© 2013 John Wiley & Sons A/S.
Pediatr Transplantation 2013
Pediatric Transplantation DOI: 10.1111/petr.12133
Protection against hyperoxia-induced lung fibrosis by KGF-induced MSCs mobilization in neonatal rats Yao L, Liu C-j, Luo Q, Gong M, Chen J, Wang L-J, Huang Y, Jiang X, Xu F, Li T-Y, Shu C. Protection against hyperoxia-induced lung fibrosis by KGF-induced MSCs mobilization in neonatal rats. Abstract: MSCs have been shown to improve functional and pathological outcome in lung fibrosis. However, low in vivo cell engraftment of the transplanted cells limits their overall effectiveness. KGF (also known as FGF-7) is a critical mediator of pulmonary epithelial repair through stimulation of epithelial cell proliferation. However, the role of KGF in MSCs and its therapeutic effects have not been identified. In this study, we investigated the effect of KGF on MSCs and its preventive role in hyperoxia-induced fibrosis in neonatal rats. Neonatal rats exposed to normoxia or hyperoxia were randomly assigned to receive intraperitoneal injections of normal saline (PL), MSCs, or KGF pretreated MSCs on the fourth day of exposure. Our results showed that as compared to PL, while MSCs attenuated lung fibrosis, KGF pretreated MSCs exhibited enhanced preventive effect against lung fibrosis. This effect was partly attributed to enhanced mobilization of MSCs to the fibrotic lungs. In addition, the SHH signaling pathway, which is associated with the differentiation of stem cells was activated by KGF. Our data suggest that MSCs, especially KGF preconditioned MSCs, can attenuate lung fibrosis and KGF may regulate the MSCs behavior by activating SHH pathway.
Lan Yao1,2*, Cheng-jun Liu1,2*, Qing Luo2,3, Min Gong2,4, Jie Chen2,4, Li-Jia Wang2,5, Ying Huang2,5, Xiaohua Jiang6, Feng Xu1,2, Ting-Yu Li2,4 and Chang Shu2,5 1
Department of Intensive Care Unit, Children’s Hospital of Chongqing Medical University, Chongqing, China, 2Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Center for Child Development and Disorders, Chongqing Medical University, Chongqing, China, 3Surgical Oncology, Children’s Hospital of Chongqing Medical University, Chongqing, China, 4Children Health, Children’s Hospital of Chongqing Medical University, Chongqing, China, 5Respiratory Medicine, Children’s Hospital of Chongqing Medical University, Chongqing, China, 6Epithelial Cell Biology Research Center, School of Biomedical Sciences, Faculty of Medicine, the Chinese University of Hong Kong, Hong Kong, China Key words: hyperoxia – lung fibrosis – KGF – MSC – SHH Chang Shu, MD, Department of respiratory medicine, Children’s Hospital of Chongqing Medical University, No136, Zhongshan 2nd Road, Yu Zhong District, Chongqing, 86 400014, China Tel.: 13637936537 Fax: 86-23-63622874 E-mail:
[email protected] *These authors contributed equally to this work. Accepted for publication 7 September 2013
BPD is one of the most serious birth complications affecting neonates and infants, which has long-term respiratory consequences that extend beyond childhood, and results in increased Abbreviations: BPD, bronchopulmonary dysplasia; BMMSCs, bone marrow-derived mesenchymal stem cells; cDNA, complementary DNA; ECM, extracellular matrix; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; KGF, keratinocyte growth factor; MSCs, mesenchymal stem cells; PBS, phosphate-buffered saline; SHH, sonic hedgehog; SD, Sprague–Dawley; SMO, smoothened.
healthcare costs (1). Exposure to hyperoxia, prolonged mechanical ventilation, and pulmonary inflammation are primary risk factors for the development of BPD (2, 3). Some of the pathologic manifestations of BPD are disrupted alveolar development and variable degree of fibrosis. The fibrosis has been considered as an abnormal repair process of lung injury, which is characterized by the extreme proliferation of myofibroblasts and redundant deposit of collagen (4–6), leading to an irreversible damage of lung. Current therapeutic intervention strategies 1
Yao et al.
