JOURNAL OF VIROLOGY, Aug. 2009, p. 8076–8081 0022-538X/09/$08.00⫹0 doi:10.1128/JVI.00655-09 Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Vol. 83, No. 16
Proline and Tyrosine Residues in Scaffold Proteins of Herpes Simplex Virus 1 Critical to the Interaction with Portal Protein and Its Incorporation into Capsids䌤† Kui Yang and Joel D. Baines* Department of Microbiology and Immunology, New York State College of Veterinary Medicine, Cornell University, Ithaca, New York 14853 Received 30 March 2009/Accepted 21 May 2009
Previous results showed that amino acids 449 to 457 of pUL26, a component of the scaffold of herpes simplex virus 1 capsids, were critical for interaction with the portal protein encoded by UL6 and for incorporation of the portal into capsids. To identify residues in this scaffold domain critical for the interaction with pUL6, the two proteins were coexpressed in the absence of other viral proteins and subjected to immunoprecipitation with scaffold-specific antibody. Coimmunoprecipitation of pUL6 was precluded by pUL26 mutations Y451A, P452A, and E454A but not by P449A, R456A, or Y450A. In infected cells, Y451A and P452A diminished solubilization of pUL6, reduced incorporation of the portal into the capsid, and precluded viral replication and DNA packaging. In contrast, E454A did not affect these parameters despite the fact that E454 is invariant in a number of different alphaherpesvirus scaffold proteins. These data suggest that the interaction between the scaffold E454A mutant and portal protein is rescued by other viral functions. Finally, we show that amino acids 448 to 459 of pUL26 are sufficient to interact with pUL6 in a glutathione S-transferase pulldown assay in the absence of other viral proteins and that this interaction is inhibited with excess peptide containing pUL26 amino acids 443 to 462. Together, these observations suggest that a direct interaction between this scaffold domain and portal protein mediates incorporation of the portal into the capsid. All DNA-containing herpesvirus capsids contain an outer protein shell of icosahedral symmetry (44; reviewed in references 1 and 13). Most capsomeres in this outer shell comprise six copies of the major capsid protein VP5 and are termed hexons (2, 3, 12, 21). Forty-five copies of VP5 within hexamers form each of the 20 faces of the icosahedral capsid. Of the 12 vertices of fivefold symmetry, 11 consist of five copies of VP5 and are termed pentons (2, 3, 10, 25, 32, 41). The remaining fivefold symmetric vertex is composed of 12 copies of the UL6 gene product in herpes simplex virus 1 (HSV-1) (24, 25, 40). This unique vertex is also termed the portal vertex because it serves as the conduit through which DNA is inserted and eventually expelled during initiation of infection. Immature capsids, termed procapsids, contain an outer shell with a biochemical composition similar to that of DNA-containing capsids, but they also contain an inner shell comprising mostly the product of UL26.5 (pUL26.5, ICP35, or VP22a) (2, 12, 20, 31, 39). The UL26.5 open reading frame initiates within the gene UL26 and shares both its coding frame and C terminus (Fig. 1) (17). The extreme C termini of pUL26.5 and pUL26 interact with the N terminus of VP5, and capsid assembly involves incorporation of these VP5/pUL26.5 and VP5/ pUL26 complexes into growing capsid shells that eventually form closed spheres with two proteinaceous shells (6, 14, 23, 27, 37, 42). UL26 encodes a protease that cleaves itself between
amino acids 247 and 248, separating pUL26 into an N-terminal protease domain called VP24 and a C-terminal domain termed VP21 (4, 8, 29, 43). During capsid maturation, the protease also cleaves itself and pUL26.5, releasing 25 amino acids from their C termini (5, 7, 8, 11, 18, 30, 33, 43). This cleavage obviates the linkage with VP5 (22, 39). In capsids that go on to become virions, pUL26.5 and VP21 are replaced with DNA and VP24 remains with the capsid (12, 31). Formation of HSV capsids is likely initiated by interaction of the portal protein encoded by UL6 (pUL6) with scaffold proteins (26). By analogy to bacteriophage systems, a reasonable model is that addition of capsomeres to this nidus ensures that only a single portal is incorporated into each capsid (19). The pUL6 domain that interacts with scaffold proteins has been defined as amino acids 449 to 457 within pUL26 and the corresponding region of pUL26.5 (15, 34, 46). This region is required for coimmunoprecipitation of transiently expressed portal and scaffold proteins, coimmunoprecipitation of portal protein and scaffold proteins in HSV-infected cells, and incorporation of the portal into the capsid. The current studies were conducted to define residues critical to the function of this domain.
