Protein Kinase C-independent Expression of Stromelysin by Platelet

Vol. 266, No. 33, Issue of November 25. pp. 22597-22602, 1991 Printed in U.S.A.

‘I‘HE J O l ! H N A L OF H I O L O G I C A L CHEMISTRY ‘k

1991 hy The American Society for Biochemistry and Molecular Biology, Inc

Protein Kinase C-independentExpression of Stromelysin by Platelet-derived Growth Factor, ras Oncogene, and Phosphatidylcholine-hydrolyzingPhospholipase C* (Received for publication, April 4,

1991)

Maria T. Diaz-MecoSB,Susan Quiiionesn, MariaM. MunicioS, LauraSanzzj, Dolores BernaljII, Esther Cabreroz, Juan SausII, and Jorge MoscatS**$$ From the $Medicina y Cirugia Experimental, Hospital General“Gregorio Mararion, ” Dr. Esquerdo 46, 28007 Madrid, Spain, the TlDepartment of Medicine, Uniuersity of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854, the IIInstituto de Investigaciones Citologicas, Amadeo de Saboya 4, 46010 Valencia, Spain, and the **Centra de Biologia Molecular, Consejo Superior de Inuestigaciones Cientificas-Universidad Autonoma de Madrid, Canto Hlanco 28049 Madrid, Spain

Changes in the expression of several genesplay critical roles in cell growth and tumor transformation. A number ofproteases are increased in some tumors, and the level of these enzymes correlates with the metastatic potential of several cancer cell lines. Stromelysin, with the widest substrate specificity, can degrade the extracellular matrix conferring metastatic potential totumor cells. The mechanisms whereby growth factors and oncogenes control the expression of stromelysin are beginning to be characterized. In the study shown here we also identify a region in the stromelysin promoter which is involved in the induction of stromelysin in response to platelet-derived growth factor,phosphatidylcholine-hydrolyzing phospholipase C, and ras oncogene. Our results are consistent withthe notion that platelet-derived growth factor/ phosphatidylcholine-hydrolyzing phospholipase C induces stromelysin gene expression through a phorbol myristate acetatelprotein kinase C-independent mechanism by acting through elements in the stromelysin promoter distinct from the 12-0-tetradecanoylphorbol-13-acetate-responsiveelement.

the level of these enzymes correlates with themetastatic potential of several cancer cell lines (13-15). Matrixdegradationrequirestheaction of these specific metalloproteinases. To date threemajor subclasses of metalloproteinases have been described exhibitingmatrix degrading activity: collagenases, gelatinases, and stromelysins. Collagenases cleave collagen types I, 11,111, VII, and X (16). Gelatinases degrade denatured collagen and collagen types IV, V, VII, and VI11 (17, 18). Stromelysins, with the widest substrate specificity, can degrade fibronectin, laminin, collagen IV, and diverseproteoglycans (19). The expression of stromelysin, or its rat homologue, transin, is subject to dual regulation. Enzyme synthesis is induced by interleukin-lp (20,21), phorbolesters (22, 23), growth factors(23),and oncogenes (24), whereas it is suppressed by dexamethasone (20, 21) or transforming growth fxtor-P (25). Therefore, the mechanisms whereby growth factors and oncogenes control the expression of stromelysin are beginning to be characterized. In this regard, considerable effol,t is being invested todefine critical steps and second messengersin mitogenic signaltransduction pathways (26-29). Recently we and others (30-36) have identified a novel required step in these cascades: activation by growth factors and oncogene products of a novel phospholipase C specific for phos:>hatidylcholine (PC-PLC)’ Cell growth and tumor transformation are associated with has been shown to be bothnecess wy and sufficient for mitocomplex changes in the expressionof several genes (1-3). At genic activation. It would be of interest to elucidate whether the first levels, the so-called nuclear proto-oncogenes (c-10s. PC-PLC activation, besides governing cell growth and tumor c-jun, c-myc; Refs. 4-9), play critical roles as tertiary messen- transformation, could also be in\,olved in the regulation of gers in the transcriptional regulation of a number of second- metalloproteinases, particularly stromelysin, and therefore be phase genes, which are apparently crucial to the maintenanceimplicated in the appearance of metastatic phenotypes. of the normal cell phenotype, as well as the degree of tumor Recently we have isolated cDNA aswell as genomic clones invasiveness (10, 11).When a tumor reaches the metastatic that cover the complete coding region for human stromelysin condition a dramatic imbalance in the equilibriumof synthe- (21). From that work (21) it was found by transient gene sis/degradation of the extracellular matrix is detected (12). expression assays that 1.3 kb of the stromelysin promoter Also a number of proteases are increased some in tumors, and region contains DNA elementsresponsible for interleukin-1P induction. In the study shown herewe further characterize a * This work was supported in partby Grant SAL90-0070 and PB87- region in the stromelysin promoter which is involved in the 0096 from Comision Interministerial de Ciencia y Tecnologia, Grant induction of stromelysin in re:,ponse toplatelet-derived 89-0406 from Fondo deInvestigciones Sanitarias, and Grant DK42614 from National Institutes of Health. The costsof publication of growth factor (PDGF), PC-PLC, andras oncogene. this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. I Fellow of the Ministerio de Educacibn. $$To whom correspondenceshouldbeaddressed Medicina y Cirugia Experimental, Hospital General “Gregorio Marafibn,” Calle Dr. Esquerdo 46, 28007 Madrid, Spain. Tel.: 1-586-8312; Fax: 1-5868018.

