Proteasomal Degradation of Rpn4 in ... - Semantic Scholar

Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.109.112227

Proteasomal Degradation of Rpn4 in Saccharomyces cerevisiae Is Critical for Cell Viability Under Stressed Conditions Xiaogang Wang,*,1 Haiming Xu,*,1,2 Seung-Wook Ha,* Donghong Ju* and Youming Xie*,†,3 *Barbara Ann Karmanos Cancer Institute, and †Department of Pathology, Wayne State University School of Medicine, Detroit, Michigan 48201 Manuscript received September 24, 2009 Accepted for publication November 22, 2009 ABSTRACT The proteasome homeostasis in Saccharomyces cerevisiae is regulated by a negative feedback loop in which the transcription factor Rpn4 induces the proteasome genes and is rapidly degraded by the assembled proteasome. In addition to the proteasome genes, Rpn4 regulates numerous other genes involved in a wide range of cellular pathways. Therefore, the Rpn4–proteasome negative feedback circuit not only controls proteasome abundance, but also gauges the expression of other Rpn4 target genes. Our previous work has shown that Rpn4-induced gene expression is critical for cell viability under stressed conditions. Here we investigate whether proteasomal degradation of Rpn4 is also important for cell survival in response to stress. To this end, we generate a stabilized Rpn4 mutant (Rpn4*) that retains its transcription activity. We find that expression of Rpn4* severely reduces cell viability in response to various genotoxic and proteotoxic agents. This detrimental effect can be eliminated by a point mutation that abolishes the transcription activity of Rpn4*, suggesting that overexpression of some Rpn4 target genes weakens the cell’s ability to cope with stress. Moreover, we demonstrate that inhibition of Rpn4 degradation causes synthetic growth defects when combined with proteasome impairment resulting from mutation of a proteasome gene or accumulation of misfolded endoplasmic reticulum membrane proteins. Rpn4 thus represents an important stress-responsive mediator whose degradation as well as availability are critical for cell survival under stressed conditions.

T

HE Saccharomyces cerevisiae RPN4 gene (also named SON1 and UFD5) was originally isolated as a suppressor of sec63-101, a temperature-sensitive mutant of SEC63, which encodes an essential component of the endoplasmic reticulum (ER) translocation channel (Nelson et al. 1993; Johnson et al. 1995; Finley et al. 1998; Fujimoro et al. 1998). Subsequent work showed that deletion of RPN4 inhibits the degradation of several model substrates of the N-end rule and UFD (U b fusion degradation) pathways, suggesting the involvement of Rpn4 in proteasomal degradation ( Johnson et al. 1995). The underlying mechanism, however, remained unsolved until recent studies revealed that Rpn4 is a transcription factor for the proteasome genes (Mannhaupt et al. 1999; Xie and Varshavsky 2001). Interestingly, Rpn4 is an extremely short-lived protein (t1/2 # 2 min) and is degraded by the proteasome (Xie and Varshavsky 2001; Ju et al.

Supporting information is available online at http://www.genetics.org/ cgi/content/full/genetics.109.112227/DC1. 1 These authors contributed equally to this work. 2 Present address: Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas, TX 75390. 3 Corresponding author: Barbara Ann Karmanos Cancer Institute, Wayne State University School of Medicine, 110 E. Warren Ave., Detroit, MI 48201. E-mail: [email protected] Genetics 184: 335–342 (February 2010)

2004, 2007, 2008; Ju and Xie 2004, 2006; Wang et al. 2004). Stabilization of Rpn4 by inhibiting the proteasome results in an increase in the expression of the proteasome genes ( Ju et al. 2004; London et al. 2004). Together, these observations led to a model in which the proteasome homeostasis is regulated by a negative feedback circuit. On one hand, Rpn4 upregulates the proteasome genes; on the other hand, Rpn4 is rapidly degraded by the assembled/active proteasome. The Rpn4–proteasome negative feedback circuit provides an efficient and sensitive means to control the proteasome abundance in S. cerevisiae. Whereas the homologs of Rpn4 have not yet been identified in higher eukaryotes, their proteasome genes are clearly regulated by a negative feedback mechanism (Lundgren et al. 2003; Meiners et al. 2003; Wo´jcik and DeMartino 2002; Xu et al. 2008). In addition to the proteasome genes, Rpn4 appears to regulate numerous other genes involved in a wide range of cellular processes (Mannhaupt et al. 1999; Jelinsky et al. 2000; Gasch et al. 2001; Haugen et al. 2004; Guo et al. 2008; Hausmann et al. 2008; Salin et al. 2008; Teixeira et al. 2008). Interestingly, the promoter of RPN4 carries the binding sites for heat-shock transcription factor 1; multidrug resistance-related transcription factors Pdr1 and Pdr3; and Yap1, a transcription factor that plays an important role in response to oxidation