MATERIALS AND METHODS Viruses and cells. CV1 and rabbit skin cells were obtained from the American Type Culture Collection (ATCC) and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% newborn calf serum, 100 U of penicillin per ml, and 100 g of streptomycin per ml. CV26 cell lines expressing pUL26 were cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/ml of penicillin, 100 g/ml of streptomycin, and 200 g/ml of hygromycin B as described previously (46). HSV-1 strain F [HSV-1(F)], UL6 null virus derived from HSV-1 strain 17, and vJB11 were described previously (9, 28, 46). Recom-
* Corresponding author. Mailing address: C5132 Vet Med Center, Cornell University, Ithaca, NY 14850. Phone: (607) 253-3391. Fax: (607) 253-3384. E-mail:
[email protected]. † Supplemental material for this article may be found at http://jvi .asm.org/. 䌤 Published ahead of print on 27 May 2009. 8076
VOL. 83, 2009
HSV SCAFFOLD RESIDUES INTERACTING WITH PORTAL PROTEIN
FIG. 1. Schematic diagrams of wild-type and mutant scaffold open reading frames. (A) Diagram of UL26 and UL26.5 mRNAs. The direction of transcription is indicated by arrows. (B) Colinear diagram of plasmids containing wild-type (upper line) or mutated (other lines) pUL26. The designation of each plasmid is indicated to the right. Codon 307 represents the initiation codon for the UL26.5 open reading frame. (C) Schematic colinear diagram of recombinant viruses used in these studies.
binant viruses vJB32, vJB33, and vJB34 and restored viruses vJB32R and vJB34R, derived from vJB32 and vJB34, respectively, are described in this paper. Plasmids. Plasmid pJB448 expresses full-length pUL26 and ICP35, whereas plasmid pJB437 contains the entire UL6 coding sequence. Both plasmids were described previously (45, 46). Point mutations in pUL26 were generated by two-step PCR using pJB448 as the template. The primers used for PCR are listed in the supplemental material. PCR amplicons were cloned into the HindIII and EcoRV sites located in the multiple-cloning site of expression vector pCDNA3 such that their transcription was under the control of the human cytomegalovirus early promoter/enhancer. The designations of the resulting plasmids and their corresponding mutations are listed in Fig. 1. All plasmid constructs were confirmed by DNA sequencing by the Cornell University DNA sequencing and genotyping core facility (data not shown) and immunoblotting after transient expression in mammalian cells. To construct plasmids encoding a 20-amino-acid peptide (EPDADYPYYPG EARAPRGV, designated GST-peptide 1) or a 12-amino-acid peptide (YPYYP GEARGAP, designated GST-peptide 2) fused in frame with glutathione Stransferase (GST), oligonucleotides GATCCGAACCGGACGCGGACTACCC GTACTACCCCGGGGAGGCTCGAGGCGCGCCGCGCGGGGTCG and AATTCGACCCCGCGCGGCGCGCCTCGA GCCTCCCCGGGGTAGTAC GGGTAGTCCGCGTCCGGTTCG or oligonucleotides GATCCTACCCGTA CTACCCCGGGGAGGCTCGAGGCGCGCCGG and AATTCCGGCGCGC CTCGAGCCTCCCCGGGGTAGTACGGGTAG were annealed and ligated into vector pGEX 4T-1 at BamHI and EcoRI sites, respectively. The plasmids were designated pJB628 and pJB649, respectively. Plasmid pCAGGS-nlsCre, expressing Cre recombinase, was a gift from Michael Kotlikoff, Cornell University. Plasmids pBAD-I-SceI, containing the gene encoding the yeast I-SceI endonuclease, and pEPkan-S, containing aphAI (encoding kanamycin resistance) adjacent to an I-SceI restriction site, were obtained from Nikolaus Osterrieder, Cornell University. Construction of recombinant viruses. Recombinant viruses were constructed by En Passant mutagenesis, a two-step Red/ET-mediated recombinant system
8077
described by Tischer et al. (38). The bacterial artificial chromosome (BAC) containing the entire HSV-1(F) genome was described previously (36). The primers for production of a PCR amplicon for eventual introduction of mutations into UL26 in the HSV-1(F)-containing BAC are listed in the supplemental material. The expected mutations in the BAC DNA were confirmed by DNA sequencing, and the resulting recombinant BACs with the pUL26 mutation Y451A, P452A, or E454A were designated bJB32, bJB33, or bJB34, respectively. Each BAC DNA was cotransfected with a Cre expression plasmid (see above) into CV26 cells expressing pUL26. The presence of viable recombinant virus was indicated by plaque formation, and the resulting virus was subjected to two further rounds of plaque purification. The genotypes of the recombinant viruses, designated vJB32, vJB33, and vJB34, were confirmed by PCR and DNA sequencing, whereas the viral phenotype was characterized as described in Results. To repair the mutated UL26 gene, rabbit skin cells were cotransfected with vJB32 or vJB34 viral DNA and linearized pJB448, which contains the UL26 gene. The viruses arising from homologous recombination were able to form plaques on rabbit skin cells and were designated vJB32R or vJB34R. The UL26 genes of these viruses in vJB32, vJB33, vJB34, vJB32R, and vJB34R were amplified by PCR and sequenced to confirm the expected genotype (data not shown). Immunoprecipitation and immunoblotting. Immunoprecipitation