The abbreviations used are: PI-PLC, phosphoinositide-hydrolyzing phospholipase C; PC, phosphatidylcholine; PLC, phospholipase C; PC-PLC, phosphatidylcholine-hydrolyzing phospholipase C; PDGF, platelet-derivedgrowth factors; PKC, protein kinase C; PMA, phorbol myristate acetate; TRE, 12-0-tetradecanoylphorbol-13-acetate-responsive element; kb, kilobase pair(s); SDS, sodium dodecyl sulfate; hGH, human growth hormone; bp, base pair(s).

22597

Regulation Expression of Stromelysin

22598 MATERIALSANDMETHODS

branes (Amicon Corp., Lexington, MA). T h e enzyme was purified to complete homogeneity as confirmed by SDS-polyacrylamide gel electrophoresis followed by silver staining. The specific activity of the purified enzyme was1.5 units/pg (34). All chromatographic materials were from Pharmacia (Uppsala, Sweden).

Cell Culturc>s-Human fibroblasts prepared from explantsof infant as foreskin hy standard techniques were cultured and maintained descrihed (21) in Dulbecco's modified Eagle's medium supplemented with 10'6 (v/v) fetal bovine serum, penicillin (100 units/ml), streptomycin (100 pg/ml), and2 mM bglutamine in standard tissue culture RESULTS flasks in a humidified air/CO? (19:l) incubator at 37 "C. Cells were made quiescent by incubation for 24 h in the presence of serum-free PDGF, ras, and PC-PLC Activate Human Stromelysin (5 pg/ml) and Na.lSeO:c(1 medium supplemented with transferrin mRNA Induction-To examine the induction of stromelysin p ~ )ts-6-315 . cells grown a t 32 "C, displaying a transformed pheno3 days. mRNA by PDGF, primary cultures of human foreskin fibrotype, were shifted to the restrictive temperature (40.5 "C) for Hy this time, a completely flat morphology was observed (33), and blasts were made quiescent by serum starvation, after which t h e cells were made quiescent as described above. they were stimulated with human recombinant B-homodimer Northern Hybridization-Total RNA (10 p g ) , isolated from either PDGF. Total RNA was collected at the indicated times and control or stimulated cells, was run on formaldehyde-agarose gels, analyzed by Northern blot. Results from Fig. 1 indicate that blotted onto nitrocellulose filters, and hybridized overnight a t 68 "C PDGF significantly induced stromelysin mRNA. It has been with :"P-labeled human stromelysin cDNA probe in 5 X SSC, 5 X demonstrated previously that phorbol esters, like PMA, are Denhardt's, 0.5% SDS,and 0.1mg/mldenaturedsalmonsperm. Filters were washedat 68"C in0.1 X SSC, 0.1% SDS. Northern blots also effective activators of stromelysin mRNA likely through were normalized by hybridization with a 28 S rRNA oligonucleotide a TRE thatexists a t position -70 in the stromelysin promoter probe. (21, 25). Results from Fig. 1 confirm the ability of PMA to Plasmid Construction-Growth hormone expression vectors conpromote stromelysin mRNA induction in humanfibroblasts. tainingstromelysinpromoterfragments -1303 t o -11 (pHBGH), We have shown recently the activation and importanceof -754 to -11 (pARGH), and-53 to-11 (pSGH) have been described a novel signal transductionmechanismthat involves the previously (21). For the constructs in which regionsof the stromelysin a stimulation of a PC-PLC by growth factors, including PDGF promoter were cloned upstreamof the thymidine kinase promoter, modified form of pTKGH (37), named RLGH, that includes cloning (33,34,36). Therefore, was it of interest to determine whether wasused as the stimulation of this novel phospholipid degradative pathway sites for 5' HindIII-SphI-P.~tI-SalI-XbaI-Ra~HI, cloning vector. T o make pHATKGH, the-1303 to -754 fragment of may play any role in the regulation of stromelysin induction, pHRGH was excised by HindIII/Asp-718 digestion, after which the in addition to itsrelatively well characterized involvement in Hind111 end was ligated to HindIIIIXbaI-digested RLGH, and the WehavedemonAsp-718 and XbaI free ends were blunted and religated. pHSTKGH cell growth andtumourtransformation. was constructedby excising the-1303 to -53 fragment from pHBGH strated previously that exogenous addition of a permanently and cloning it into HindIII/RarnHI-digested BLGH. Similarly, muactivated