for neonatal or infants with BPD are still limited and predominantly focused on the reduction in inflammation and lung congestion during intensive supportive care in the hospital, and followed by continued oxygen and nutritional therapy at home. Over the past decade, stem cell-based therapy has been emerging as a novel approach in the treatment of lung fibrosis, which aims to replace dead or damaged alveolar epithelial cells and provide environmental enrichment to support host regenerative process by producing trophic factors, thereby beneficial for functional recovery (7, 8). While various stem and progenitor cell populations have improved outcomes in animal lung fibrosis models (9–11), MSCs have been most extensively used as therapeutic agents in lung fibrosis management, as they are easily obtained and can be expanded rapidly ex vivo for autologous transplantation. Of great promise, the first studies using MSCs in clinical trials for fibrotic lung diseases are underway (12). KGF, which is also known as fibroblast growth factor (FGF)-7, belongs to the family of FGFs consisting of 22 polypeptide growth factors (13). KGF is produced by cells of mesenchymal origin and acts exclusively through a subset of FGF receptor isoforms (FGFR2b) that are expressed primarily in epithelial cells (14). The restricted pattern of FGFR2b expression and the high specificity of KGF for FGFR2b support the notion that KGF functions as a paracrine signal that mediates mesenchymal–epithelial communication (15, 16). Interestingly, it has been reported recently that KGF can promote epithelial differentiation from MSCs in vitro (17), suggesting that KGF might have some autocrine effects on MSCs themselves. Based on these findings, we hypothesize that KGF might enhance the therapeutic efficacy of MSCs in the treatment of lung fibrosis through either autocrine or paracrine effects. To test this, we exposed neonatal rats to high-concentration oxygen to make lung fibrosis model, and KGF pretreated MSCs were transplanted to the rats by intraperitoneal injection. Our data suggest that KGF has a role in the mobilization of MSCs to the injured lung, leading to the attenuation of lung injury and fibrosis. Materials and methods
supplemented with 10% fetal bovine serum (FBS; Gibco), 100 units/mL penicillin, 100 mg/mL streptomycin, and maintained at 37°C in a humidified incubator containing 5% CO2. MSCs were passaged at 80–90% confluence using 0.25% trypsin (Invitrogen, CA, USA) solution according to standard protocols. MSCs at passage 4–7 were used for flow cytometry and subsequent transplantation experiments. MSCs at passage 4–7 were exposed to 10 ng/mL KGF (QED Bioscience Inc, CA, USA) in 5 mL of medium for 24 h in 25 cm2 cell culture flask. Then, MSCs with or without KGF pretreatment were collected in PBS and prepared to transplant.
Flow cytometry Cultured cells were trypsinized and resuspended in PBS containing 1% bovine serum albumin (BSA). Cell suspensions were incubated with different antibodies including CD29-FITC (BD Biosciences, NJ, USA), CD11b-PE (BD Biosciences), CD31-PE (BD Biosciences), and CD90-PE (Biolegend, CA, USA) at recommended dilution for 30 min at room temperature in dark. After washed with PBS twice, labeled cells were analyzed by FACSC-anto IIsystem (BD Biosciences) and quantified using CellQuest Pro software (BD Biosciences).
Animal care and treatment Adult and female neonatal SD rats were maintained in humidity- and temperature-controlled specific pathogen-free rooms on a 12:12 h light–dark cycle and were allowed food and water ad libitum. For experiments, the 1-day-old neonates were exposed to either normoxia (21% O2) or hyperoxia (95% O2) condition. Continuous 95% O2 exposure was achieved in the chamber by a flow-through system. The concentration of O2 in the chamber was detected by the oxygen analyzer and adjusted the oxygen flow meter to make sure that the concentration of O2 ≥ 95%. Chambers were opened to nursing dams at 9 am every day for nursing purposes. After 72 h of exposure, the pups were randomly assigned to receive intraperitoneal injections of normal saline (PL), MSCs (8 9 105), or KGF-MSCs (8 9 105). At the 14 d of cell transplantation, the rats were anesthetized by 10% chloral hydrate intraperitoneal injections and lung tissues were excised. The left lung tissues were fixed by 4% paraformaldehyde, and the right lung tissues were collected and kept at -80°C. The experimental protocol was performed according to guidelines set forth by the Chongqing Medical University Animal Care and Use Committee (Chongqing, China).
Morphological analysis The fixed lung was embedded in paraffin, sectioned at 5 lm thickness. For the quantitative analysis of the fibrotic changes induced by hyperoxia, the Masson staining was used. Six fields within each lung section were observed at a magnification of 9400, and the total staining areas and densities were analyzed in a blinded fashion by NISElements BR 3.2 Image analysis software.