336

X. Wang et al.

and DNA damage (Owsianik et al. 2002; Haugen et al. 2004; Hahn et al. 2006). These transcription factors are activated by a variety of stressors and in turn induce RPN4 expression. Thus, Rpn4 is considered to be an important stress-responsive mediator. In fact, it has been shown that rpn4D cells are sensitive to different stressing agents ( Jelinsky et al. 2000; Ng et al. 2000; Ju et al. 2004; London et al. 2004; Hanna et al. 2007; Wang et al. 2008). Among the pathways involving Rpn4, the Rpn4– proteasome negative feedback loop likely plays a central role. It not only controls proteasome homeostasis, but also regulates the expression of other Rpn4 target genes through proteasomal degradation of Rpn4. Our previous work has demonstrated that disruption of Rpn4induced proteasome expression severely reduces cell viability under stressed conditions (Wang et al. 2008). In this study, we sought to determine whether Rpn4 degradation is also important for cell survival in response to stress. We found that inhibition of Rpn4 degradation dramatically sensitizes cells to various genotoxic and proteotoxic stressors. This detrimental effect is eliminated by a point mutation that inactivates the transcription activity of Rpn4, suggesting that overexpression of Rpn4 target genes impairs the cell’s ability to tolerate stress. We also demonstrated that stabilization of Rpn4 exhibits synthetic growth defects with proteasome impairment. The underlying mechanism is further discussed.

MATERIALS AND METHODS Plasmids and yeast strains: The details of plasmid construction are available upon request. Briefly, full-length RPN4 and a truncated mutant encoding Rpn4D1-10/D211-229 (RPN4*) were ligated with the RPN4 promoter (500 bp) into the low-copy vectors pRS314 and pRS315 (Sikorski and Hieter 1989), resulting in p314RPN4, p315RPN4, p314RPN4*, and p315RPN4*. For immunoblotting and immunoprecipitation assays, a DNA sequence encoding a triple ha tag (3ha) was inserted immediately upstream of the stop codons of RPN4 and RPN4* in p314RPN4 and p314RPN4* to generate p314RPN4-3ha and p314RPN4*-3ha. To construct replacement vectors, p314RPN4-3ha and p314RPN4*-3ha were cut with XhoI and SacI, and the inserts were subcloned into a XhoI/ SacI-cut pRS304 vector to obtain p304RPN4-3ha and p304RPN4*-3ha. p315CUPRPN4*-C477A expresses a stabilized and transcriptionally inactive Rpn4 allele (Rpn4*-C477A) from the CUP1 promoter in pRS315 (Wang et al. 2004). The plasmids expressing Rpn4172-229-bgal and Rpn4172-229/K187R-bgal from the CUP1 promoter were previously described ( Ju and Xie 2006). Plasmids expressing CPY* (pSM2215), ste6-G38D (pSM1898), and N-terminally His6-tagged VHL-L158P (pSM2016), and a control vector (pSM922) were kindly provided by Susan Michaelis (Metzger and Michaelis 2009). To generate a strain that expresses RPN4* from the native chromosomal locus, p304RPN4*-3ha was linearized by XhoI and transformed into strain EJY140 (MATa his3-D200 leu2-3, 112 lys2-801 trp1-D63 ura3-52 rpn4DTLEU2; see Johnson et al. 1995). The replacement of the rpn4DTLEU2 allele by the RPN4*TTRP1 cassette through recombination at the RPN4