extensively characterized PC-PLC from B. cereus tant stromelysin promoter lacking the T R E between -70 and -64 (40) is sufficient trigger to mitogenic signals (34,36).A similar and one with an inactivating mutation in the TRE (TGAGTCA to strategy was followed here to investigate the involvement of GGAGTCA)werereleasedfromtheirparentvectors(generously provided by Dr. Kurkinen, University of Medicine and Dentistry of PC hydrolysis in the signal transduction mechanisms conNew Jersey-Robert Wood Johnson Medical School, Piscataway,N J ) trolling stromelysin expression. Thus, we added 1 unit/ml of fibroblast cultures, by HindIII/Sau3A digestion and cloned into HindIII/RarnHI-digested B. cereus PC-PLC to quiescent human HLGH. Plasmids pl24HATKGH, pA63HATKGH, pll58HATKGH, and stromelysin mRNA levels were measured by Northern pl226HATKGH, pXMHATKGH, and pI332HATKGHwere conanalysis a t differenttimesthereafter.Results from Fig. 1 structed by polymerase chain reaction using the plasmid pHATKGH demonstrate that specific hydrolysis of PC (34) promotes a as thereactiontemplateandthefollowingprimers:ATGAAGCTTCAACCTCTCAAAGT and ATGAAGCTTACAAGGTACC- potent induction of stromelysin mRNA with a significantly greater potential than PDGF. Stimulation of PLC-mediated ATTG for pI24HATKGH, ATGAAGCTTAGGCACCTGGCCTAA degradation of PC has also been shown to occur in response a n d ATGAAGCTTCCAGGAAGAAACAGT forpA63HATKGH, ATGAAGCTTAGGGAAAATATTTG and ATGAAGCTTCCAGto transformation and mitotic activation by r a y oncogene (31, GAAGAAACAGTforpAl58HATKGH,ATGAAGCTTCCAGG33). Also it is noteworthy that recent evidence demonstrates AAGAAACAGTandATGAAGCTTACAAGGTACCATTGfor the criticalinvolvement of this oncogene product in mitogenic p.l226HATKGH, ATGAAGCTTATTGAGAGGTTAAA and signaling cascades activated by growthfactors (41). Therefore, ATGAAGCTTACAAGGTACCATTG for pA258HATKGH, and we next analyzed the ability of ras-mediated transformation ATGAAGCTTCTCTGGAGTTATandATGAAGCTTACAAGGTto activate stromelysin expression. To this aim we used a ACCATTG for pA332HATKGH. All the amplified fragments were subcloned into plasmid pTKGH, andall constructs were verified by fibroblast cell line (ts-6-315) transformedby a mutant of Kisequence analysis. ras which is sensitive to temperaturefor transformation (33, Transfection and Gene Expression Assa+ys-Human foreskin fibrocells/100-mmdishand blastswereseeded a t a density of 7 X Control Eagle's mediumsupplemented maintainedinDulbecco'smodified with10%fetalcalfserum.Twenty-fourhourslater,mediumwas control changed and cells were transfected, following a 4-h preincubation PC-PLC period with 40pg of total DNA (20p g of plasmid and 20 pg of carrier PMA calf thymus) in calcium phosphate for 16(38). h Afterwards, medium waschangedandcellsincubatedforanother 24 hinquiescent Control medium, after which different stimuli were added according to the pDGF Down-regulated experiments,andhumangrowthhormonelevelsweredetermined PC-Pu: using a solid-phaseradioimmunoassaysystem(NicholsInstitute) PMA following manufacture's instructions.T o provide an internal control of transfection efficacy, some experiments also included co-transfec(39). Chloramphenicolacetyltransferase tionwithRSVcatvector FIG. 1. Expression of stromelysinin human fibroblasts. as described previously (21). assays were performed on cell extracts Quiescent human fibroblasts either untreated or chronicallyincuIsolation of PC-I'IL'from Bacillus cereus- R. cereus PC-PLC was bated (24 h) with PMA (500 ng/ml) were stimulated with PDGF (10 purifiedfromculturesupernatants of H. cereusSE-1(34)using ng/ml), R. cereus PC-PLC ( 1 unit/ml), or PMA (100 ng/ml) for 12 h. IIEAE-Sepharose Fast Flow, phenyl-Sepharose CL-4€3, and chroma- Afterwards, total RNA was prepared and run in formaldehyde-agarose tofocusing on PHE 94 columns. Polyhuffers were removed by Seph- gels, blotted onto nitrocellulose filter, and hybridized to a human arose CL-4R chromatographyfollowed by dialysis. T h e enzyme prep- cDNA probe for stromelysin. Results are representative of other three experiments with similar results. arationwasconcentrated by ultrafiltrationonDiafloYM5mem-

