Dec 13, 1994 - E.coli media were prepared according to Miller (16). ... MEL cell protein extract (1 ig/pl) was prepared according to. Dignam (24) and was a ...
Q--)l 1995 Oxford University Press
Nucleic Acids Research, 1995, Vol. 23, No. 3
405-412
Promoter control of translation in Xenopus oocytes N. Gunkel, M. Braddock1, A. M. Thorburn2, M. Muckenthaler, A. J. Kingsman1 and S. M. Kingsmanl,* EMBL, Meyerhofstrasse, D-6900 Heidelberg, Germany,1Retrovirus Molecular Biology Group, Department of Biochemistry, South Parks Road, Oxford OX1 3QU, UK and 2Department of Cardiology, Institute of Human Genetics, University of Utah, Salt Lake City, UT, USA Received October 21, 1994; Revised and Accepted December 13, 1994
ABSTRACT The HIV-1 promoter directs the high level production of transcripts in Xenopus oocytes. However, despite being exported to the cytoplasm, the transcripts are not translated [M. Braddock, A. M. Thorburn, A. Chambers, G. D. Elliott, G. J. Anderson, A. J. Kingsman and S. M. Kingsman (1990) Cell, 62, 1123-1133]. We have shown previously that this is a function of promoter sequences and is independent of the TAR RNA element that is normally located at the 5' end of all HIV mRNAs. We now show that a three nucleotide substitution at position -340, upstream of the RNA start site, reverses the translation inhibition. This site coincides with a sequence that can bind the haematopoietic transcription factor GATA. The inhibition of translation can also be reversed by treatment with inhibitors of casein kinase 11 or by injection into the nucleus of antibodies specific for the FRGY2 family of RNP proteins. We suggest that the -340 site influences the quality of the transcription complex such that transcripts are diverted to a nucleus-dependent translation inhibition pathway.
INTRODUCTION The HIV- 1 promoter, fused to a reporter coding sequence such as the bacterial chloramphenicol acetyl transferase (CAT) or firefly
luciferase (LUC) sequences, is active when an appropriate DNA template is injected into the nucleus of Xenopus oocytes. Significant quantities of full-length mRNA are produced and these are initiated correctly and exported efficiently to the cytoplasm (1). However, no translation of these mRNAs is detected. Curiously, when the identical RNAs are produced from the immediate early promoter of cytomegalovirus (CMV) they are translated efficiently (1). These data suggest that there are qualitative differences between promoters that could influence the translatability of their cognate transcripts. The nature ofthe translation block is not clear. It is possible that the RNA was either directed to an 'unfavourable site' in the cytoplasm (2) or that it was packaged into translationally repressed mRNPs (3-7). Xenopus oocytes contain a group of proteins that are known to form complexes with mRNA and inhibit translation (8-15). *
To whom correspondence should be addressed
In this study we have further characterised the HIV-1 promoterdependent translation block. In particular, we asked whether we could define a region of the HIV-1 promoter that was responsible for mediating the control. We show that just a three base substitution in the HIV- 1 promoter is sufficient to prevent cognate transcripts becoming inhibited by this nucleus-specific translation control pathway. These three nucleotides correspond to a GATA factor binding site. In addition, we show that this promoter-mediated phenomenon involves the FRGY2 family of RNP proteins and a casein kinase II substrate.
MATERIALS AND METHODS Strains and media
Escherichia coli strain K12 MC1061 [(argdl39), (Idra, leu), 7697 lac, X74, galk, galk, ham+, sti hrf] was used for plasmid manipulations and preparation. E.coli media were prepared according to Miller (16). Restriction enzymes and plasmid construction Standard procedures were used for restriction enzyme digestion and plasmid construction (17). Restriction enzymes, Bal31 nuclease and T4 DNA ligase were from BRL and were used according to the manufacturer's instructions. Plasmid pOGS210 has the wild-type LTR (long terminal repeat) including the TAR sequence to +82 (18), pOGS209 has a truncated TAR (18) and pPE343 has the wild-type LTR up to the RNA start at +1 and is therefore TAR- (1); pPE344 and pPE345 correspond to plasmids pOGS210 and pPE343 and carry a deletion in the LTR from -420 to -120, indicated by dashes; pPE311 has an XbaI linker inserted at the EcoRV site in pPE344. Plasmid pPE742 contains an oligonucleotide corresponding to -406 to -313 inserted in the HIV-1 LTR at the unique XbaI site in pPE3 11; pPE840, pPE841 and pPE842 have small deletions around the internal EcoRV (-340) site in pPE742; pPE860 has base substitutions at the internal EcoRV site in pOGS210 (Fig. 4b). Plasmid pPE862 contains an oligonucleotide spanning nucleotides -84 to -116 in the human 4-globin promoter (-116 CACTGGATC GATAAGAAACACCACCCCGCAG -84) inserted into the unique XbaI site in pPE3 11. Plasmid pPE863 contains the same region but with a three base substitution
406
Nucleic Acids Research, 1995, VoL 23, No. 3
mutation known to abolish the binding of GATAI (19) (-116 CACTGGATCTGgcAcAAACACCACCCCTGCAG -84).