promoter region and the vector sequences of pRS304 and pRS305 was illustrated by a TRP11leu2 phenotype. An RPN4TTRP1 wild-type strain was also constructed by using a similar approach with a XhoI-linearized p304RPN4-3ha vector. Immunoblotting analysis with an anti-ha antibody confirmed the expression of Rpn4-3ha and Rpn4*-3ha in the wild-type and RPN4* strains. Other yeast strains used in this study included JD52 (MATa his3-D200 leu2-3, 112 lys2-801 trp1-D63 ura3-52), YXY210 (MATa trp1-D63 ura3-52 his3-D200 leu2-3,112 lys2-801 PRE1-FLAG-His6TYIplac211 rpn4DTLEU2), WCG4a (MATa ura3 his3-11,15 leu2-3,112), and YHI29/1 (MATa pre1-1 ura3 his3-11,15 leu2-3,112). These yeast strains were described previously (Heinemeyer et al. 1993; Johnson et al. 1995; Ju et al. 2004). Analysis of gene expression: Quantitative real-time PCR (qRT–PCR) was applied to measure gene expression. RNA was prepared from cells grown to an OD600 of 0.8–1.2 as previously described (Schmitt et al. 1990). Reverse-transcription was carried out with SuperScript II reverse transcriptase (Invitrogen), and qRT–PCR was performed using the Fast SYBR Green Master Mix in the StepOne system following the manufacturer’s instruction (Applied Biosystems). The primers used in qRT–PCR included YX717 (ACTGGATCCCCTAATTGACT TGGCTAATTC) and YX732 (CAAGAATTCATGGATATTAT TCTGGGCATC) for PRE1; YX125 (CAGGAACTTTTTCCAC CATCA) and YX126 (CTGAGGGAAAATACATCGTGG) for RPT6; and YX814 (TCCATCCAAGCCGTTTTG) and YX815 (CGGCCAAATCGATTCTCA) for ACT1, which served as an internal control to normalize the levels of gene expression. b-Galactosidase enzymatic assay and immunoblotting analysis: The enzymatic activity of b-galactosidase in liquid yeast cultures was determined using the chromogenic substrate o-nitrophenyl-b-d-galactopyranoside (ONPG) ( Ju and Xie 2006). For induction of the CUP1 promoter driving the expression of Rpn4172-229-bgal and Rpn4172-229/K187R-bgal, yeast cells grown to an OD600 of 0.3–0.5 were treated with CuSO4 at a final concentration of 0.1 mm for 6–7 hr. For immunoblotting analysis, yeast cells were grown to an OD600 of 0.8–1.2, harvested, and resuspended in lysis buffer (150 mm NaCl, 50 mm Tris.Cl, 5 mm EDTA, 1% Triton X-100, pH 7.5) plus protease inhibitor mix (Roche). Yeast extracts were prepared using the glass-bead vortexing method. Protein concentrations were measured by Bradford assay. Approximately 50 mg of each extract was separated by SDS–PAGE, followed by immunoblotting with an anti-ha antibody (Covance) for C-terminally 3ha-tagged Rpn4 and Rpn4* and an antiFLAG antibody (Sigma) for C-terminally FLAG-tagged Pre1 and detection with the Odyssey infrared imaging system (LiCor Biosciences). The blots were reprobed with an anti-yeast a-tubulin antibody (Chemicon) to verify comparable loading. Pulse-chase analysis: S. cerevisiae cells from 10-ml cultures (OD600 of 0.8–1.0) in SD medium with essential amino acids were harvested. The cells were resuspended in 0.3 ml of the same medium supplemented with 0.15 mCi of [35S]methionine/cysteine (EXPRESS [35S] Protein Labeling Mix, PerkinElmer) and incubated at 30° for 5 min. The cells were then pelleted and resuspended in the same medium with cycloheximide (0.2 mg/ml) and excessive cold l-methionine/l-cysteine (2 mg/ml l-methionine and 0.4 mg/ml l-cysteine) and chased at 30°. An equal volume of sample was withdrawn at each time point. Labeled cells were harvested and lysed in equal volume of 23 SDS buffer (2% SDS, 30 mm dithiothreitol, 90 mm Na–HEPES, pH 7.5) by incubation at 100° for 3 min. The supernatants were diluted 20-fold with buffer A (1% Triton X-100, 150 mm NaCl, 1 mm EDTA, 50 mm Na–HEPES, pH 7.5) before being applied to immunoprecipitation with anti-ha antibody (Sigma) combined with protein A agarose (Calbiochem). The volumes of

Proteasomal Degradation of Rpn4 in Stress Response

337

supernatants used in immunoprecipitation were adjusted to equalize the amounts of 10% trichloroacetic acid-insoluble [35S]. The immunoprecipitates were washed three times with buffer A and resolved by SDS–PAGE, followed by autoradiography and quantitation with a PhosphorImager (Molecular Dynamics). Cell growth and survival assays: Cell growth was assessed by serial dilution assays. Yeast cells were grown to exponential phase (OD600 of 0.8–1.2) and normalized by optical density. Fivefold serial dilutions of cell cultures were spotted on selective plates and incubated at 30°. Alternatively, cell growth was directly measured in liquid cultures. Specifically, overnight cultures were diluted to an OD600 of 0.2 and continued to grow to stationary phase. Cell density (OD600) was monitored at different time points and applied to plotting cell-growth curves. Cell survival was measured by colony formation assay. Yeast cultures were grown to exponential phase before being subjected to stresses. Cells were treated with various doses of MMS and t-BuOOH for 1 hr, extensively washed with medium, and plated on selective synthetic complete medium. For UV stress, cells were plated and incubated for 4 hr before being exposed to UV radiation. The plates were kept in darkness afterward. To examine canavanine sensitivity, cells were directly seeded on minimal medium (SD) plates containing different concentrations of canavanine. Colonies were counted 72 hr after plating. The survival rates of treated cells were normalized against that of untreated cells, which was set at 100%.

RESULTS

Figure 1.—Analysis of a stabilized and transcriptionally active Rpn4 mutant. (A) Diagram of wild-type Rpn4 and Rpn4D1-10/D211-229 (Rpn4*) mutant. The Ub-dependent degradation signal (black box) and the N-terminal residues required for Ub-independent degradation (hatched box) were indicated. The C2H2 DNA-binding motif is also shown. (B) Comparison of the degradation of Rpn4 and Rpn4* by pulse-chase analysis. Low-copy vectors expressing C-terminally 3ha-tagged Rpn4 (lanes 1–3) or Rpn4* (lanes 4–6) were transformed into a wild-type strain (JD52). 35S-labeled proteins were immunoprecipitated with an anti-ha antibody and resolved by SDS–PAGE. (C) Quantitation of the data from B by PhosphorImager to show the decay of Rpn4 and Rpn4*. (D) Measurement of the mRNA levels of PRE1 and RPT6 in rpn4D transformants expressing RPN4 or RPN4* or a control vector by qRT–PCR. The relative mRNA levels in rpn4D were set at 1.0. (E) Immunoblotting analysis of the steady-state level of the Pre1 proteasome subunit. Low-copy vectors expressing Rpn4 (lane 2) or Rpn4* (lane 3) from the native RPN4 promoter or an empty vector (lane 1) were transformed into an rpn4D strain (YXY210) in which a FLAG-His6 tag is attached to the C terminus of Pre1 expressed from the chromosomal locus. Cell extracts were separated by SDS–PAGE, followed by immunoblotting analysis with anti-FLAG (top) or anti-a tubulin (bottom) antibodies. (F) Proteasome activity assay. The degradation of Rpn4172-229-bgal in rpn4D transformants ex-