and immunoblotting were performed essentially as described previously (46). Briefly, CV1 cells either were transfected with expression plasmids containing UL6, UL26, or its derivatives or were infected with wild-type and recombinant viruses. At 24 h after transfection or 18 h after infection, the cells were washed with cold phosphate-buffered saline (PBS) and lysed in cold radioimmunoprecipitation assay (RIPA) buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA, and 1⫻ protease inhibitor cocktail (Roche). Mouse anti-ICP35 monoclonal antibody (MCA 406, AbDSeroTEC; 1:200 dilution) was used for immunoprecipitation. Immune complexes, RIPA buffer-solubilized clarified lysates, total lysates solubilized in 1% sodium dodecyl sulfate (SDS) and beta-mercaptoethanol, SDS-denatured purified B capsids, or proteins eluted from glutathione-conjugated Sepharose beads were separated on SDS-polyacrylamide gels and transferred to nitrocellulose membranes for immunoblotting. Immunoblots were probed with anti-ICP35 antibodies diluted 1:2,000 and/or anti-pUL6 rabbit polyclonal antiserum diluted 1:1,000. The bound immunoglobulins were revealed by reaction with appropriate horseradish peroxidase-conjugated anti-immunoglobulins and visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech). Capsid purification. CV1 cell monolayers from three 850-cm2 roller bottles were infected with either HSV-1(F) or mutant viruses at a multiplicity of infection (MOI) of 5 PFU/cell. The cells were harvested by scraping 18 hours later and washed with cold PBS. Cell pellets were suspended in 25 ml of lysis buffer (1 mM dithiothreitol, 1 mM EDTA, 20 mM Tris [pH 7.6], 500 mM NaCl, 1% Triton X-100, and protease inhibitor), sonicated briefly, and precleared by spinning at 10,000 ⫻ g for 15 min. The precleared lysates were pelleted through a 5-ml 35% sucrose cushion in TNE buffer (20 mM Tris-HCl [pH 7.6], 500 mM NaCl, 1 mM EDTA) in an SW28 ultracentrifuge tube at 24,000 rpm for 1 h. The pellets were resuspended in TNE buffer, and applied to 20% to 50% sucrose gradients in SW41 ultracentrifuge tubes, followed by centrifugation at 24,500 rpm for 1 h. After centrifugation, the light-refracting B capsid band was removed with a Pasteur pipette. Purities of capsid preparations were evaluated by transmission electron microscopy and negative staining (data not shown). GST pulldown assay. GST, GST-peptide 1 or GST-peptide 2 proteins were purified according to the manufacturer’s protocol (GE Healthcare). Briefly, the BL21(DE3) strain of Escherichia coli (Stratagene) was chemically transformed with plasmids expressing GST (pGEX4T-1) or GST-peptide (pJB629 or pJB649) and induced by addition of 0.3 mM IPTG (isopropyl--D-thiogalactopyranoside), and proteins were purified by affinity chromatography on glutathione-conjugated Sepharose 4B beads. The purity and concentration of the purified proteins were evaluated by SDS-polyacrylamide gel electrophoresis and staining with Coomassie blue (data not shown). CV1 cells (2 ⫻ 106) were transfected with appropriate expression plasmids. Twenty-four hours after transfection, cells were washed with cold PBS, lysed in cold RIPA buffer described as above for 30 min, and centrifuged at 14,000 rpm for 15 min to clarify the lysates. About 3 g of purified proteins was added directly to the lysates in the presence or absence of 5 M synthesized peptide 1 (Genemed Synthesis) at 4°C and left for 4 hours, and 50 l of glutathione-conjugated Sepharose 4B beads was then added and incubated with rotation at 4°C overnight. Following the incubation period, the beads with bound proteins were washed four times with cold RIPA buffer. The bound proteins were eluted by boiling in 2⫻ SDS loading buffer and electrophoretically separated on an SDS–12% polyacrylamide gel, and the presence of pUL6 was detected by immunoblotting with pUL6-specific antiserum.
8078
YANG AND BAINES
J. VIROL.
TABLE 1. Virus replication assay
Virus
Mutation in UL26
Cells used for virus replication/ plaque assay
Titer, PFU/ml (mean ⫾ SD)
vJB32 vJB32 vJB33 vJB33 vJB34 vJB34 vJB32R vJB34R
P452A P452A E454A E454A Y451A Y451A None None
CV1/CV26 CV26/CV26 CV1/CV26 CV26/CV26 CV1/CV26 CV26/CV26 CV1/CV1 CV1/CV1
⬍102 (2.1 ⫾ 1.02) ⫻ 106 (1.5 ⫾ 0.76) ⫻ 107 (1.6 ⫾ 0.29) ⫻ 107 ⬍102 (2.9 ⫾ 2.28) ⫻ 106 (2.5 ⫾ 0.5) ⫻ 107 (1.9 ⫾ 0.79) ⫻ 107
Virus replication assay. Approximately 2 ⫻ 106 cells in 25-cm2 flasks were infected with the viruses indicated in Table 1 at an MOI of 0.1 PFU/cell. After adsorption for 2 hours at 37°C with shaking, the inocula were removed, and the cells were washed with CBS buffer (40 mM citric acid, 10 mM KCl, 135 mM NaCl, pH 3.0) to remove residual infectivity. The cells were then washed with PBS once and overlaid with 5 ml of DMEM supplemented with 5% newborn calf serum. Twenty-four hours after infection, virus was harvested by three cycles of freezing and thawing, and 1 ml of various dilutions was used to infect monolayers of the cells indicated in Table 1. Viral plaques observed at 48 h postinfection were counted and the titer reported as PFU per ml.