specific activity of 107 c.p.m./4g using T4 polynucleotide kinase and [y-32P]ATP (6000 Ci/mmol activity; Amersham International). Binding reactions were essentially as described (19) and
Xenopus oocyte microinjection Xenopus laevis females (Blades Ltd, UK) were anaesthetised with tricaine (Sigma) and ovarian follicles were removed by manual dissection using standard procedures (20). Individual oocytes were manually dissected and stage VI oocytes were selected. Stage VI oocytes were prepared and injected with 3 ng (unless otherwise stated) of plasmid DNA as described (20). In all cases a f3-galactosidase plasmid was co-injected and the levels of ,-galactosidase were determined (21). These were always within 2-fold and the CAT data are, therefore; presented without standardisation. Careful preparation of the oocytes was essential, in particular the use of collagenase to separate the oocytes was avoided because this can artificially mature oocytes, leading to atypical expression of injected molecules (22; Braddock et al., unpublished data). To ensure accurate injection, oocytes were orientated with the amal pole towards the needle for injections into the nucleus and with the vegetal pole towards the needle for injection into the cytoplasm. Oocytes were orientated in batches of 10 on a buffer-soaked pad flooded with buffer to ensure that no dessication occurred. It was essential to change the media during incubation every 24 h. Experiments were never initiated more than 24 h after isolation of the oocytes. Using these procedures the data are highly reproducible. Data are representative of a least three independent frogs for each data item. The different figures were generated from different frogs. Oocytes were maintained in Barth's X medium at 19°C. Typically, 3 ng of DNA or 3 ng of synthetic RNA (unless otherwise stated in the text) was injected in 25 nl using 20-30 oocytes per item of data. Rescued RNA was injected as previously described (23).
contained 0.5 ng of probe, 0.5 jl of extract, 2 jg poly(dIdC):poly(dIdC) (Pharmacia) and appropriate competitor in 20 p1 ofbuffer (10 mM Tris-HCl, pH 7.5,50 mM NaCl, 1 mM EDTA, 5% glycerol). Reactions were incubated at room temperature for 30 min; where indicated antibody was added after 15 min. Complexes were analysed on 0.5 x TBE native polyacrylamide gels (5%) run at 200 V for 2-3 h. Gels were dried and visualised by phosphorimaging. The wild-type 4-globin GATA oligonucleotide is shown in Figure Sb. The sequence of the upper strand of the mutant oligonucleotide was -116 CACTGGATCTGgcAcA AACACCACCCCTGCAG -84 (19). Substitutions are indicated by lower case. Total oocyte protein extracts were prepared by homogenisation of 30 stage VI oocytes in 60 p1 buffer (300 mM NaCl, 20 mM Hepes, pH 7.9, 1 mM MgCI2, 50 mM disodium gylcerophosphate, 1 mM PMSF, 5 mM bencamidin, Sj g/ml each of pepstatin, leupeptin and aprotonin, 40 pg/ml bestatin, 50 mM sodium butyrate, 1 mM DfT). The homogenate was extracted with 2 vol of freon (1,1,2-trichlorotrifluoroethane) to remove yolk (20), centrifuged at 4°C for 10 min at 1200 r.p.m. and the aqueous phase (5 pg/ml) was collected and stored at 4°C for up to 2 days. Oocyte extracts (4 p1l) were incubated with 0.5 ng of probe and 2 jig poly(dI.dC):poly(dI-dC) and appropriate competitor in 25 i11 of binding buffer (20 mM Hepes, pH 7.9, 50 mM NaCl, 2 mM MgCI2, 4% Ficoll) for 30 min at 40C. Reactions were analysed by electrophoresis in native 5% polyacylamide gels buffered with 0.5 x glycine.
RNA analysis RNA was extracted from Xenopus oocytes as described (20) and analysed by quantitative primer extension using equal amounts of total RNA in each analysis. Primer extensions used a synthetic oligonucleotide complementary to nucleotides +13 to +33 (relative to the ATG) of the CAT coding region that was end-labelled ([32P]dATP, 5000 Ci/mmol; Amersham). The primer extension products were analysed on 6% denaturing polyacrylamide gels.
Preparation of ceHl extracts and gel mobility shift assay MEL cell protein extract (1 ig/pl) was prepared according to Dignam (24) and was a generous gift from Nick Proudfoot. The 197 bp HIV-1 LTR GATA fragment was generated by standard PCR amplification (25) from pPE742 using appropriate pmers mapping to sites in the HIV-1 LTR located upstem (-454 to -435) and downstream (-90 to -67) of the oligonucleotide insertion in the HIV-1 LTR in this plasmid (as shown in Fig. 2). The specific competitor was a double-stranded oligonucleotide corresponding to -116 to -84 in the human C-globin promoter (19) encompassing the sequence shown in Figure 5b. The non-specific competitor was a 200 bp fragment from Tat exon 2 (26). Mutant competitors were generated by PCR using the same primer pair as described above for fragments from pPE742, pPE840 and pPE842 and primers mapping to -429 to -406 and -322 to -303 for pPE860. Fragments were end-labelled to a
Antibody preparation and purification of IgG fraction Antibodies against p56 and p60 were raised as described (6). Polyclonal anti-GATAl rabbit antibody C62, raised against a conserved region of the DNA binding domain of chicken GATA 1, was a generous gift from Graham Goodwin. Control antibody was rabbit anti-IgG (Sigma). Inhibitors Inhibitors were co-injected and maintained in the media. Quercetin was used at 5 jig/ml and rutin at 5 pg/ml (both obtained from Sigma). The inhibitory activity of these compounds was confirmed in vitro using purified casein kinase II with casein as the substrate (data not shown). Enzyme assays CAT and 13-galactosidase assays were perforned and quantitated as described by Gorman et al. (21,27), ensuring that measurements were made within the linear range of the assay. Activities are given as per cent conversion of [14C]chloramphenicol. Unless otherwise stated assays used 100 jig of protein extract and were run for 2 h. Data analysis CAT and quantitative primer extensions were analysed by conventional autoradiography or by phosphorimaging (Molecular Dynamics, Sunnyvale, CA). The images are presented directly as obtained using the linear scanning mode without file conversion (28).