Generation of a stabilized and transcriptionally active Rpn4 mutant: An ideal experimental setting to examine the phenotypes caused by inhibition of Rpn4 degradation is to express a stabilized and transcriptionally active version of Rpn4. This has been a difficult task because Rpn4 is extremely short-lived in vivo and can be degraded by two distinct mechanisms, ubiquitin (Ub)dependent and -independent ( Ju and Xie 2004). Our recent studies showed that the N-terminal 10 amino acids of Rpn4 are required for the Ub-independent degradation mode, whereas residues 211–229 constitute the Ub-dependent degradation signal ( Ju and Xie 2004, 2006; Wang et al. 2004; Ju et al. 2007, 2008). Using pulsechase analysis, we demonstrated that Rpn4D1-10/D211-229, an Rpn4 mutant simultaneously deleted of residues 1– 10 and 211–229 (hereafter referred to as Rpn4*; Figure 1A), was substantially stabilized (Figure 1, B and C). We then decided to examine whether Rpn4* retains transcriptional activity. Low-copy vectors expressing RPN4 or RPN4* from the native RPN4 promoter or a control vector were transformed into an rpn4D strain, and the expression levels of two proteasome genes, PRE1 and RPT6, were measured by qRT–PCR. As expected, the proteasome genes were induced by Rpn4 (Figure 1D). We found that the RPN4* transformants had higher

pressing RPN4 or RPN4* or a control vector was analyzed by an ONPG assay, which measures the bgal activity of the remaining substrates. Rpn4172-229/R187K-bgal, a stabilized Rpn4172-229bgal derivative, was used as a control.

338

X. Wang et al.

mRNA levels of PRE1 and RPT6 than their RPN4 counterparts (Figure 1D). In line with the qRT–PCR results, the Pre1 protein level was also relatively higher in the RPN4* transformants than in the RPN4 counterparts (Figure 1E; compare lanes 2 and 3). These results indicated that Rpn4* is competent in activating its target genes. The elevated expression of PRE1 and RPT6 in the RPN4* transformants likely reflected a higher steady-state level of Rpn4* due to its stabilization. To further examine the effect of Rpn4* on the expression of other proteasome genes, we compared the proteasome activity of the three rpn4D transformants. A plasmid expressing Rpn4172-229-bgal, a short-lived bgal fusion protein with the Ub-dependent degradation signal of Rpn4 ( Ju and Xie 2006), was introduced into the rpn4D transformants. The degradation of Rpn4172229-bgal was assessed by ONPG assay, which measures the remaining bgal enzymatic activity ( Ju and Xie 2006). Rpn4172-229/R187K-bgal, a stabilized derivative of Rpn4172229-bgal with a K187R substitution ( Ju and Xie 2006), was used as a control to ensure that the disparity of bgal activity is not due to variation of transcription and/or translation of the bgal substrates. Whereas its degradation was inefficient in the absence of Rpn4, Rpn4172-229-bgal was rapidly degraded in the cells expressing RPN4 or RPN4* (Figure 1F). These results again demonstrated that Rpn4* is capable of inducing its target genes. In fact, the proteasome activity was slightly higher in the RPN4* transformants than in their RPN4 counterparts, consistent with the increase in proteasome expression in the RPN4* transformants (Figure 1, D and E). Proteasomal degradation of Rpn4 is crucial for cell survival under stressed conditions: To study the biological significance of Rpn4 degradation, we constructed a yeast strain that expresses RPN4* from the native chromosomal locus. Specifically, we replaced the rpn4DTLEU2 allele in strain EJY140 with an RPN4*TTRP1 cassette via site-specific recombination (Figure 2A). Using a similar approach, we generated a wild-type control strain by replacing the rpn4DTLEU2 allele with an RPN4TTRP1 cassette. The RPN4* strain grew relatively slower than its wild-type counterpart under normal conditions (Figure 2B). The growth rate difference between these two strains was most notable at an early stage. RPN4* acted as a dominant mutant because expression of wild-type RPN4 from an episomal vector could not suppress the slow-growth phenotype of the RPN4* strain (data not shown). We then assessed the effect of the inhibition of Rpn4 degradation on cell viability under stressed conditions. Wild-type and RPN4* strains were treated with various doses of DNA-damaging agents, including UV radiation and the alkylating agent MMS. The survival rates were measured by colony formation assays (Figure 3, A and B). We found that RPN4* cells were much more sensitive to UV and MMS than wild-type cells, especially at higher doses. The survival rate of RPN4* cells after

Figure 2.—Construction of an RPN4* strain. (A) Diagram to show the construction of an RPN4* strain. The rpn4DTLEU2 allele of strain EJY140 was replaced with an RPN4*TTRP1 cassette via site-specific recombination (see materials and methods). The gray boxes represent the identical sequences between pRS304 and pRS305 vector backbones. (B) Measurement of the growth of wild-type and RPN4* strains. Overnight cultures were diluted to an OD600 of 0.2 and continued to grow to stationary phase. Cell density (OD600) was measured at intervals as indicated and used to plot the growth curves. Results shown here were the mean of three independent experiments.