] ]

22599

Regulation Expression of Stromelysin

35). This cell line displays atransformingphenotype at32 "C, whereas it assumesa flat morphology a t 40.5 "C. As shown in Fig. 2, ts-6-315 cells gave increased stromelysin mRNA levels when incubatedfor 12 h at thepermissive temperature. Therefore, all these results indicate that PDGF, PC-PLC, and ras [TRE] are potent inducersof stromelysin mRNA. Noninvolvement of PKC intheInduction of Stromelysin mRNA by PDGF, PC-PLC, or ras-The activation of PC hydrolysis by PDGF or by exogenous addition of B. cereus PC-PLC generates diacylglycerol which, like PMA, is theoretically a potent inducer of PKC (26). Therefore, it was of interest to evaluate whether PKC was or was not required for induction of stromelysin gene expression. Awidely used strat- 1383 I pHSTKGH egy to deplete cellular PKC levels consists of treating cell cultures chronicallywith PMA. This approach completely , - 1383 removes PKC from fibroblasts, which can be easily followed p6HSTKGH by Western blot with specific antibodies (34). Thus, we exposed quiescent human fibroblast cultures to PMA (500 ngl - 1383 ml) for 24 h after which PKC levels were completely depleted as corroborated by an enzymatic assay as well as Western FIG. 3. Partial restrictionmap of stromelysin promoter and blot (not shown). Induction of stromelysin mRNA was then gene constructsused in thetransient expression assays.A t the determined in these cells following theaddition of either top of the figure is the SstI-XbaI 2.1-kh fragment containing 1.3 kh PDGF, B. cereus PC-PLC,or PMA. Results from Fig. 1 of promoter sequence extending through the first exon (box) and into indicate that although PMA was unable toinduce stromelysin the second (half-box).The restriction sites used to obtain the different constructs are noted. In the constructsused in the different transient mRNA in cells with PKC down-regulated, PDGF and PCPLC promoted a potent response which was even higher than expression assays, the promoter elementsused to drive the hGH gene in cells with normal PKC levels. Consistent with the notion were derived from the SstI-Am1 (1293 nucleotides; -1303 to - l l ) , Asp-71R-A~aI(744; -754 to -ll), SUUB-AUUI(43; -53 to - l l ) , S ~ t l that ras oncogenes transduce its signals through PC-PLC (36) Asp-718(549; -1303 to -754), S S ~ I - S U(1250; U ~ -1303 to -53) are the results shown in Fig. 2. Thus, complete PKC down- fragments, as described under "Materials and Methods." regulation of ts-6-315 cells does not inhibit the abilityof raq to induce stromelysin mRNA. All these results strongly sug- results suggest the existence of regulatory element(s) in the gest that although PKCis capable of activating transcription stromelysinpromoter responsible for induction by PDGF, of stromelysin gene, probably through the TRE presentin its PC-PLC, and PMA. Endogenous hGH gene activity was not promoter (25), neither PDGF, PC-PLC, nor ras require PKC detectably affected by any of these three stimuli norwas the to induce stromelysin mRNA. This allows one to speculate expression of control plasmid p+GH which lacks promoter on the existence of distinct regulatory elements in the stro- sequences (not shown). From Fig. 4A it is also clear that PKC melysin promoter which may presumably be responsible for down-regulation severely impairsPMA induction of hGH PKC-independent transcriptional activation of this gene by production, whereas PDGF and PC-PLC actions were affected PDGF, PC-PLC, and ras. Therefore, the following experi- slightly or not atall. ments were carried out to test thishypothesis. In order to further delineate potential discrete regulatory Analysis of Stromelysin Promoterby Transient Gene