Nucleic Acids Research, 1995, Vol. 23, No. 3 400
400
-100
4I
RspaI
AP-1 WFAT.1 , _ H
NFAB SI TATA = = |
USF
3ng
~~~~TAR
RV
RV
.1 mF NA InHbtbn .,~~~~~~~~~~~0 RV
RV
RV
RV
v. .,
4
Eamew B_n Pmnta
Elwood
_
3
2
1 be""w
407
site
pOGS210 EZI H
pOGS209
1l
pPE344
H
:fl RV r
pPE311
RV
CA-F
)
RV -I--
-
x H
_
RV
x
ATv
RV
LTICAT
pPE343 H
pPE345
RV
DNA injected
CAT conversion
3ng pOGS210
15ng pOGS210
pPE311
3ng pOGS21O+tat
0.7%
0.9%
86%
76%
RV
I-AT --- L car
Figure 1. A site in the HIV-1 promoter controls translation. The promoter region of HIV-l (HXB2) (59). Key cis elements and plasmid derivatives are shown. The RNA start site is numbered as +1. H, HindIll; RV, EcoRV; X, XbaI restriction sites; CAT is the coding region for bacterial chloramphenicol acetyl transferase.
RNA
I 1 L22 3 i I4
79
*
*
*
129
161
196
.*-
154
Figure 2. Expression directed by the wild-type LTR and the NRE-deleted LTR. CAT assays and RNA analysis as assayed by quantitative primer extension; the extension product is 154 nucleotides by comparison with standards (not shown). RNA quantitation is shown below the gel as counts xIO-3.
RESULTS The negative regulatory region (NRE) of the HIV-1 promoter controls translation
RNA that is translationally inactive is functionally intact
To define the mechanism of promoter control of translation we initially constructed a large deletion in the promoter that removed sequences that were redundant for transcription, but which, in some assays, contain a negative element for transcription of LTR-directed expression (29-32). Our previous studies indicated that the TAR sequence did not influence promoter control of translation (33), but for completeness we constructed the NRE deletion in TAR+ and TAR- LTRs. Plasmids are shown in Figure 1. The plasmids with wild-type NREs are pOGS21O (TAR+) (18), pOGS209 (TAR defective) and pPE343 (TAR-) (1). The NRE was deleted by removing the double EcoRV fragment from -120 to -420 in the LTR to produce pPE344 (TAR+) and pPE345 (TAR-). pPE3 11 is derived from pPE344 by insertion of a unique XbaI site at -340. Plasmids were injected into the nucleus of Xenopus oocytes and extracts were assayed after 24 h for CAT protein activity and RNA. The initial experiment (Fig. 2) showed that pOGS210 and pPE311 produce equivalent amounts of RNA but no CAT activity was detected from pOGS210 (lane 1), even when increased DNA was injected (lane 2). However when the NRE was deleted, as in pPE311, efficient translation was obtained (lane 3). This was equivalent to the level obtained when Tat activated translation. The Tat-TAR interaction can be viewed as essentially bypassing the promoter-imposed block (1). Similar results were obtained with the TAR- plasmids, in that pPE344 and pPE345 yielded equivalent amounts of RNA but translation was only detected with pPE345 (see next section). This result suggests that sequences mapping between -120 and -450 mediate the promoter control of translation.
We wished to determine whether lack of translation of the RNA produced by pOGS210 orpPE343 was due to post-transcriptional processing of the RNA. pOGS210, pPE343 and the respective NRE-deleted plasmids pPE311 and pPE345 were injected into the nucleus of Xenopus oocytes and after 24 h total RNA was isolated and re-injected into fresh oocytes to assess translational competence (Fig. 3). Two trpes of assay were used. RNA produced from pPE343 and pPE345 lacks the TAR RNA leader and can be tested by simple injection into the cytoplasm of the oocyte as described previously (1,23). RNA produced from pOGS21O and pPE311 has the TAR RNA leader which inhibits translation, precluding analysis by injection into the cytoplasm. We have, however, previously shown that when TAR RNA is injected into the nucleus together with Tat protein, then translation is activated (23,33). Therefore all RNAs derived from TAR+ plasmids, irrespective of the promoter structure, were assayed after rescue by injection into the nucleus in the presence of Tat. RNA that had been synthesised from pOGS210 (TAR+, NRE+) but not translated (Fig. 3, lane 1) was translated after rescue and re-injection (Fig. 3, lane 4). RNA that had been synthesised from pPE311 (TAR+, NRE-) was translated (Fig. 3, lane 5) and was, as expected, still translationally competent after re-injection (Fig. 3, lane 7). In both cases, as expected, the rescued RNA required Tat. The level of translation of rescued RNAs were comparable (Fig. 3, lane 7 compared to lane 4), indicating that the rescued RNAs had a similar translational potency. This suggests that the lack of initial translation from pOGS210 did not reflect an alteration to the RNA. Likewise, RNA rescued after injection of pPE343 (TAR-, NRE-) which was not translated after the initial
408
Nucleic Acids Research, 1995, Vol. 23, No. 3 RNA
Plasmid
T 4 2 1 2 :.~j
RNA
Plasmid
6
5
4_ AmA_ w
pOGS210 pOGS210
RNA
Plasmid
RNA
8
9
10
f1
_s dl
A
Jw _ 0
IF
0
.) OD*
210
Plasnmid
w
0
40 0 0
7
210
O*
pPE311
311
311
N
N
N
pPE343
Tat
N
N
N
-
+
-
N +-
T
o.4%
49%
0.80/.