Isolation and expansion of rat BM-MSCs Rat BM-MSCs were isolated from male SD 8-wk-old rats as previously described (18). MSCs were grown in Dulbecco’s modified Eagle’s minimal essential medium/Ham’s nutrient mixture F12 (DMEM/F12; Gibco, CA, USA)
2
Hydroxyproline assay Hydroxyproline content in whole rat lungs was used to quantify lung collagen content and was measured by basic hydrolysis method (KeyGEN Biotech Co Ltd., Nanjing,
KGF promotes the protective effect of MSCs Table 1. The sequence of primers used for RT-PCR
Results
Gene
Forward
Reverse
bp
Isolation and identification of rat BM-MSCs
SRY KGFR2b SMO GLI1 PTCH GAPDH
CCATGTCAAGCGCCCATGAA GGGCTGGGCATCACTA TTTGCCGAGCAGATGGCACCA AAGGACCTTGCGTTGCGGCT AAAACCCCGTCTTTGCCCGGTC GCAAGTTCAACGGCACAGTCA
GGCTTCTGTAAGGCTTTTCCACT TCGCATCGGAGGCTAT AGTGACCACGTGAGCAGGTGGA ATGCTGCTGGAGCTGCTGCT TACAAAGCGTCTCTGCGCGG TCACCCCATTTGATGTTAGCG
104 243 178 159 171 106
Primary BM-MSCs were isolated from 8-wk-old male SD rats and propagated in vitro successfully. MSCs adhered to the surface of plastic culture dishes and exhibited a spindle-shaped fibroblast-like morphology as cells approached confluence (Fig. 1a). Although there is no specific marker, it is generally agreed that rat BM-MSCs are positive for CD29, CD90 but negative for CD11b and CD31. MSCs at passage 4 were characterized by flow cytometry for the expression of these cell surface markers. As expected, more than 99% of the cells were CD29 and CD90 positive (Fig. 1b and d), whereas the vast majority of cells were CD11b and CD31 negative (Fig. 1b and c). These results were consistent with our previous study (18), confirming the high purity of BM-MSCs.
China). At the time of killing, the extrapulmonary airways and blood vessels were excised and discarded. 100-mg lung parenchyma was cut into 10-mg pieces and 1 mL basic hydrolysates added. Then, the samples were hydrolyzed at 100°C for 20 min. Absorbance was measured at 550 nm, and the hydroxyproline content was calculated. Results were expressed as micrograms of hydroxyproline per gram of lung wet weight.
Real-time PCR Total DNA samples were isolated from female lung tissue using DNA extraction kits (BioTeke Co Ltd., Beijing, China). Total RNA samples were isolated from MSCs using the TRIzol reagent (Tiangen Biotech Co Ltd., Beijing, China). cDNA was synthesized by reverse transcription according to the manufacturer’s instructions (Takara Co Ltd., Dalian, China). The expression of sex-determining region of Y-chromosome (SRY) in the female recipient rat and expression of SMO, PTCH1, and GLI1 were further detected by PCR amplification. PCR amplification was performed as the following condition: 94°C for 1 min, 60°C for 1 min, and at 72°C for 1 min. The primers used in this study were listed in Table 1. All PCR products were size-fractionated by a 1.5% agarose gel electrophoresis, and DNA bands were visualized by staining the gel with ethidium bromide. GAPDH was used as a housekeeping gene control.
Statistical analysis The results are expressed as the mean standard deviation (s.d.). The differences among experimental groups were analyzed by one-way analysis of variance (ANOVA). Variance between groups was determined using LSD and Student– Newman–Keuls post hoc test.
(a)
(b)
KGF enhances the preventive effect of MSCs on hyperoxiainduced lung fibrosis
To study the potential effect of KGF on MSCsbased treatment in neonatal lung fibrosis, a hyperoxia-induced lung fibrosis model was established to mimic the development of lung fibrosis in neonates. Exposure of newborn rodents to hyperoxia has been useful in the study of the effects of oxidant-induced inflammatory responses in lung. In consistence with the previous reports, we observed marked expansion of lung interstitial area in the hyperoxia-treated lungs 14 days after treatment (Fig. 2d vs. a), which might be due to accumulated fibroblastic cells and ECM deposition, as demonstrated by Masson’s trichrome staining. Interestingly, while MSCs treatment significantly decreased Masson’s trichrome staining in the fibrotic lungs, pretreatment with KGF greatly enhanced the alleviation of ECM
(c)
(d)
Fig. 1. Morphology and identification of rat primary mesenchymal stem cells. a: morphology of rat primary MSCs at passage 4 (Scale Bar = 100 lm). b–d: primary MSCs (passage 4) were analyzed by FACS to detect the expression of mesenchymal surface markers using monoclonal antibodies. b: CD29-fluorescein isothiocyanate (FITC) labeled; CD11b-phycoerythrin (PE) labeled; c: CD31-PE labeled; D: CD90-PE labeled.