RESULTS To investigate the role of specific residues within the pUL6 interaction domain of pUL26, a series of mutations were introduced into an expression plasmid encoding pUL26 and ICP35, as diagrammed in Fig. 1B. To test the effects of the mutations on interaction with portal protein, the mutant plasmids were cotransfected with a UL6 expression plasmid into CV1 cells. Twenty-four hours later, the cells were lysed and the lysates were clarified and reacted with ICP35-specific antibody. Immune complexes were then purified, and the presence or absence of pUL6 or ICP35 in immunoprecipitated material was determined by immunoblotting. As shown in Fig. 2, the expression levels of ICP35 and pUL6 were similar regardless of which pUL26 expression plasmids were transfected. The expression of pUL26 was more variable among the different samples, with less expression from cells transfected with plasmids encoding the Y450A, P452A, and E454A mutations. ICP35 was successfully immunoprecipitated by its cognate antibody from all tested lysates, and, consistent with previous results, pUL6 was efficiently coimmunoprecipitated with scaffold-specific antibody from cells expressing wildtype pUL26 and pUL6 (46). In contrast, mutations Y451A, P452A, and E454A precluded coimmunoprecipitation of pUL6 with antiscaffold antibody. We conclude that Y451, P452, and E454 of pUL26 are critical for the coimmunoprecipitation of transiently expressed pUL6. To determine whether the pUL26 residues critical for interaction with the portal in vitro were important for interaction in vivo, the mutations were introduced into the viral genome as described in Materials and Methods. As shown in Fig. 1C, viruses bearing mutations, P452A, E454A, and Y451A were designated vJB32, vJB33, and vJB34, respectively. CV1 cells were infected with HSV-1(F), the UL6 null virus, or the UL26 mutant viruses, and lysates were prepared 18 h after infection and subjected to immunoblotting with pUL6- and ICP35-specific antibodies or were immunoprecipitated with ICP35-spe-
cific antibodies followed by immunoblotting to detect scaffold and portal proteins. As shown in Fig. 3, similar total amounts of pUL6 were expressed in cells infected with HSV-1(F) and the pUL26 mutants but, as expected, were not detected in lysates of mockinfected cells or cells infected with the UL6 null virus. A mockinfected cell protein cross-reacted with pUL6 antibody and migrated above the position of pUL6 in the denaturing polyacrylamide gel (Fig. 3A). pUL6 was relatively insoluble (i.e., was detected at lower levels in clarified lysates) in cells infected with vJB32(P452A) and vJB34(Y451A), whereas vJB33(E454A)infected cell lysates contained levels of soluble pUL6 similar to that of in lysates of cells infected with HSV-1(F). This observation was consistent with our previous observations that deletion of pUL26 amino acids 449 to 457 precluded solubilization of pUL6 in infected cells (46). The pUL26 mutant E454A of vJB33 readily interacted with pUL6 as revealed by its coimmunoprecipitation with scaffold-specific antibody (Fig. 3, lane 6). In contrast to this result, pUL6 did not coimmunoprecipitate with pUL26 P452A or pUL26 Y451A (encoded by vJB32 and vJB34, respectively), despite the observation that substantial amounts of ICP35 were immunoprecipitated with its cognate antibody. We conclude that Y451A and P452A precluded interaction with pUL6 in vivo and in vitro, whereas E454A did not interfere with the portal/scaffold interaction in infected cells. Thus, E454 is necessary for interaction with portal protein in vitro but not in vivo. To determine whether the ability of pUL6 and pUL26 to interact correlated with the ability of HSV to produce infectious virus, either CV1 cells or the UL26-expressing cell line CV26 were infected with the various viruses indicated in Table 1. After 24 h, the cells were lysed by freezing and
FIG. 2. Point mutations within pUL26 preclude interaction with transiently expressed pUL6. CV1 cells (2 ⫻ 106) were cotransfected with expression plasmids carrying wild-type UL6 and mutated UL26. Twenty-four hours after transfection, coimmunoprecipitation with anti-ICP35 antibodies was performed. Cell lysates and immunoprecipitated proteins were separated in denaturing 12% polyacrylamide gels and transferred to nitrocellulose membranes. The transferred proteins were probed with anti-pUL6 or anti-ICP35 antibodies. Bound immunoglobulins were revealed by enhanced chemiluminescence. IP, immunoprecipitation. IB, immunoblotting.