RNA
154
N
pPE345
345
N
r
94%.
79% 01
T--
T
+
+
+ _ _ _+ i i -
CAT conversion
N
C
343 -
Injection site
36%
1%
51%
5
8
+__4-_-
47%
. 1.
.
10
_
IS
-..-76
Figure 3. Translation of rescued RNA. Plasmids pOGS21O, pPE311, pPE343 and pPE345 were injected into Xenopus oocytes and after 16 h RNA was isolated. The respective RNAs are referred to as 210, 311, 343 and 345. These RNAs were injected into fresh oocytes into the designated cellularcompartment as described previously (23). N, nucleus; C, cytoplasm. CAT assays are shown for the initial plasmid injections and for the injected RNAs. The quality of the RNAs prior to injection is indicated by the primer extension; the extension products are 154 and 76 bases. Plasmids pPE343 and pPE345 generate a staggered start site due to disruption of the initiation region (1,58).
injection (Fig. 3, lane 8) was translated after re-injection (Fig. 3, lane 9). RNA rescued after injection of pPE345 (TAR-, NRE-) which was translated after the initial injection (Fig. 3, lane 10) was, as expected, translated after re-injection (Fig. 3, lane 11). Again, the levels of translation of the rescued RNAs were comparable, despite the lack of initial translation of the RNA produced from pPE343. These data show that the RNAs produced by transcription from pOGS210 and pPE343, which are not translated, are in fact fully translationally competent when rescued and re-assayed. This suggests that there has been no degradation and no modification of 5' or 3' ends. This is consistent with Northern blot analysis that indicates that the transcripts have the correct size (data not shown). A discrete sequence in the promoter mediates the translation block Our data implicate the NRE region in detennining the translation block. To identify a specific sequence in this region, we made deletion and substitution mutations. The NRE had been removed, in pPE344, as a double EcoRV fragment and so initially we re-inserted either the upstream (pPE309) or downstream (pPE314) EcoRV fragments into pPE3 11. Neither of these fragments completely restored the translational inhibition, restoring -23% of the activity of the fully deleted NRE (pPE3 11) (Fig. 4a). This suggested that a key site straddled the EcoRV site at -340. A synthetic oligonucleotide spanning -406 to -313 was inserted, therefore, into pPE311 to produce pPE742. When RNA was produced from pPE742 it was not translated (Fig. 4a). Smaller deletion and substitution mutations were made in and around the -340 EcoRV site (Fig. 4b). Several of these, pPE840, 841, 842 and 860, ablated the translational inhibition. In
particular, a three base substitution at the EcoRV site (pPE860) produced a promoter that generated RNA that was translated as efficiently as RNA from pPE344 (Fig. 4a and b). RNA levels produced from all of these constructions were the same (data not shown). These data show that a discrete element in the HIV-1 promoter mediates translational control. Evidence that a GATA-like protein mediates the translation inhibition The NRE region contains numerous presumptive and proven sites for the binding of positive and negative transcription factors (34-44). Spanning the central EcoRV site is a sequence with homology to sites that bind the haematopoietic transcription factors known as GATA factors (45-47) (Fig. 5), raising the possibility that GATA-like factors in Xenopus oocytes might mediate the promoter control of translation described above. It is known that GATA-like factors are present in Xenopus oocytes (47) and we confirmed that this was true in our system using gel mobility shift assays in which we showed that our oocytes contain a factor that binds to a human 4-globin promoter fragment with similar mobility characteristics to a MEL cell GATA1 factor (19) (Fig. 6a). Binding of the oocyte factor to the HIV sequence was specifically inhibited by a fragment derived from the human 4-globin promoter which contains a GATA binding site. Furthermore, fragments derived from the HIV promoters in plasmids pPE840, pPE841 and pPE860 all failed to compete for binding of GATA1 to the HIV-1 LTR (Fig. 6b). None of these mutant promoters inhibited translation. In contrast, a fragment from pPE742 that contained the promoter that inhibited translation competed effectively for GATA1 binding (Fig. 6b). These data indicate that the HIV- I LTR might interact with GATA factors and
a
HN1( .X UJ
RV
H
RV
H
RV
H
l
X
pPESOW H
x
L
pPES2
RV
4
,
Extract
,
X
RV
lxl..
4
}
GATA
1 1
0
10 100
2
3
4
non-spec.
I -1[''-1 10 100
5
6
0
GATA
non-spec.
10 100
100 10 11
If -l
7 8
9
=
1
El
23%
C
-..