treatment with 180 J/m2 UV or 0.2% MMS was 0.1%, whereas .1% of wild-type cells survived under the same conditions. We also compared the sensitivity of RPN4 and RPN4* cells to the oxidizing agent t-BuOOH. Only 0.03% of RPN4* cells grew to form colonies after treatment with 30 mm t-BuOOH, whereas .0.3% of wild-type cells survived with the same treatment (Figure 3C). We further examined whether proteasomal degradation of Rpn4 is critical for cell survival in response to proteotoxic stress. Specifically, we challenged RPN4 and RPN4* cells with canavanine, an arginine analog that can be efficiently incorporated into nascent proteins in the place of arginine, thereby producing structurally aberrant proteins that may not function properly. As shown in Figure 3D, the survival rate of RPN4* cells was significantly lower than that of wild-type cells in the presence of canavanine. Thus, proteasomal Rpn4 degradation is crucial for cell survival in response to genotoxic and proteotoxic stressors. The detrimental effect of Rpn4* depends on its transcriptional activity: To gain insight into the mechanism underlying the stress hypersensitivity caused by the inhibition of Rpn4 degradation, we wanted to determine whether the detrimental effect of Rpn4* is related to its transcriptional activity. To this end, we introduced a Cys-to-Ala substitution at codon 477 of the


339

Figure 3.—Inhibition of Rpn4 degradation sensitizes cells to various stressing agents. Colony formation assays were used to measure the survival rates of wild-type and RPN4* cells treated with various doses of UV radiation (A), MMS (B), t-BuOOH (C), and canavanine (D). Data were presented as the mean of at least three independent experiments. A survival rate was expressed as a percentage of the value of untreated cells, which was set at 100%.

C2H2 DNA-binding motif of Rpn4*, thereby generating a stable but transcriptionally inactive Rpn4 mutant (Rpn4*-C477A). (Our previous study has shown that the C477A mutation abolishes the transcription activity of Rpn4; see Wang et al. 2004.) Low-copy plasmids expressing RPN4, RPN4*, or RPN4*-C477A were transformed into a wild-type (RPN4) strain. The transformants were challenged with UV radiation, and the survival rates were measured by a colony formation assay. While Rpn4* sensitized cells to UV exposure, Rpn4*-C477A dis-

played no effect (Figure 4A). Similarly, Rpn4*-C477A did not reduce cell viability in response to MMS, t-BuOOH, and canavanine (data not shown). These results indicate that the negative effect of Rpn4* on cell survival under stressed conditions is related to its transcription activity. We suspected that Rpn4* over-induces its target genes and that some of the protein products are toxic if not rapidly degraded by the proteasome. To test this hypothesis, we transformed low-copy plasmids expressing RPN4, RPN4*, or RPN4*-C477A or a control vector into a

Figure 4.—The detrimental effect of Rpn4* is related to its transcriptional activity. (A) The UV hypersensitivity of RPN4* cells depends on the transcriptional activity of Rpn4*. Low-copy plasmids expressing RPN4, RPN4*, or RPN4*C477A were transformed into a wild-type strain ( JD52), and the survival rates of the transformants after exposure to UV radiation were measured by colony formation assay. (B) Inhibition of Rpn4 degradation exhibits synthetic growth defects with proteasome impairment. Low-copy plasmids expressing RPN4, RPN4*, or RPN4*C477A or an empty vector were transformed into the proteasome mutant pre1-1 (YHI29/1) and a congenic wild-type strain (WCG4a). A fivefold serial dilution assay was used to compare the growth of the transformants.

340

X. Wang et al.

proteasome mutant, pre1-1, and its wild-type counterpart. The pre1-1 mutant bears a mutation in the proteasome subunit Pre1, and its proteasome activity is compromised (Heinemeyer et al. 1993). Whereas Rpn4* had only a mild effect on wild-type cells, it severely impaired the growth of pre1-1 cells (Figure 4B). Notably, Rpn4*-C477A did not affect the growth of pre1-1. These results reveal that overproduction of Rpn4 target proteins and proteasome impairment exhibit a synthetic effect on cell growth. This synthetic effect likely contributes to the vulnerability of RPN4* cells to stress. Under stressed conditions, the proteasome may be choked by damaged proteins and fail to remove the toxic Rpn4 target proteins in a timely manner, thereby reducing cell viability. Inhibition of Rpn4 degradation sensitizes cells to overexpression of misfolded ER membrane proteins: The hypersensitivity of RPN4* cells to canavanine suggests that inhibition of Rpn4 degradation impairs the cell’s ability to tolerate misfolded proteins. We went on to examine whether RPN4* cells are sensitive to misfolded proteins located in a specific cellular compartment. Specifically, we compared the sensitivity of RPN4* cells to overexpression of three different classes of misfolded proteins. CPY*, a misfolded form of carboxypeptidase Y, is soluble and retained in the ER lumen (Hiller et al. 1996). ste6-G38D, which bears a mutation in the first transmembrane span of the ABC transporter Ste6, represents a misfolded ER membrane protein (Metzger and Michaelis 2009). VHL-L158P, a mutated allele of the mammalian von Hippel Lindau tumor suppressor protein (VHL) serves as a cytosolic misfolded protein (McClellan et al. 2005). Plasmids expressing these mutated alleles from the galactose-inducible GAL1 promoter or an empty vector were introduced into RPN4, RPN4*, and rpn4D cells, respectively. The transformants were seeded on glucose and galactose plates, and the relative survival rates (galactose vs. glucose) were measured by colony formation assay (Figure 5A). In the absence of the overexpression of misfolded proteins, RPN4, RPN4*, and rpn4D cells displayed a similar colony formation efficiency. Overexpression of CPY* and ste6G38D modestly reduced the viability of RPN4 cells. Interestingly, RPN4* cells were much more sensitive to overexpression of ste6-G38D than their RPN4 counterparts. By contrast, they tolerated CPY* accumulation slightly better than RPN4 cells. We found that rpn4D cells were also very sensitive to overexpression of ste6-G38D. However, unlike RPN4* cells, rpn4D cells were relatively more sensitive to CPY* than RPN4 cells. Differing from ste6-G38D and CPY*, overexpression of VHL-L158P had no appreciable effect on the survival of RPN4, RPN4*, and rpn4D cells. Immunoblotting analysis confirmed the expression of VHL-L158P upon induction by galactose (supporting information, Figure S1). These results suggest that inhibition of Rpn4 degradation sensitizes cells specifically to the accumulation of misfolded ER membrane proteins.