VOL. 83, 2009
HSV SCAFFOLD RESIDUES INTERACTING WITH PORTAL PROTEIN
FIG. 3. Effects of scaffold mutations on coimmunoprecipitation with portal protein in lysates of infected cells. CV1 cells were mock infected or were infected with HSV-1(F), UL6 null, or UL26 mutant viruses at 5 PFU per cell. Eighteen hours after infection, cells were lysed in RIPA buffer, and coimmunoprecipitation was performed with anti-ICP35 antibodies. Whole or clarified cellular lysates (A and B, respectively) or immunoprecipitated proteins (D and E) were transferred to nitrocellulose and immunoblotted with anti-pUL6 antibodies (A, B, and D) or anti-ICP35 antibodies (C and E). Bound immunoglobulins were visualized by enhanced chemiluminescence. IP, immunoprecipitation. IB, immunoblotting.
thawing, and infectious virus was determined by plaque assay on CV1 cells (for wild-type virus) or CV26 cells (for UL26 mutants). As shown in Table 1, neither vJB32(P452A) nor vJB34(Y451A) was able to replicate to an appreciable extent on CV1 cells, whereas production of infectious virus was fully restored upon infection of CV26 cells. In contrast, vJB33 and viruses derived from vJB32 and vJB34 but bearing restored UL26 genes (designated vJB32R and vJB34R, respectively) were able to replicate efficiently on CV1 cells. We conclude from these studies that tyrosine 451 and proline 452 are critical for viral replication, whereas glutamic acid 454 can be changed to alanine with no ill effects on virus replication. Further investigation using Southern blots of BamHI-digested viral DNA revealed that the mutations also precluded the production of genomic ends free of concatameric DNA (data not shown). Thus, pUL26 amino acids 451 and 452 were critical for cleavage of viral DNA, potentially explaining the effects of the corresponding mutations on viral replication. To determine whether pUL26 amino acids tyrosine 451 and proline 452 were critical for incorporation of the portal protein into capsids, cells were infected with the relevant wild-type and mutant viruses, and capsids within these cells were purified, denatured in SDS, electrophoretically separated, transferred to nitrocellulose, and probed with pUL6-specific antibody. To ensure that the mutations did not preclude efficient incorporation of scaffold proteins into capsids, the immunoblots were also probed with anti-ICP35 antibody. Immunoblotting with VP5 antibody served as a loading control. As shown in Fig. 4, capsids purified from cells infected with
8079
FIG. 4. Immunoblot of B capsids probed with anti-pUL26, -ICP35, or -VP5 antibodies. Approximately 4 ⫻ 108 CV1 cells were infected with UL6 null, vJB32(P452A), vJB34(Y451A), or HSV-1(F) at an MOI of 5 PFU per cell. Twenty hours after infection, B capsids were purified, separated by SDS-polyacrylamide gel electrophoresis, transferred onto nitrocellulose membrane, and probed with anti-pUL6, antiICP35, or anti-VP5 antibodies. Bound immunoglobulin was revealed by enhanced chemiluminescence.
vJB32(P452A) and vJB34(Y451A) contained significantly less pUL6 than did capsids purified from cells infected with wildtype virus, whereas the incorporation of scaffold proteins into these capsids was not affected. We conclude that proline 452 and tyrosine 451 of pUL26 are critical to interaction with portal protein in vitro and in vivo and for incorporation of portal protein into capsids. The simplest hypothesis to explain the results shown here is that the domain defined by amino acids 449 to 457 of pUL26 interacts directly with the portal protein. However, we could not rule out the possibility that the studied mutations altered the scaffold protein conformation and thereby precluded interaction with pUL6 indirectly. To distinguish between these possibilities, we wanted to determine if the region of pUL26 including amino acids 449 to 457 was sufficient to interact with pUL6 in the absence of other viral proteins. Thus, codons 443 to 462 of UL26 were cloned in frame with GST, and the resulting fusion protein (designated GST-peptide1; see Fig. 1 for primary amino acid sequence) was purified by affinity chromatography. GST and a second GST fusion protein bearing only 12 of these 20 amino acids (encoded by codons 448 to 459, designated GST-peptide 2, and shown in Fig. 1) were purified similarly. The proteins were then reacted with lysates of CV1 cells transiently expressing pUL6 in the presence or absence of exogenous peptide 1. The presence of pUL6 in the GST pulldowns was then determined by immunoblotting with pUL6specific antibody. As shown in Fig. 5A and B, pUL6 was pulled down with GST-peptide 1 and GST-peptide 2 but not with GST alone. Moreover, the presence of the homologous peptide 1 in the reaction mixture largely precluded the pulldown of pUL6 by either GST-peptide 1 or GST-peptide 2 (Fig. 5B). We conclude that the 12 pUL26 amino acids YPYYPGEARGAP are sufficient to interact with pUL6 in vitro.