F
--
as # NIp_
23%
1%
3
x
90%
95% 40%
RV
M
'
150%
Eco RV
pOGS210(-357to-328) AGaGCCA GaATcA -AT AT C CACTGACCTT ATCAaA....I- TGACCTT
pPE0
AaaGccAAGa
pPEU41
. . AT CICACTACCTT AGaGccAaaGATCAIA.-- cAcAcTaAccTT c CACTGACCTT AaaaCCaaOATCA 9 ALc
AGOaCCAGaa.
pPEU42 pPE860
Figure 4. Localisation of the post-transcriptional blocking sequence within the HIV- 1 LTR. (a) Structure and activity of HIV- 1 mutant promoters. Deletions are indicated by dashed lines; a substitution mutation is indicated by a hatched box. Plasmids pPE309 and pPE314 contain insertions of EcoRV fragments; pPE742 contains an oligonucleotide corresponding to -406 to -313 inserted in the HIV-l LTR at the unique XbaI site in pPE31 1; pPE840, pPE841, pPE842 and pPE860 are described in Materials and Methods. The expression from each plasmid is shown by the bar graph displaying CAT activity. (b) Sequences of deletion and substitution mutants. Deletions are indicated by dashes and base substitutions are shown in lower case.
f usmdGATA ICsesmmswpeo
HNV4(46.4 ) G
TA.1.
Probe
HIV-1 LTR GATA Fragment MEL
Extract
Competitor Molar Excess
pPE 742
C --IP-
W
pPE 840 50 200 5 50 200
5
0
4
pPE 860
pPE 841 5 50 200
5
4, u'w " w
i-A
TCAi :.Ax >.I"
to 40 CA @ "_"i!0-3
Hzooa.Zbis(T11oT41
b.
50
200
6.j
ild
AM Iwy
HW.1(4Ub4) _ 7.e....
Hip* p a
zeta glob.
zeta glob.
I
,
MEL
Oocytes
Competitor Molar Excess
RV
5D
.
RV
H
pPE86
I
x
>,
u
H
b
-
-
1~
1%I
Z
HIV-1 LTR GATA OLIGO (-355 to -326)
Probe
I
US
RV
x
pPE309
pPE742
R
RV
RV
H
pPE311
pPE3I4
CAT Activity
FINA Mad
RV
409
a.
1A
p00S210i
pPE344
Nucleic Acids Research, 1995, Vol. 23, No. 3
C T T W *. C
061
T
::
VA,O AU *a A T a 6 At A A GA:WA: CT
T
`T
A
C
C
C
A
C
i
T
A
F -+
A
A
C C C
Figure 5. Sequence homologies between the HIV-1 and HIV-2 LTRs (26) and mammalian GATA binding sites from human a-globin (19) and human 4-globin (47) promoters.
that loss of binding to GATA correlates with loss of the ability to inhibit translation. To determine whether a GATA binding site was sufficient to mediate translational repression, a 17 residue oligonucleotide containing the GATA site from the human 4-globin promoter was inserted into pPE3 11 to produce pPE862. This hybrid promoter produced RNA that was not translated (Fig. 7, lanes 1 and 3). In contrast, insertion of a 4-globin oligonucleotide with a mutation in the GATA site known to abolish binding of GATA protein (19) produced a hybrid promoter that directed the production of RNA
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Figure 6. Specific binding of mammalian GATA1 to the post-transcriptional blocking sequence. (a) Evidence for a GATA binding protein in Xenopus oocytes. Gel mobility shift of an HIV- I LTR-derived oligonucleotide containing the putative GATA binding site (-355 to -326) with a Xenopus oocyte protein extract (lane 2) compared to a MEL cell extract (lane 7). Free fragment is shown in lane 1. The effect of an increasing molar excess of a specific GATA binding oligonucleotide (4-globin GATA, lanes 3, 4, 8 and 9) and a non-specific competitor (lanes 5, 6, 10 and 11) are shown. (b) Specific binding of MEL cell GATA protein to the HIV-1 LTR. A 197 bp HIV-1 LTR fragment encompassing the GATA site was retarded with an extract from MEL cells (lanes 1). The effect on the fonnation of a shifted complex of an increasing molar excess of oligonucleotides derived from either the wild-type HIV-1 promoter (pPE742, lanes 2-4) ormutated HIV-1 promoters (pPE840, pPE841, pPE860, lanes 5-14) is shown.
410
Nucleic Acids Research, 1995, Vol. 23, No. 3 1
3
2
-- -r
4
;,
i
I, 4wm
DNA injected CAT conversion
pOGS210
pPE311
pPE862
2%
980°o
3%
pPE863
78%
sOC32 CO c
RNA
1
2
3
78
72
(o
rIeG:
t.
c,
't4
*
4 *
80
°
_
154
60
Figure 7. Functional substitution of the human 4-globin GATA sequence for the HIV-l post-transcriptional blocking sequence. (a) CAT assays showing the level of expression from the wild-type promoter (pOGS2lO), the NRE-deleted promoter (pPE31 1), the NRE-deleted promoter plasmid containing an insert from the human 4-globin gene (pPE862) and the NRE-deleted promoter containing a mutated fragment from the human 4-globin gene (pPE863). (b) RNA analyses are shown. RNA was analysed by quantitative primer extension and the extension product is shown. Quantitation is shown below the gel as counts xIO-3.
that was fully translatable (Fig. 7, lane 4). Taken together, these data are intriguing and suggest there is a specific protein in Xenopus oocytes, probably related to mammalian GATA factors, that mediates the translational repression via binding to a discrete, specific DNA motif in the HIV promoter.