Figure 5.—Inhibition of Rpn4 degradation impairs the growth of cells overexpressing misfolded ER membrane proteins. (A) RPN4* cells are specifically sensitive to the accumulation of misfolded ER membrane proteins. Plasmids expressing CPY*, ste6-G38D, or VHL-L158P from the galactoseinducible GAL1 promoter or a control vector were transformed into RPN4, RPN4*, and rpn4D strains, respectively. The transformants were plated on glucose and galactose plates. The relative survival rates on galactose vs. glucose plates were calculated by dividing the colony numbers on galactose plates by those on glucose plates. (B) A fivefold serial dilution assay was applied to compare the sensitivity of RPN4, RPN4*, and rpn4D cells to tunicamycin (0.25 mg/ml).

Since Rpn4* slightly but reproducibly mitigated the toxicity of CPY* overexpression (Figure 5A), we wanted to examine whether Rpn4* could lessen the detrimental effect of the accumulation of other misfolded ER lumenal proteins. To this end, we compared the sensitivity of RPN4, RPN4*, and rpn4D cells to tunicamycin, a wellknown inhibitor that blocks protein folding in the ER lumen. As shown in Figure 5B, RPN4* cells were indeed relatively more resistant to tunicamycin than RPN4 cells. Consistent with the data from CPY* analysis, rpn4D cells were more sensitive to tunicamycin than RPN4 cells. Thus, whereas inhibition of Rpn4 degradation severely reduces cell viability in the presence of the accumulation of misfolded ER membrane proteins, it modestly enhances the cell’s ability to cope with misfolded lumenal proteins. DISCUSSION

Recent studies have revealed a stress-response network in S. cerevisiae where Rpn4 may serve as a major mediator


( Jelinsky et al. 2000; Ng et al. 2000; Owsianik et al. 2002; Haugen et al. 2004; Ju et al. 2004; London et al. 2004; Hahn et al. 2006; Hanna et al. 2007; Salin et al. 2008; Teixeira et al. 2008; Wang et al. 2008; Metzger and Michaelis 2009). RPN4 is activated by a variety of stressors; and Rpn4 in turn upregulates a large number of stress-responsive genes, including the proteasome genes and others involved in protein ubiquitylation, DNA repair, and other cellular processes. The induction of RPN4 under stressed conditions suggests that an increase in the Rpn4 protein level is important for cell survival in response to stress. One would expect that stabilization of Rpn4 might increase cell viability under stressed conditions. Surprisingly, we found that inhibition of Rpn4 degradation actually sensitizes cells to various genotoxic and proteotoxic agents. It is likely that, whereas a transient increase in Rpn4 expression benefits the cell by inducing relevant stress-responsive genes, some of the Rpn4 target proteins may be toxic to the cell if overproduced and accumulated. In support of this argument, we showed that the toxicity of Rpn4* can be eliminated by a point mutation that inactivates its transcription activity. We further demonstrated that expression of RPN4* severely impairs the growth of proteasome mutant cells but has no significant effect on wild-type cells. In addition, we found that cells expressing Rpn4* are hypersensitive to accumulation of ste6-G38D, a misfolded ER membrane protein. Interestingly, a recent study reported that the proteasome activity is impaired in cells overexpressing ste6-G38D (Metzger and Michaelis 2009). These results indicate that over-induction of Rpn4 target genes is toxic if the protein products cannot be removed rapidly by the proteasome. We infer from these results that the toxic Rpn4 target proteins are normally short-lived but may be stabilized under stressed conditions because the proteasome could be occupied by damaged proteins. It is currently unclear why RPN4* cells tolerate the accumulation of misfolded lumenal proteins, such as CPY*, relatively better than wild-type cells (Figure 5). Unlike ste6-G38D, overexpression of CPY* does not impair the proteasome activity (Metzger and Michaelis 2009). Therefore, the Rpn4 target proteins are presumably not accumulated in the cells overexpressing CPY*. On the other hand, the relatively higher proteasome expression level induced by Rpn4* may facilitate the degradation of misfolded lumenal proteins via the ER-associated degradation pathway. It is worthy of note that rpn4D cells are also hypersensitive to the stressors that impair the growth and viability of RPN4* cells, such as UV, MMS, t-BuOOH, and ste6G38D (Figures 3 and 5; also see Wang et al. 2008). Thus, both availability and degradation of Rpn4 are critical for cell survival under stressed conditions. This underscores the biological significance of the Rpn4–proteasome negative feedback circuit. On one hand, Rpn4 induces proteasome and other stress-responsive genes to cope