3
Yao et al. (a)
(b)
(c)
(d)
(e)
(f)
(g)
(h)
(i)
Fig. 2. MCS prevents the increase in pulmonary fibrosis and pretreatment with KGF further attenuates this response. a–f: Masson’s trichrome staining of lung sections (9400). a: air 14 d+PBS, b: air 14 d+MSCs, c: air 14 d+MSCs+KGF, d: hyperoxia 14 d+PBS, e: hyperoxia 14 d+MSCs f: hyperoxia 14 d+MSCs+ KGF. f–h: The total staining area (g) and density (h) analysis of Masson’s trichrome staining. Values are shown as the mean s.d., n = 6. *p < 0.05. i: Collagen content of lung tissue as determined by hydroxyproline assay. Values are shown as the mean s.d., n = 6. *p < 0.05.
Fig. 3. SRY gene expression in lung tissue. 1: hyperoxia 14 d+MSCs, 2: hyperoxia 14 d+MSCs+KGF, 3: air 14 d+MSCs, 4: air 14 d+MSCs, 5: positive control, and 6: negative control. Values are shown as the mean s.d., n = 3. *p < 0.05 vs. air 14 d+MSCs, **p < 0.05 vs. hyperoxia 14 d+MSCs
deposition (Fig. 2g and h). This result was further confirmed by the hydroxyproline measurement in the injured lung tissues with or without MSCs treatment. As shown in Fig. 2i, the content of hydroxyproline was significantly 4
increased after hyperoxia exposure. KGF pretreated MSCs significantly abrogated increased hydroxyproline in the hyperoxia-treated lungs (630.32 88.53 vs. 875.26 181.34 lg/g). Taken together, these results clearly demonstrate
KGF promotes the protective effect of MSCs
increased the expression of SRY in hyperoxiatreated lungs. These results indicate that KGF can mobilize MSCs to the hyperoxia-injured lungs. MSCs express KGF receptor: FGFR2b
Fig. 4. KGF receptor FGFR2b is expressed in MSCs. MSCs and KGF pretreated MSCs were extracted for RNA and examined for the expression of FGFR2b. There were strong expression of KGFR2b mRNA in MSCs and KGF pretreated MSCs. 1: MSCs 2: KGF pretreated MSCs.
that while MSCs transplantation alleviates the development of hyperoxia-induced lung fibrosis in neonatal rats, KGF pretreatment of MSCs further decreases fibrosis. KGF mobilizes MSCs to hyperoxia-injured lungs
To further attest the engraftment of MSCs and discern the donor MSCs from the recipient animals, we transplanted MSCs with or without KGF treatment from male bone marrow into the female SD rats. Subsequently, the expression of SRY was detected in the lung tissues of female rats in air groups or hyperoxia groups, which received MSCs or KGF pretreated MSCs. As shown in Fig. 3, the SRY gene expression was barely detected in normal lung (lane 3 and 4). However, hyperoxia (lane 1) or KGF (lane 2) increased the expression of SRY in the lungs. Significantly, KGF treatment markedly
FGFR2b is the specific receptor of KGF and is mainly expressed on epithelial cells (19). While it has been reported that KGF has effects on MSCs differentiation, there is no report to show the existence of KGF receptor in MSCs. Therefore, we examined the expression of FGFR2b mRNA in MSCs and KGF stimulated MSCs by RT-PCR. We found that FGFR2b mRNA is strongly expressed in MSCs and KGF pretreated MSCs (Fig. 4). SHH signaling pathway is upregulated in KGF pretreated MSCs
SHH signaling pathway is closely associated with stem cell fate determination. Recently, it has been reported that SHH pathway plays important role in MSCs differentiation (20, 21). To examine the mechanisms underlying the effect of KGF on MSCs, we determined the expression of the members of SHH signaling pathway in the MSCs and KGF pretreated MSCs. MSCs were treated with 1 ng/mL, 10 ng/mL, or 50 ng/mL KGF for 24 h. Our results showed that 10 ng/mL significantly upregulated SMO, PATCH1, and GLI1 mRNA expressions in MSCs, which suggest that KGF stimulates the SHH signaling pathway in MSCs.