The HIV-1 promoter loads cognate RNA into the general Xenopus oocyte translation masking pathway We considered the possibility that HIV-l-directed transcripts were destined to be packaged by the classical masking proteins p60 and p56 (6,7). To test this we attempted to reverse the translation inhibition by injecting antibodies specific for p60 and p56 (6). Plasmid pOGS209 was used for this study. This contains the full HIV-1 LTR but lacks the TAR element beyond +19. This is analagous to pPE343 in that it has no TAR activity and is not activatable by tat, but basic levels of transcription are 10 times higher because the initiator element InR is intact (48). Plasmid pOGS209 was co-injected into the nucleus of Xenopus oocytes together with antibodies specific to p60 and p56. It has also been suggested that the activity ofthe masking proteins is phosphorylation dependent (5,6) and that casein kinase II is involved in the modification (6,8). We therefore injected quercetin, an inhibitor of casein kinase II and the inactive analogue rutin to address the role of casein kinase II phosphorylation. As shown in Figure 8, when pOGS209 DNA was injected into the nucleus, there was transcription but no translation (lane 1). When specific antibodies to p56 and p60 were injected into the nucleus, translation was now detected (lane 4), Interestingly,
5U.
RNA
ra
y:
i
T---- '- --
-
---- .r --
-
:,
-
.......
**
*
-
93hp
Figure 8. The block to translation of TAR- RNAs is relieved by co-injection ofantibodies to p56 and p60 or by inhibition of casein kinase H. pOGS209 DNA was injected into the nucleus either alone (lane 1) or together with quercetin (lane 2) or rutin (lane 3), antibodies raised against p56 and p60 (lane 4) or rabbit immunoglobulin G (lane 5). CAT assays were perforned as described and the percentage CAT converted calculated by phosphorimager analysis. RNA was analysed as above.
injection of the same antibodies into the cytoplasm had no effect (data not shown). These data indicate that p56 and/or p60 plays a role in the translational repression. Furthermore, they suggest that the repression can be established in the nucleus, which is consistent with the notion we have previously advanced, that there is a nucleus-dependent translation repression pathway in the Xenopus oocyte (6). The inhibition of casein kinase II by quercetin also allowed some translation (lane 2), whereas rutin had no effect (lane 3). These data suggest that casein kinase II plays a role in mediating the translational block.
DISCUSSION We have shown that the HIV- 1 promoter controls translation via a discrete site upstream of the mRNA start. A subtle mutation that substitutes three nucleotides at position -340 had no effect on transcript structure or yield, but completely changed the translational fate of the RNA. We have demonstrated a correlation between the ability of the region to bind GATA proteins and the ability to repress translation. Furthermore, a fragment from the
Nucleic Acids Research, 1995, Vol. 23, No. 3 human Q-globin promoter, apparently comprising only a GATA binding site, functionally substituted for the -340 region to repress translation. It remains to be seen whether a known GATA protein is involved, or whether there are other proteins related only by their binding specificities that mediate the repression. Given the discrete nature of the promoter site, it seems most likely that a specific protein-DNA interaction is required to mediate translation control. We have gained some insight into the mechanism of the translation control in this system. The injection of antibodies against the major masking proteins p56 and p60 allowed significant levels of translation. This suggests that the HIV-1directed mRNA becomes associated to some degree with these proteins. Furthermore, a casein kinase II type phosphorylation appeared to be involved as the inhibitor quercetin blocked the translational repression. One important aspect of our results was that the antibodies and quercetin were only active when delivered to the nucleus. This is consistent with our earlier suggestion (1) that the nucleus can control translation. Normally, in the oocyte, masked messages are stored in the cytoplasm and therefore the bulk of the p56 and p60 is cytoplasmic. However, these proteins can be detected in the nucleus (6,49). We therefore suggest that translation repression involves the loading of phosphorylated p56 and p60 onto the RNA in the nucleus and that the phosphorylated mRNP is exported to the cytoplasm where for some, as yet undetermined, reason it cannot associate with polysomes. The HIV- 1 promoter, when functioning in Xenopus oocytes, appears to deliver its cognate RNA to this nucleus-specific message masking pathway as a result of the function of promoter sequences in the -340 region. Given that transcription and translation pathways are spatially separated in the cell, it is not immediately obvious how a promoter can signal a translation block. However, the finding that the block is imposed in the nucleus may help to explain how transcriptional and translational events might be coupled. We propose that there are two types of transcription in Xenopus oocytes: productive and non-productive. Productive transcription couples the cognate transcript to a positive translation pathway. This pathway allows the RNA to avoid the masking proteins. Alternatively, non-productive transcription uncouples transcription from translation and delivers the RNA to the masking proteins. Productive transcription could for example be due to a specific export route being used or positive translation factors could be loaded in the nucleus and prevent the masking proteins assembling. The promoter would be responsible for either setting up the export route or recruiting the positive factors. The notion that promoters might dictate export has been proposed previously as the 'gene gating' hypothesis (50), which states that transport is coupled to transcription. The notion that positive translation factors might be recruited in the nucleus is consistent with the finding that some translation factors, e.g. eIF-4E, are nuclear (5 1). The -340 site might influence the type and/or number of the transcription factors that associate with the promoter. This in turn could affect gene gating or translation factor recruitment. If the gene does not gate correctly, or fails to recruit translation factors, the mRNA may be a target for masking, perhaps by default. There are a number of related observations in the literature that also support the notion that a promoter can influence events after the production of the transcripts. For example, the human ,-globin promoter directs the production of significant levels of intron-containing transcripts, but is apparently non-functional if
411
the introns are removed from the DNA template. However, the identical intronless transcript is expressed efficiently using a heat shock or CMV promoter (52). Similarly, the SV40 late promoter is intron-dependent (53). The human (-globin promoter also appears to 'sense' the presence of translation stop codons in the transcript. The presence of stop codons results in reduced export of transcripts to the cytoplasm, whereas identical transcripts driven by the HSV Tk promoter are exported efficiently (54). A potentially related observation is that the HSV Tk promoter regulates the export of cognate transcripts in trans in Xenopus oocytes (55). Furthermore, stop codons in transcripts have also been shown to influence the rate of nuclear RNA turnover (56,57). There is clearly some cell specificity for some of these promoter effects on post-transcriptional processes. For example, introns increased transcriptional efficiency of mouse metallothionein I gene-based constructs in transgenic mice, but had little effect on these constructs in cultured cells (58). All of these observations imply that there is some sort of two-way communication between transcriptional and post-transcriptional processes. In summary, we have shown that the region around -340 in the HIV- 1 promoter controls the translation of cognate RNA in Xenopus oocytes. Our data appear to be the first to implicate a discrete site in a promoter in controlling the translational fate of RNA.