341

with stress; on the other hand, proteasomal degradation prevents Rpn4 target genes from being over-induced by keeping the Rpn4 protein level in check. The importance of Rpn4 degradation in cellular stress is also reflected by the fact that Rpn4 can be degraded by two distinct pathways that are Ub-dependent and -independent ( Ju and Xie 2004). This dual degradation mode guarantees the efficient removal of Rpn4 even if one of the degradation pathways is impaired by stressors. This study provides an interesting model molecule for understanding the molecular basis of the cellular stress response. We thank Susan Michaelis for plasmids and Li Li for access to the qRT–PCR instrument. This study was supported by a National Science Foundation grant (MCB-0816974) to Y.X.

LITERATURE CITED Finley, D., K. Tanaka, C. Mann, H. Feldmann, M. Hochstrasser et al., 1998 Unified nomenclature for subunits of the Saccharomyces cerevisiae proteasome regulatory particle. Trends Biochem. Sci. 23: 244–245. Fujimoro, M., K. Tanaka, H. Yokosawa and A. Toh-e, 1998 Son1p is a component of the 26S proteasome of the yeast Saccharomyces cerevisiae. FEBS Lett. 423: 149–154. Gasch, A. P., M. Huang, S. Metzner, D. Botstein, S. J. Elledge et al., 2001 Genomic expression response to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p. Mol. Biol. Cell 12: 2987–3003. Guo, N., L. Yu, R. Meng, J. Fan, D. Wang et al., 2008 Global gene expression profile of Saccharomyces cerevisiae induced by dictamnine. Yeast 25: 631–641. Hahn, J.-S., D. W. Neef and D. J. Thiele, 2006 A stress regulatory network for co-ordinated activation of proteasome expression mediated by yeast heat shock transcription factor. Mol. Microbiol. 60: 240–251. Hanna, J., A. Meides, D. P. Zhang and D. Finley, 2007 A ubiquitin stress response induces altered proteasome composition. Cell 129: 747–759. Haugen, A. C., R. Kelley, J. B. Collins, C. J. Tucker, C. Deng et al., 2004 Integrating phenotypic and expression profiles to map arsenic-response networks. Genome Biol. 5: R95. Hausmann, S., S. Zheng, M. Costanzo, R. L. Brost, D. Garcin et al., 2008 Genetic and biochemical analysis of yeast and human cap trimethylguanosine synthase: functional overlap of 2,2,7trimethylguanosine caps, small nuclear ribonucleoprotein components, pre-mRNA splicing factors, and RNA decay pathways. J. Biol. Chem. 283: 31706–31718. Heinemeyer, W., A. Gruhler, V. Mo¨hrle, Y. Mahe´ and D. H. Wolf, 1993 PRE2, highly homologous to the human major histocompatibility complex-linked RING10 gene, codes for a yeast proteasome subunit necessary for chrymotryptic activity and degradation of ubiquitinated proteins. J. Biol. Chem. 268: 5115– 5120. Hiller, M. M., A. Finger, M. Schweiger and D. H. Wolf, 1996 ER degradation of a misfolded luminal protein by the cytosolic ubiquitin-proteasome pathway. Science 273: 1725–1728. Jelinsky, S. A., P. Estep, G. M. Church and L. D. Samson, 2000 Regulatory networks revealed by transcriptional profiling of damaged Saccharomyces cerevisiae cells: Rpn4 links base excision repair with proteasomes. Mol. Cell. Biol. 20: 8157–8167. Johnson, E. S., P. C. Ma, I. M. Ota and A. Varshavsky, 1995 A proteolytic pathway that recognizes ubiquitin as a degradation signal. J. Biol. Chem. 270: 17442–17456. Ju, D., and Y. Xie, 2004 Proteasomal degradation of RPN4 via two distinct mechanisms: ubiquitin-dependent and -independent. J. Biol. Chem. 279: 23851–23854. Ju, D., and Y. Xie, 2006 Identification of the preferential ubiquitination site and ubiquitin-dependent degradation signal of Rpn4. J. Biol. Chem. 281: 10657–10662.

