogous to the MHC class I binding site for CD8. Nature 356, 796–798. Koskinen, R., Lamminmaki, U., Tregaskes, C.A., Salomonsen, J., Young, J.R., Vainio, O., 1999. Cloning and modeling of the first non mammalian CD4. J Immunol. 162, 4115–4121. Kwong, P.D., Ryu, S.E., Hendrickson, W.A., Axel, R., Sweet, R.M., Folena-Wasserman, G., Hensley, P., Sweet, R.W., 1990. Molecular characteristics of recombinant human CD4 as deduced from polymorphic crystals. Proc. Natl. Acad. Sci. U.S.A. 87, 6423–6427. Lederman, S., DeMartino, J.A., Daugherty, B.L., Foeldvari, I., Yellin, M.J., Cleary, A.M., Berkowitz, N., Lowy, I., Braunstein, N.S., Mark, G.E., Chess, L., 1991. A single amino acid substitution in a common African allele of the CD4 molecule ablates binding of the monoclonal antibody OKT4. Mol. Immunol. 28, 1171–1181. Maddon, P.J., Littman, D.R., Godfrey, M., Maddon, D.E., Chess, L., Axel, R., 1985. The isolation and nucleotide sequence of a cDNA encoding the T cell surface protein T4: a new member of the immunoglobulin gene family. Cell 42, 93–104. Maddon, P.J., Molineaux, S.M., Maddon, D.E., Zimmerman, K.A., Godfrey, M., Alt, F.W., Chess, L., Axel, R., 1987. Structure and expression of the human and mouse T4 genes. Proc. Natl. Acad. Sci. U.S.A. 84, 9155–9159. Morrison, W.I., Howard, C.J., Hinson, C.A., 1991. Polymorphism of the CD4 and CD5 differentiation antigens in cattle. Vet. Immunol. Immunopathol. 27, 235–238. Morrison, W.I., Howard, C.J., Hinson, C.J., MacHugh, N.D., Sopp, P., 1994. Identification of three distinct allelic forms of bovine CD4. Immunology 83, 589–594. Norimine, J., Miyazawa, T., Kawaguchi, Y., Tohya, Y., Kai, C., Mikami, T., 1992. A cDNA encoding feline CD4 has a unique repeat sequence downstream of the V-like region. Immunology 75, 74–79. Olivier, M., Berthon, P., Chastang, J., Cordier, G., Lantier, F., 2001. Establishment and characterisation of ovine blood monocytederived cell lines. Vet. Immunol. Immunopathol. 82, 139–151. Prowse, R.K., Chaplin, P., Robinson, H.C., Spithill, T.W., 2002. Fasciola hepatica cathepsin L suppresses sheep lymphocyte proliferation in vitro and modulates surface CD4 expression on human and ovine T cells. Parasite Immunology 24, 57–66.

312


Romano, T.A., Ridgway, S.H., Felten, D.L., Quaranta, V., 1999. Molecular cloning and characterization of CD4 in an aquatic mammal, the white whale Delphinapterus leucas. Immunogenetics 49, 376–383. Rudd, C., Helms, S., Barber, E.K., Schlossman, S.F., 1989. The CD4/CD8:p56lck complex in T lymphocytes: a potential mechanism to regulate T-cell growth. Biochem. Cell Biol. 67, 581–589. Sundt, T.M., LeGuern, C., Germana, S., Smith, C.V., Nakajima, K., Lunney, J.K., Sachs, D.H., 1992. Characterization of a polymorphism of CD4 in miniature swine. J. Immunol. 148, 3195–3201.

Swain, S.L., 1983. T cell subsets and the recognition of MHC class. Immunol. Rev. 74, 129–142. Tourveille, B., Gorman, S.D., Field, E.H., Hunkapiller, T., Parnes, J.R., 1986. Isolation and sequence of L3T4 complementary DNA clones: expression T-cells and brain. Science 234, 610–623. Veillette, A., Bookman, M.A., Horak, E.M., Samelson, L.E., Bolen, J.B., 1989. Signal transduction through the CD4 receptor involves the activation of the internal membrane tyrosine-protein kinase p56lck. Nature 338, 257–259. Wu, H., Kwong, P.D., Hendrickson, W.A., 1997. Dimeric association and segmental variability in the structure of human CD4. Nature 387, 527–530.