ACKNOWLEDGEMENTS This research was supported by the MRC AIDS Directed Programme. Martin Braddock is a Royal Society Research Fellow. We are grateful to John Sommerville for the gift of purified IgG fractions to Xenopus p56 and p60 and to Geoff Partington for advice on detecting GATA factors in Xenopus oocytes. We thank our colleagues in the Retrovirus Molecular Biology Group for stimulating discussion.
REFERENCES 1 Braddock, M., Thorburn, A.M., Chambers, A., Elliott, G.D., Anderson, G.J., Kingsman, A.J. and Kingsman, S.M. (1990) Cell, 62, 1123-1133. 2 Capco, D.G. and Jackle, H. (1982) Devl BioL 94, 41-50. 3 Dambrough, C.H. and Ford, P.J. (1981) Eur. J. Biochem. 113,415-424. 4 Dearsly, A.L., Johnson, R.M., Barrett, P. and Sommerville, J. (1985) Eur J. Biochem. 150,95-103. 5 Kick, D., Barrett, P., Cummings, A. and Sommerville, J. (1987) Nucleic Acids Res., 15, 4099-4109. 6 Braddock, M., Muckenthaler, M., White, M.R.H., Thorbum, A.M., Sommerville, J., Kingsman, A.J. and Kingsman, S.M. (1994) Nucleic Acids Res., 22, 5255-5264. 7 Bouvet, P. and Wolffe, A.P. (1994) Cell, 77, 931-942. 8 Cummings, A. and Sommerville, J. (1988) J. Cell Biol., 107, 45-56. 9 Cummings, A., Barrett, P. and Sommerville, J. (1989) Biochim. Biophys. Acta, 1014, 319-326. 10 Deschamps, S., Viel, A., Denis, H. and le Maire, M. (1991) FEBS Lett., 282, 110-114. 11 Marello, K., LaRovere, J. and Sommerville, J. (1992) Nucleic Acids Res., 20,5593-5600. 12 Richter, J.D. and Smith, L.D. (1984) Nature, 309, 378-380. 13 Richter, J.D. (1991) BioEssays, 13, 179-183. 14 Sommerville, J. (1990) J. Reprod. Fert., 42 (suppl.), 225-233. 15 Sommerville, J. (1992) BioEssays, 14, 337-339. 16 Miller, J.H. (1972). In Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 17 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
412
Nucleic Acids Research, 1995, Vol. 23, No. 3
18 Adams, S.E., Johnson, I.D., Braddock, M., Kingfsman, S.M., Edwards, M.R. and Kingsman, A.J. (1988) Nucleic Acids Res., 16, 4287-4298. 19 Watt, P., Lamp, P., Squire, L. and Proudfoot, N. (1990) Nucleic Acids Res., 18, 1339-1350. 20 Gurdon, J.P. and Wickens, M.P. (1983) Methods Enzymol., 101, 307-386. 21 Sowden, M.P., Harrison, S., Ashfield, R., Kingsman, A.J. and Kingsman, S.M. (1989) Nucleic Acids Res., 17, 2959-2972. 22 Watanabe, N., Vande Woude, G.F., Ikawa, Y. and Sagata, N. (1989) Nature, 342, 505-511. 23 Braddock, M. Thorburn, A.M., Kingsman, A.J. and Kingsman, S.M. (1991) Nature, 350, 439-441. 24 Dignam, J.D., Lebovitz, M.R. and Roeder, R.G. (1983) Nucleic Acids Res., 11, 1475-1491. 25 Saiki, R., Stoffel, S., Horn, G., Mullis, K. and Ehrlich, H. (1988) Science,
239,487-491. 26 Myers, G., Robson, A.B., Berzofsky, J.A., Smith, T.F. and Wong-Staal, F. (1991) Human Retroviruses and AIDS. Los Alamos Laboratory, Los Alamos, NM. 27 Gorman, C.M., Moffat, L.F. and Howard, B.H. (1982) Mol. CelL Biol., 32, 1044 1051. 28 Johnston, R.E, Pickett, S.C. and Barker, D.L. (1980) Electrophoresis, 11, 355-360. 29 Rosen, C.A., Sodroski, J.G. and W.A Haseltine (1985) Cell, 41, 813-823. 30 Giacca, M., Gutierrez, M., Menzo, S., d'Adda di Fagagna, F. and Falaschi, A. (1992) Virology, 186, 133-147. 