(a)
(b)
Fig. 5. Upregulation of SHH signal pathway in KGF pretreated MSCs. MSCs were treated with different concentration of KGF for 24 h, and then the expression were examined by RT-PCR in control and KGF-treated MSCs. a: The gel image showing 10 ng/lL KGF significantly increased the expression of SMO, PTCH1, and GL1. 1:KGF pretreated MSCs, 2: MSCs. b: The quantification of PCR data showing the upregulation of SMO, PTCH1, and GLI1. Values are shown as the mean s.d., n = 3. *p < 0.05 vs. MSCs, **p < 0.01 vs. MSCs.
5
Yao et al. Discussion
MSCs have generated great interest as a potential source of cells for cell-based therapeutic strategies (22, 23). For lung injury, several experimental studies have demonstrated that exogenous stem cells can home to and/or participate in the regeneration and rebuilding of damaged lung tissue (23, 24). Despite the promise, the mechanisms of stem cell recruitment to sites of injury and of stem cell involvement in lung tissue repair, regeneration, and remodeling of the airway structure remain largely unknown. In terms of cell therapy approaches for BPD, several recent reports have demonstrated therapeutic benefits with different stem cell types in rodent models of oxygen-induced lung injury (25, 26). For instance, it has been shown that intraperitoneal and intratracheal delivery of MSCs prevents alveolar growth arrest and alleviates fibrotic changes in the lungs (27). Indeed, these results were achieved despite a small degree of MSCs engraftment in lung tissue, suggesting a role of paracrine mechanisms in modulating the inflammatory and fibrogenic processes. However, there are also reports indicating the potential harmful effects of MSCs, as MSCs can also differentiate into fibroblasts in vivo (28, 29). In this study, we have clearly shown that intraperitoneal delivery of BMMSCs decreases the severity of hyperoxiainduced lung fibrosis in neonatal rats. Of note, we transplanted MSCs 3 days after hyperoxia induction, which may emphasize the importance of early intervention with stem cells. KGF is a kind of soluble growth factor mainly secreted by mesenchymal cells, with its receptor mainly expressed in epithelial cells. Thus, the paracrine effects of KGF on epithelial cell proliferation, survival, and differentiation have been well characterized (30). However, the autocrine effects of KGF on MSCs have not been studied. In the present study, we have found that pretreatment of KGF significantly enhances the preventive effects of MSCs on hyperoxia-induced lung fibrosis. This is consistent with the previous report showing that MSCs overexpressing KGF via an inducible lentivirus protects against bleomycin-induced pulmonary fibrosis (31). Using sex gene mismatching technique, we have demonstrated, for the first time, that KGF enhances the stem cell recruitment into injured lungs (Fig. 3). This finding is highly relevant to clinical application, since low cell engraftment is the major hurdle currently faced by the stem cell-based therapy. The mobilization effect of KGF has the potential to greatly 6
enlarge the number of injury targeting MSCs, and therefore enhance their protective effects. The migratory capability of MSCs toward injury is largely attributed to its inherent expression of large amount of receptors for cytokines, chemokines, and growth factors secreted by the local injured environment. Interestingly, we have found that MSCs expresses KGF receptor FGF2b mRNA. We speculate that the enhanced mobilization of MSCs is due to the autocrine effect of KGF, which leads to enhanced migration of MSCs. Another interesting finding from our study is that KGF induces SHH-mediated pathway in MSCs (Fig. 5). We have found the mRNA expression levels of SMO, patched (PTCH1) and GLI1 are significantly increased after KGF treatment in MSCs. SHH signaling pathway is critical in the regulation of human embryonic development. Recently, SHH has been implicated in the control of stem cell self-renewal and differentiation including MSCs (32–35). The finding that KGF significantly upregulates the SHH signaling pathway in MSCs emphasizes the notion that KGF can regulate MSCs phenotype through autocrine mechanism. In addition to the demonstrated enhanced cell engraftment, KGF may also propel local microenvironmental signals to better sustain active endeavors for damaged epithelial substitution. In fact, stimulation of endogenous repair mechanisms in injured lung has been suggested to be a novel and promising therapeutic application of MSCs despite their limited engraftment in vivo. This may be another protective strategy fleshed out in the present study in hyperoxia-induced lung fibrosis. In summary, our study may have several important implications: First, as compared to MSCs, KGF pretreated MSCs further attenuated hyperoxia-induced pulmonary fibrosis. Second, we have found MSCs express FGFR2b mRNA, the specific receptor of KGF, indicating KGF could have autocrine effects on MSCs. Third, the SHH signaling pathway of MSCs can be activated by KGF, which may contribute to the autocrine effects of KGF including enhanced mobilization. Taken together, our findings may lead to the development of therapeutic strategies toward BPD and possibly other lung injuryrelated diseases. Acknowledgments This work was supported by the Nature Science Foundation of China (No. of grant: 30700915). We are deeply grateful to Zhang Xiaoping, Zhao Li, Jiang Wei, and Li Yasha for their diligent assistance.