8080
YANG AND BAINES
FIG. 5. Domain of pUL26 sufficient to pull down pUL6 from cellular lysates. (A) CV1 cells were transfected with a pUL6 expression plasmid. Twenty-four hours later, the transfected cells were washed with cold PBS, lysed in RIPA buffer, and clarified. The purified GST or GST fused to the indicated pUL26 peptides was added directly to the clarified lysates and then reacted with glutathione-Sepharose beads. The presence or absence of pUL6 in association with the beads was determined by elution in SDS-containing buffer, electrophoretic separation in denaturing polyacrylamide gels, and immunoblotting (IB). (B) Similar reactions were performed, but in the presence (lanes 4 and 6) or absence (lanes 1, 2, 3, and 5) of exogenously labeled peptide 1 (EPDADYPYYPGEARAPRGV). The presence of pUL6 in the GST pulldown material was detected by immunoblotting after elution in denaturing buffer and electrophoretic separation.
J. VIROL.
FIG. 6. The interaction domain of scaffold is highly conserved in the pUL26 orthologs of alphaherpesviruses. BHV, bovine herpesvirus. CHV, cercopithecine herpesvirus. DEV, duck enteritis virus. EHV, equine herpesvirus. GaHV, gallid herpesvirus. MeHV-1, meleagrid herpesvirus 1(herpesvirus of turkeys). PRV, pseudorabies virus. SMV, squirrel monkey herpesvirus. VZV, varicella-zoster virus.
DISCUSSION The data presented here indicate that amino acids 449 to 456 of pUL26 and the corresponding amino acids of pUL26.5 that can tolerate alteration to alanine (underlined) or that cannot tolerate such mutation and are therefore deemed critical for the interaction with pUL6 (double underlined) are as follows: PYYPGEAR. An alignment of amino acids 443 to 462 of pUL26 of HSV-1 with homologous regions of other herpesvirus scaffold protein sequences is shown in Fig. 6. As noted previously (34), this region of HSV is highly conserved among various herpesviruses. Moreover, proline 452 is invariant, whereas tyrosine 451 is either invariant or conservatively changed to phenylalanine in two of 18 sequences analyzed. Based on the data, we speculate that these residues are critical to portal/scaffold interactions in all herpesviruses. Interestingly, the glutamic acid at position 454 is also invariant among these herpesviruses, yet its mutation to alanine did not block replication of HSV or incorporation of portal protein into capsids. On the other hand, this mutation did preclude interaction between transiently expressed portal and scaffold proteins. Thus, proteins in the infected cell can restore the interaction between portal and scaffold proteins when glutamic acid 454 is mutated to alanine. Candidates that might provide such a function include other components of the capsid, such as the triplexes or major capsid protein VP5, which comprises capsid hexamers and pentamers. In support of the role of VP5, the pUL6-analogous bacteriophage portal of SPP1 contacts the major capsid protein, pre-
sumably to help anchor the portal within the capsid shell (16, 35). The data presented also indicate that amino acids 448 to 459 of pUL26 are sufficient to interact with pUL6 in a GST pulldown assay. Given the inhibition of the portal/scaffold interaction in vitro with exogenous peptide containing amino acids 443 to 462, it is possible that this peptide or a compound mimicking it could serve as a novel antiviral therapy. ACKNOWLEDGMENT These studies were supported by R01 grant GM507401 from the National Institutes of Health. REFERENCES 1. Baines, J. D., and C. Duffy. 2006. Nucleocapsid assembly and envelopment of herpes simplex virus, p. 175–204. In R. M. Sandri-Goldin (ed.), Alpha herpesviruses: pathogenesis, molecular biology and infection control. Caister Scientific Press, Norfolk, United Kingdom. 2. Baker, T. S., W. W. Newcomb, F. P. Booy, J. C. Brown, and A. C. Steven. 1990. Three-dimensional structures of maturable and abortive capsids of equine herpesvirus 1 from cryoelectron microscopy. J. Virol. 64:563–573. 3. Booy, F. P., W. W. Newcomb, B. L. Trus, J. C. Brown, T. S. Baker, and A. C. Steven. 1991. Liquid crystalline, phage-like packaging of encapsidated DNA in herpes simplex virus. Cell 64:1007–1015. 4. Davison, M. D., F. J. Rixon, and A. J. Davison. 1992. Identification of genes encoding two capsid proteins (VP24 and VP26) of herpes simplex type 1. J. Gen. Virol. 73:2709–2713. 5. Deckman, I. C., M. Hagen, and P. J. McCann III. 1992. Herpes simplex virus type 1 protease expressed in Eschericia coli exhibits autoprocessing and specific cleavage of the ICP35 assembly protein. J. Virol. 66:7362–7367. 6. Desai, P., and S. Person. 1999. Second site mutations in the N-terminus of the major capsid protein (VP5) overcome a block at the maturation cleavage
VOL. 83, 2009
7.
8.
9.
10. 11.
12.
13. 14.
15.
16.
17.
18.
19. 20.
21.
22.
23.
24.
25.
26.
27.