31 Lu, Y., Touzijian, N., Stenzel, M., Dorfmann, T., Sodroski, J.G. and Haseltine, W.A. (1990) J. Virol., 64, 5226-5229. 32 Nakanishi, Y., Masamune, P. and Kobayashi, N. (1991) J. Vrol., 65, 6334-6338. 33 Braddock, M., Chambers, A., Wilson, W., Esnouf, M.P., Adams, S.E., Kingsman, A.J. and Kingsman, S.M. (1989) Cell, 58, 269-279. 34 Garcia, J. A., Wu, F.K., Mitsujasy, R. and Gaynor, R.B. (1987) EMBO J., 6, 3761-3770. 35 Siekewitz, M., Josephs, S.F., Ducovich, M., Peffer, N., Wong-Staal, F. and Greene, W.C. (1987) Science, 238, 1575-1578. 36 Smith, M.R. and Green, W.C. (1989) Proc Natl. Acad. Sci. USA, 86, 8526-8530. 37 Orchard, K., Perkins, N., Chapman, C., Harris, J., Emery, V., Goodwin, G., Latchman, D. and Colfins, M. (1990) J. Vrol., 64, 3234-3239. 38 Dasgupta, P., Saikumar, P., Reddy, C.D. and Reddy, E.P. (1990) Proc. Natl. Acad. Sci. USA, 87, 8090-8094.
39 Guy, B., Acres, R.B., Kieny, M.P. and LeCocq, J.P (1990) J. AIDS, 3, 797-809. 40 Jarman, A.P., Wood, W.G., Sharpe, J.A., Gourdon, G., Ayyub, H. and Higgs, D.R. (1991) Mo. Cell. Biol. 11, 4679-4689. 41 Li, Y, Ross, L., Scheppler, J.A. and Franza, B.R. (1991) Mol. Cell. Biol., 11, 1883-1893. 42 Cooney, A.J., Tsai, S.Y., O'Malley, B.W. and Tsai, M.-J. (1991) J. Wrol., 65, 2853-2860. 43 Orchard, K., Lang, G., Collins, M. and Latchman, D. (1992) Nucleic Acids Res. 20, 5428-5434. 44 Franza, B.R., Raucher, F.J., Josephs, S.F. and Curran, T. (1988) Science, 239, 1150-1153. 45 Yang, Z. and Engel, J.D. (1992) Mol. Cell. Biol., 12, 4562-4570. 46 Engel, J. D., Beug, H., LaVail, J.H., Zenke, M.W., Mayo, K., Leonard, M.W., Foley, K.P., Yang, Z., Komhauser, J.M., Ko, L.J., Lim, K.-C., George, K.M. and Breigel, K. (1992) J. Cell Sci., 16 (suppl.), 21-31. 47 Zon, L., Mather, C., Burgess, S., Bolce, M., Harland, R. and Orkin, S. (1991) Proc. Natl. Acad. Sci. USA, 88, 10642-10646. 48 Du, H., Roy, A. and Roeder, R. (1993) EMBO J., 12, 501-511. 49 Sommerville, J., Baird, J. and Turner, B.M. (1993) J. Cell. Biol., 120, 277-290. 50 Blobel, G. (1985) Proc. Natl. Acad. Sci. USA, 82, 8527-8529. 51 Rhoads R.E., Joshi-Barve, S. and Rinker-Schaeffer (1993) Prog. Nucleic Acid Res. Mol. Biol., 46, 183-219. 52 Neuberger, M.S. and Williams, G.T. (1988) Nucleic Acids Res., 16, 6713-6724. 53 Buchman, A.R. and Berg, P. (1988) Mol. Cell. Biol., 8,4395-4405. 54 Enssle, J., Kugler, W., Hentze, M.W. and Kulozik, A.E. (1993) Proc. Natl. Acad. Sci. USA, 90, 10091-10095. 55 de la Pena, P. and Zasloff, M. (1987) Cell, 50, 613-619. 56 Urlaub, G., Mitchell, P.J., Ciudad, C.J. and Chasin, L.A. (1989) Mol. Cell. Biol., 9, 2868-2880. 57 Barker, G.F. and Beemon, K. (1991) Mo. Cell. Biol., 11, 2760-2768. 58 Brinster, R., Allen, J., Behringer, R., Gelinas, E. and Palniter, D. (1988) Proc. Natl. Acad. Sci. USA, 85, 836-840. 59 Ratner, L., Haseltine, W., Patarca, R., Livak, K.J., Stacich, B., Josephs, S.F., Doran, E.R., Rafalski, J.A., Whitehom, E.A., Baumeister, K., Ivanoff, L., Petteway, S.R., Pearson, M.L., Lautenberger, J.A., Papas, T.S., Ghrayeb, J., Chang, N.T., GaHo, R.C. and Wong-Staal, F. (1985) Nature, 313, 277-284.