KGF promotes the protective effect of MSCs Disclosures No author has a financial interest or other potential conflict of interest related to subject matter or materials mentioned in the manuscript.
17.
18.
Authors’ contributions The concept/design, data collection, data analysis/interpretation, drafting the article, statistics, approval of the article, critical revision were carried out by Lan Yao, Chengjun Liu, Qing Luo, Jie Chen, Min Gong, Lijia Wang, Ying Huang, Xiaohua Jiang, Feng Xu, Tingyu Li, and Chang Shu.
19.
20.
References 1. MURPHY KE, HANNAH ME, WILLAN AR, et al. MACS Collaborative Group. Multiple courses of antenatal corticosteroids for preterm birth (MACS): A randomised controlled trial. Lancet 2008: 372: 2143–2151. 2. SPEER CP. Chorioamnionitis, postnatal factors and proinflammatory response in the pathogenetic sequence of bronchopulmonary dysplasia. Neonatology 2009: 95: 353–361. 3. RATNER V, SLINKO S, UTKINA-SOSUNOVA I, STARKOV A, POLIN RA, TEN VS. Hypoxic stress exacerbates hyperoxia-induced lung injury in a neonatal mouse model of bronchopulmonary dysplasia. Neonatology 2009: 95: 299–305. 4. DACIC S, YOUSEM SA. Histologic classification of idiopathic chronic interstitial pneumonias. Am J Respir Cell Mlo Biol 2003: 29(3 Suppl.): S5–S9. 5. GROSS TJ, HUNNINGHAKE GW. Idiopathic pulmonary fibrosis. N Engl J Med 2001: 345: 517–525. 6. NOBLE PW. Idiopathic pulmonary fibrosis: New insights into classification and pathogenesis usher in a new era in therapeutic approaches. Am J Respir Cell Mol Biol 2003: 3(Suppl): S27–S31. 7. XIAN W, MCKEON F. Adult stem cells underlying lung regeneration. Cell Cycle 2012: 11: 887–894. 8. STEWART DJ, MEI SH. Cell-based therapies for lung vascular diseases: Lessons for the future. Proc Am Thorac Soc 2011: 8: 535–540. 9. BANERJEE ER, LAFLAMME MA, PAPAYANNOPOULOU T, KAHN M, MURRY CE, HENDERSON WR Jr. Human embryonic stem cells differentiated to lung lineage-specific cells ameliorate pulmonary fibrosis in a xenograft transplant mouse model. PLoS ONE 2012: 7: e33165. 10. ZHANG X, WANG H, SHI Y, et al. Role of bone marrowderived mesenchymal stem cells in the prevention of hyperoxia-induced lung injury in newborn mice. Cell Biol Int 2012: 36: 589–594. 11. PRATAMA G, VAGHJIANI V, TEE JY, et al. Changes in culture expanded human amniotic epithelial cells: Implications for potential therapeutic applications. PLoS ONE 2011: 6: e26136. 12. TZOUVELEKIS A, KOLIAKOS G, NTOLIOS P, et al. Stem cell therapy for idiopathic pulmonary fibrosis: A protocol proposal. J Transl Med 2011: 9: 182. 13. ORNITZ DM, ITOH N. Fibroblast growth factors. Genome Biol 2001: 2: REVIEWS3005. 14. FINCH PW, RUBIN JS, MIKI T, RON D, AARONSON SA. Human KGF is FGF-related with properties of a paracrine effector of epithelial cell growth. Science 1989: 245: 752–755. 15. MIKI T, FLEMING TP, BOTTARO DP, RUBIN JS, RON D, AARONSON SA. Expression cDNA cloning of the KGF receptor by creation of a transforming autocrine loop. Science 1991: 251: 72–75. 16. FINCH PW, RUBIN JS. Keratinocyte growth factor/fibroblast growth factor 7, a homeostatic factor with therapeutic
21.