HSV SCAFFOLD RESIDUES INTERACTING WITH PORTAL PROTEIN
site of the capsid scaffold proteins of herpes simplex virus type 1. Virology 261:357–366. DiIanni, C. L., D. A. Drier, I. C. Deckman, P. J. McCann III, F. Liu, B. Roizman, R. J. Colonno, and M. G. Cordingley. 1993. Identification of the herpes simplex virus-1 protease cleavage sites by direct sequence analysis of autoproteolytic cleavage products. J. Biol. Chem. 268:2048–2051. DiIanni, C. L., C. Mapelli, D. A. Drier, J. Tsao, S. Natarajan, D. Riexinger, S. M. Festin, M. Bolgar, G. Yamanaka, and S. P. Weinheimer. 1993. In vitro activity of the herpes simplex virus type 1 protease with peptide substrates. J. Biol. Chem. 268:25449–25454. Ejercito, P. M., E. D. Kieff, and B. Roizman. 1968. Characterization of herpes simplex virus strains differing in their effects on social behavior of infected cells. J. Gen. Virol. 2:357–364. Furlong, D. 1978. Direct evidence for 6-fold symmetry of the herpesvirus hexon capsomere. Proc. Natl. Acad. Sci. USA 75:2764–2766. Gao, M., L. Matusick-Kumar, W. Hurlburt, S. F. DiTusa, W. W. Newcomb, J. C. Brown, P. J. McCann, I. Deckman, and R. J. Colonno. 1994. The protease of herpes simplex virus type 1 is essential for functional capsid formation and viral growth. J. Virol. 68:3702–3712. Gibson, W., and B. Roizman. 1972. Proteins specified by herpes simplex virus. VIII. Characterization and composition of multiple capsid forms of subtypes 1 and 2. J. Virol. 10:1044–1052. Homa, F. L., and J. C. Brown. 1997. Capsid assembly and DNA packaging in herpes simplex virus. Rev. Med. Virol. 7:107–122. Hong, Z., M. Beaudet-Miller, J. Durkin, R. Zhang, and A. D. Kwong. 1996. Identification of a minimal hydrophobic domain in the herpes simplex virus type 1 scaffolding protein which is required for interaction with the major capsid protein. J. Virol. 70:533–540. Huffman, J. B., W. W. Newcomb, J. C. Brown, and F. L. Homa. 2008. Amino acids 143 to 150 of the herpes simplex virus type 1 scaffold protein are required for the formation of portal-containing capsids. J. Virol. 82:6778– 6781. Lebedev, A. A., M. H. Krause, A. L. Isidro, A. A. Vagin, E. V. Orlova, J. Turner, P. Tavares, and A. A. Antson. 2007. Structural framework for DNA translocation via the viral portal protein. EMBO J. 26:1984–1994. Liu, F., and B. Roizman. 1991. The promoter, transcriptional unit, and coding sequences of herpes simplex virus 1 family 35 proteins are contained within and in frame with the UL26 open reading frame. J. Virol. 65:206–212. McCann, P. J., III, D. R. O’Boyle II, and I. C. Deckman. 1994. Investigation of the specificity of the herpes simplex virus type 1 protease by point mutagenesis of the autoproteolysis sites. J. Virol. 68:526–529. Murialdo, H., and A. Becker. 1978. Head morphogenesis of complex doublestranded deoxyribonucleic acid bacteriophages. Microbiol. Rev. 42:529–576. Newcomb, W. W., and J. C. Brown. 1989. Use of Ar⫹ plasma etching to localize structural proteins in the capsid of herpes simplex virus. J. Virol. 63:4697–4702. Newcomb, W. W., and J. C. Brown. 1991. Structure of the herpes simplex virus capsid: effects of extraction with guanidine hydrochloride and partial reconstitution of extracted capsids. J. Virol. 65:613–620. Newcomb, W. W., F. L. Homa, D. R. Thomsen, F. P. Booy, B. L. Trus, A. C. Steven, J. V. Spencer, and J. C. Brown. 1996. Assembly of the herpes simplex virus capsid: characterization of intermediates observed during cell-free capsid formation. J. Mol. Biol. 263:432–446. Newcomb, W. W., F. L. Homa, D. R. Thomsen, B. L. Trus, N. Cheng, A. Steven, F. Booy, and J. C. Brown. 1999. Assembly of the herpes simplex virus procapsid from purified components and identification of small complexes containing the major capsid and scaffolding proteins. J. Virol. 73:4239–4250. Newcomb, W. W., R. M. Juhas, D. R. Thomsen, F. L. Homa, A. D. Burch, S. K. Weller, and J. C. Brown. 2001. The UL6 gene product forms the portal for entry of DNA into the herpes simplex virus capsid. J. Virol. 75:10923– 10932. Newcomb, W. W., B. L. Trus, F. P. Booy, A. C. Steven, J. S. Wall, and S. C. Brown. 1993. Structure of the herpes simplex virus capsid: molecular composition of the pentons and the triplexes. J. Mol. Biol. 232:499–511. Newcomb, W. W., F. L. Homa, and J. C. Brown. 2005. Involvement of the portal at an early step in herpes simplex virus capsid assembly. J. Virol. 79:10540–10546. Nicholson, P., C. Addison, A. m. Cross, J. Kennard, V. G. Preston, and F. J.
28.