342

X. Wang et al.

Ju, D., L. Wang, X. Mao and Y. Xie, 2004 Homeostatic regulation of the proteasome via an Rpn4-dependent feedback circuit. Biochem. Biophys. Res. Commun. 321: 51–57. Ju, D., H. Xu, X. Wang and Y. Xie, 2007 Ubiquitin-mediated degradation of Rpn4 is controlled by a phosphorylation-dependent ubiquitylation signal. Biochim. Biophys. Acta 1773: 1672–1680. Ju, D., X. Wang, H. Xu and Y. Xie, 2008 Genome-wide analysis identifies MYND-domain protein Mub1 as an essential factor for Rpn4 ubiquitylation. Mol. Cell. Biol. 28: 1404–1412. London, M., B. I. Keck, P. C. Ramos and R. J. Dohmen, 2004 Regulatory mechanisms controlling biogenesis of ubiquitin and the proteasome. FEBS Lett. 567: 259–264. Lundgren, J., P. Masson, C. A. Realini and P. Young, 2003 Use of RNA interference and complementation to study the function of the Drosophila and human 26S proteasome subunit S13. Mol. Cell. Biol. 23: 5320–5330. Mannhaupt, G., R. Schnall, V. Karpov, I. Vetter and H. Feldmann, 1999 Rpn4p acts as a transcription factor by binding to PACE, a nonamer box found upstream of 26S proteasomal and other genes in yeast. FEBS Lett. 450: 27–34. McClellan, A. J., M. D. Scott and J. Frydman, 2005 Folding and quality control of the VHL tumor suppressor proceed through distinct chaperone pathways. Cell 121: 739–748. Meiners, S., D. Heyken, A. Weller, A. Ludwig, K. Stangl et al., 2003 Inhibition of proteasome activity induces concerted expression of proteasome genes and de novo formation of mammalian proteasomes. J. Biol. Chem. 278: 21517–21525. Metzger, M. B., and S. Michaelis, 2009 Analysis of quality control substrates in distinct cellular compartments reveals a unique role for Rpn4p in tolerating misfolded membrane proteins. Mol. Biol. Cell 20: 1006–1019. Nelson, M. K., T. Kurihara and P. A. Silver, 1993 Extragenic suppressors of mutations in the cytoplasmic C terminus of SEC63 define five genes in Saccharomyces cerevisiae. Genetics 134: 159–173. Ng, D. T. W., E. D. Spear and P. Walter, 2000 The unfolded protein response regulates multiple aspects of secretory and mem-

brane protein biogenesis and endoplasmic reticulum quality control. J. Cell Biol. 150: 77–88. Owsianik, G., E. Balzi and M. Ghislain, 2002 Control of 26S proteasome expression by transcription factors regulating multidrug resistance in Saccharomyces cerevisiae. Mol. Microbiol. 43: 1295– 1308. Salin, H., V. Fardeau, E. Piccini, G. Lelandais, V. Tanty et al., 2008 Structure and properties of transcriptional networks driving selenite stress response in yeasts. BMC Genomics 9: 333. Schmitt, M. E., T. A. Brown and B. L. Trumpower, 1990 A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 18: 3091–3092. Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19–27. Teixeira, M. C., P. J. Dias, T. Simo ˜es and I. Sa´-Correia, 2008 Yeast adaptation to mancozeb involves the up-regulation of FLR1 under the coordinate control of Yap1, Rpn4, Pdr3, and Yrr1. Biochem. Biophys. Res. Commun. 367: 249–255. Wang, L., X. Mao, D. Ju and Y. Xie, 2004 Rpn4 is a physiological substrate of the Ubr2 ubiquitin ligase. J. Biol. Chem. 279: 55218–55223. Wang, X., H. Xu, D. Ju and Y. Xie, 2008 Disruption of Rpn4-induced proteasome expression in Saccharomyces cerevisiae reduces cell viability under stressed conditions. Genetics 180: 1945–1953. Wo´jcik, C., and G. N. DeMartino, 2002 Analysis of Drosophila 26 S proteasome using RNA interference. J. Biol. Chem. 277: 6188– 6197. Xie, Y., and A. Varshavsky, 2001 RPN4 is a ligand, substrate, and transcriptional regulator of the 26S proteasome: a negative feedback circuit. Proc. Natl. Acad. Sci. USA 98: 3056–3061. Xu, H., D. Ju, T. Jarois and Y. Xie, 2008 Diminished feedback regulation of proteasome expression and resistance to proteasome inhibitors in breast cancer cells. Breast Cancer Res. Treat. 107: 267–274. Communicating editor: A. P. Mitchell

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.112227/DC1

Proteasomal Degradation of Rpn4 in Saccharomyces cerevisiae Is Critical for Cell Viability Under Stressed Conditions Xiaogang Wang, Haiming Xu, Seung-Wook Ha, Donghong Ju and Youming Xie

Copyright © 2009 by the Genetics Society of America DOI: 10.1534/genetics.109.112227

2 SI

X. Wang et al.

FIGURE S1.—Induction of VHL-L158P expression by galactose. Plasmid expressing N-terminally His6-tagged VHLL158P from the GAL1 promoter was transformed into RPN4 (lanes 3, 4) and RPN4* (lanes 5, 6) strains. As a control, an empty vector was transformed into RPN4 strain (lanes 1, 2). Overnight cultures of the transformants were diluted into either glucose medium (lanes 1, 3, 5) or galactose medium (lanes 2, 4, 6) and continued to grow for 6 h. Cell extracts were prepared and subjected to immunoblotting analysis with an anti-His antibody. The membrane was subsequently stained with Coomassie blue to evaluate the loading.