22. 23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33. 34. 35.
potential for epithelial protection and repair. Adv Cancer Res 2004: 91: 69–136. LI H, XU Y, FU Q, LI C. Effects of multiple agents on epithelial differentiation of rabbit adipose-derived stem cells in 3D culture. Tissue Eng Part A 2012: 18: 1760–1770. SHU C, LI TY, TSANG LL, et al. Differentiation of adult rat bone marrow stem cells into epithelial progenitor cells in culture. Cell Biol Int 2006: 30: 823–828. FINCH PW, CUNHA GR, RUBIN JS, WONG J, RON D. Pattern of keratinocyte growth factor and keratinocyte growth factor receptor expression during mouse fetal development suggests a role in mediating morphogenetic mesenchymal epithelial interactions. Dev Dyn 1995: 203: 223–240. KIM WK, MELITON V, BOURQUARD N, HAHN TJ, PARHAMI F. Hedgehog signaling and osteogenic differentiation in multipotent bone marrow stromal cells are inhibited by oxidative stress. J Cell Biochem 2010: 111: 1199–1209. TRZASKA KA, RAMESHWAR P. Dopaminergic neuronal differentiation protocol for human mesenchymal stem cells. Methods Mol Biol 2011: 698: 295–303. LE BLANC K, PITTENGER M. Mesenchymal stem cells: Progress toward promise. Cytotherapy 2005: 7: 36–45. ORTIZ LA, GAMBELLI F, MCBRIDE C, et al. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A 2003: 14: 8407–8411. ROJAS M, XU J, WOODS CR, et al. Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am J Respir Cell Mol Biol 2005: 33: 145–152. ASLAM M, BAVEJA R, LIANG OD, et al. Bone marrow stromal cells attenuate lung injury in a murine model of neonatal chronic lung disease. Am J Respir Crit Care Med 2009: 180: 1122–1130. VAN HAAFTEN T, BYRNE R, BONNET S, et al. Airway delivery of mesenchymal stem cells prevents arrested alveolar growth in neonatal lung injury in rats. Am J Respir Crit Care Med 2009: 180: 1131–1142. CHANG YS, OH W, CHOI SJ, et al. Human umbilical cord blood-derived mesenchymal stem cells attenuate hyperoxiainduced lung injury in neonatal rats. Cell Transplant 2009: 18: 869–886. HASHIMOTO N, JIN H, LIU T, CHENSUE SW, PHAN SH. Bone marrow-derived progenitor cells in pulmonary fibrosis. J Clin Invest 2004: 113: 243–252. POPOVA AP, BOZYK PD, GOLDSMITH AM, et al. Autocrine production of TGF-beta1 promotes myofibroblastic differentiation of neonatal lung mesenchymal stem cells. Am J Physiol Lung Cell Mol Physiol 2010: 298: L735–L743. XU J, WOODS CR, MORA AL, et al. Prevention of endotoxininduced systemic response by bone marrow-derived mesenchymal stem cells in mice. Am J Physiol Lung Cell Mol Physiol 2007: 293: L131–L141. AGUILAR S, SCOTTON CJ, MCNULTY K, et al. Bone marrow stem cells expressing keratinocyte growth factor via an inducible lentivirus protects against bleomycin-induced pulmonary fibrosis. PLoS ONE 2009: 4: e8013. ZONG X, CAI J, JIANG D, WANG W. Research progress on keratinocyte growth factor. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 2009: 23: 188–193. JACOB L, LUM L. Deconstructing the hedgehog pathway in development and disease. Science 2007: 318: 66–68. COHEN MM Jr. The hedgehog signaling network. Am J Med Genet 2003: 123A: 5–28. KIM WK, MELITON V, BOURQUARD N, HAHN TJ, PARHAMI F. Hedgehog signaling and osteogenic differentiation in multipotent bone marrow stromal cells are inhibited by oxidative stress. J Cell Biochem 2010: 111: 1199–1209.
7