29.
30.
31.
32. 33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44. 45.
46.
8081
Rixon. 1994. Localization of the herpes simplex virus type 1 major capsid protein VP5 to the cell nucleus requires the abundant scaffolding protein VP22a. J. Gen. Virol. 75:1091–1099. Patel, A. H., F. J. Rixon, C. Cunningham, and A. J. Davison. 1996. Isolation and characterization of herpes simplex virus type 1 mutants defective in the UL6 gene. Virology 217:111–123. Person, S., S. Laquerre, P. Desai, and J. Hempel. 1993. Herpes simplex virus type 1 capsid protein, VP21, originates within the UL26 open reading frame. J. Gen. Virol. 74:2269–2273. Preston, V. G., F. Rixon, I. M. McDougall, M. McGregor, and M. F. AlKobaisi. 1992. Processing of the herpes simplex virus assembly protein ICP35 near its carboxy terminal end requires the product of the whole of the UL26 reading frame. Virology 186:87–98. Rixon, F. J., A. M. Cross, C. Addison, and V. G. Preston. 1988. The products of herpes simplex virus type 1 gene UL26 which are involved in DNA packaging are strongly associated with empty but not with full capsids. J. Gen. Virol. 69:2879–2891. Schrag, J. D., B. V. Prasad, F. J. Rixon, and W. Chiu. 1989. Three-dimensional structure of the HSV1 nucleocapsid. Cell 56:651–660. Sheaffer, A. K., W. W. Newcomb, J. C. Brown, M. Gao, S. K. Weller, and D. J. Tenney. 2000. Evidence for controlled incorporation of herpes simplex virus type 1 UL26 protease into capsids. J. Virol. 74:6838–6848. Singer, G. P., W. W. Newcomb, D. R. Thomsen, F. L. Homa, and J. C. Brown. 2005. Identification of a region in the herpes simplex virus scaffolding protein required for interaction with the portal. J. Virol. 79:132–139. Sun, S., K. Kondabagil, B. Draper, T. I. Alam, V. D. Bowman, Z. Zhang, S. Hegde, A. Fokine, M. G. Rossmann, and V. B. Rao. 2008. The structure of the phage T4 DNA packaging motor suggests a mechanism dependent on electrostatic forces. Cell 135:1251–1262. Tanaka, M., H. Kagawa, Y. Yamanashi, T. Sata, and Y. Kawaguchi. 2003. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J. Virol. 77:1382–1391. Thomsen, D. R., W. W. Newcomb, J. C. Brown, and F. L. Homa. 1995. Assembly of the herpes simplex virus capsid: requirement for the carboxyterminal twenty-five amino acids of the proteins encoded by the UL26 and UL26.5 genes. J. Virol. 69:3690–3703. Tischer, B. K., J. von Einem, B. Kaufer, and N. Osterrieder. 2006. Two-step RED-mediated recombination for versatile high-efficiency markerless DNA manipulation in Eschericia coli. BioTechniques 40:191–197. Trus, B. L., F. P. Booy, W. W. Newcomb, J. C. Brown, F. L. Homa, D. R. Thomsen, and A. C. Steven. 1996. The herpes simplex virus procapsid: structure, conformational changes upon maturation, and roles of the triplex proteins VP19C and VP23 in assembly. J. Mol. Biol. 263:447–462. Trus, B. L., N. Cheng, W. W. Newcomb, F. L. Homa, J. C. Brown, and A. C. Steven. 2004. Structure and polymorphism of the UL6 portal protein of herpes simplex virus type 1. J. Virol. 78:12668–12671. Trus, B. L., W. W. Newcomb, F. P. Booy, J. C. Brown, and A. C. Steven. 1992. Distinct monoclonal antibodies separately label the hexons or the pentons of herpes simplex virus capsid. Proc. Natl. Acad. Sci. USA 89:11508–11512. Warner, S. C., G. Chytrova, P. Desai, and S. Person. 2001. Mutations in the N-terminus of VP5 alter its interaction with the scaffold proteins of herpes simplex virus type 1. Virology 284:308–316. Weinheimer, S. P., P. J. McCann III, D. R. O’Boyle II, J. T. Stevens, B. A. Boyd, D. A. Drier, G. A. Yamanaka, C. L. Dilanni, I. C. Deckman, and M. G. Cordingly. 1993. Autoproteolysis of herpes simplex virus type 1 protease releases an active catalytic domain found in intermediate capsid particles. J. Virol. 67:5813–5822. Wildy, P., W. C. Russell, and R. W. Horne. 1960. The morphology of herpes virus. Virology 12:204–222. Yang, K., F. Homa, and J. D. Baines. 2007. Putative terminase subunits of herpes simplex virus 1 form a complex in the cytoplasm and interact with portal protein in the nucleus. J. Virol. 81:6419–6433. Yang, K., and J. D. Baines. 2008. Domain within herpes simplex virus 1 scaffold proteins required for interaction with portal protein in infected cells and incorporation of the portal vertex into capsids. J. Virol. 82:5021–5030.