Expres- elements in the stromelysin promoter for each one of these sion Assays-In order to further investigate the regulatory stimuli, different constructs harboring 5' sequential deletions mechanisms involved in the expression of stromelysin gene, (Fig. 3) were used in transient transfection assays. Results 1.3 kb of the stromelysin promoterregion was cloned into the from Fig. 4A demonstrate that deletion of 5' 549 bp of the p@GH reporter vector (pHBGH; Ref. X ) , and experiments stromelysin promoterleads to thecomplete loss of inducibility were carried out by using transient gene expression assays. by PDGF andB. cereus PC-PLC, whereas activation by PMA After transfection of human fibroblasts with this construct remained unaffected (plasmid pABGH). Furtherdeletions did (for a description of the different constructsused in this and the following experiments, see Fig. 3), they were stimulated not alter PMA inducibility, except when the 43-bp minimal either with PDGF, B. cereus PC-PLC, or PMA, according to promoter construct (-53 to -11; plasmid pSGH) (Fig. 3) was measurableinducibility was the protocol described under "Materials and Methods." Re- assayed. In that situation, no observed in response to PMA addition (Fig. 4). These results sults presented in Fig. 4A demonstrate that all three stimusuggest the existence of two types of regulatory elements in lants promoted a potent accumulation of human growth hormone (hGH) in cells transfected with plasmid pHBGH. Thesethe stromelysin promoter. One of them, that is responsive to PDGFandPC-PLC, is locatedbetween -1303 and -754 respective to the transcription startsite. The second element is situated between positions -754 and -53 and is responsible @ 32 s C Control for inducibility by PMA. In order to determine whether the 40 ' C 5' 549 bp were sufficient toconfer inducibility of stromelysin promoter to PDGF and PC-PLC, we cloned that fragment 32 ] Down-regulated into the pTKGH reporter vector upstream of a thymidine + 40 * C kinase minimal promoter (construct pHATKGH, Fig. 3). SynFIG. 2. Expression of stromelysin in ts-6-315 cells after thesis of hGH was assayed, thereafter, in response to PDGF, temperature shifting. Quiescent ts-6-315 cells kept at the restric- B. cereus PC-PLC, and PMA. Results from Fig. 4B demontive temperature (40.5 "C) were shifted to therestrictive temperature strate that promoter fragment -1303 to -754 was able to (32 "C) for 12 h, after which total RNA was isolated and analyzed as described in the legend to Fig. 1. Results are representative of other drive hGH synthesis in response to either PDGF orB. cereus PC-PLC, but not toPMA. This is consistent with the lack of three experiments with similar results.

9p3

L

'

3

Regulation Expression of Stromelysin

22600

sponsible for the inducibility of stromelysin by PDGF/PCPLC, the following plasmids were constructed. pA24HATKGH is a 5' deletion of 24 bp of plasmid pHATKGH. This deletionremoves TGATTCTC thatresembles TGACTC which has been shown to confer inducibility by ras to several genes (42).pA63HATKGH,pAl58HATKGH, pA226HATKGH, pA258HATKGH, and pA332HATKGH are further 5' deletions of pA24HATKGH (see Fig. 5). Results from Fig. 5 indicate that thelack of 5' 24 bp of the fragment extending from -1303 to -754 does not affect inducibility of PDGF/ PC-PLC.Therefore,the sequence TGATTCTCisnotinvolved in the induction of stromelysin by PDGF/PC-PLC. Fig. 5 also shows that deletion of the region extending from -1279 to -1240 respective to the transcription initiation site completely abolishes the abilityof PDGF/PC-PLC to induce stromelysin. Therefore an element located in this region is probably responsible for induction of stromelysin by PDGF/ PC-PLC.

" PHBCH

-

PABCH

pSGH

10

0

DISCUSSION

A number of independent reports (10-15) strongly support the notion that the synthesis/degradation equilibrium of the ~

"

PWTKGH

_

_

pKSTKGH

-1303 I

_ PAHSTKGH

asp118

Xb-I

-11

FIG. 4. Regulation of stromelysin promoter activity as evidenced by transientgene expression assays. A, 16h posttransfection with different plasmids (pHBGH, pABGH, pSGH; Fig. 3 ) , human foreskin fibroblasts were made quiescent and either untreated (filled bars) or incubated for 24 h with 500 ng/ml of PMA ( rmpty bars) to down-regulate PKC levels, as described under "Materials and Methods." Afterwards, different stimuli were added and hGHproduction was determinedinsupernatants following 48h incubationwithstimulants; B, plasmids pHATKGH, pHSTKGH, pAHSTKGH, and pmHSTKGH were transfected, different stimuli added, and productionof hGH levels determined as described above. Results are expressed as -fold stimulation over controls (cells incubated in parallel without stimuli) and are representative of other three experiments with identical results.

P-ER

SEQUENCE E-=

pDHSTlUiH

-754

-1-3

"--$t]

rn

1

-1nQ

1

*4mw

-l240

&$j

I

hM

I

e

I I

pAlS8lWlWQi

w

w

-1145

' L a

l a

m 1-

h M

-1

m

j.AZZ61vnKGH

-1845

1 "

P.258WKM

-071

3-1

T R E in this DNA fragment (seeFig. 3). Toverify that TRE (positions -70 to -64) is not required for induction of stromelysin by PDGFandPC-PLC,plasmidspHSTKGH, pAHSTKGH, and pmHSTKGH were constructed (Fig.3). The first one harbors the wild type fragment extending from -1303 to -53 from the stromelysin promoter linked to the thymidine kinase minimal promoter. The second and third constructsareidenticaltopHSTKGHbutwitheither a deletionthatentirely removes the TRE or with a point mutation which changes the sequencefrom TGAGTCA t o GGAGTCA in the TRE, respectively. Results from Fig. 4B demonstrate that the lack of T R E or the presence of inactivating mutations in that elementcompletely abolishes hGH induction by PMA; however, no detectable effect is observed in the response to PDGF or B. cereus PC-PLC. Taken to1) PMA/PKC signals gether all these results indicate that: leading to activation of stromelysin expression involve the T R E located at position -70 to -64 in the stromelysin promoter, 2) activation of stromelysin by PDGF/PC-PLC does not require either PKC or the presence of TRE in its promoter, and 3) an element located in the fragment encompassing the sequence -1303 to -754 of the stromelysin promoter is both necessary and sufficient to activate stromelysin transcription in response to PDGF/PC-PLC (see above) and to ras (not shown). All these data further support idea the that the transduction signals generated by PDGF/PC-PLC differ from those produced by PMA/PKC. To further characterize the region re-

p~332lWKM

k G 9 b k L C G k G 4 G 9 G

pQw 8,$Qv QdQ" 8QcQvQ#QcQw $Qv 8 Qv uuuuuuu Q

Q

S

a

a

.

a

.

a

!

.

S

. a

l

a

FIG. 5. Deletion analysis of the fragment extending from -1303 to -754 of the stromelysin promoter. Sixteen hours posttransfection with different plasmids (pHATKGH, pA24HATKGH, pA63HATKGH, pAl58HATKGH, pA226HATKGH, pA258HATKGH,andpA332HATKGH; see upper panel), human foreskin fibroblasts were made quiescent, after which different stimuli were added, and hGH production was determined in supernatants following 48-h incubation with the stimuli. Results are expressed as -fold stimulation over controls (cells incubated parallel without stimuli) and are representative of other three experiments with identical results.

Regulation Expression of Stromelysin

22601

extracellular matrixis a critical issue in the appearance of the appears to use that activating cascade. It is possible that growth factors channel stromelysin induction metastatic phenotypein tumor cells. In the study shown here different cell systems. we demonstrate that the activation of the extracellular matrix through distinct promoter elements in different In summary, the results shown here reveal that the region degradingproteinasewith widestspecificity, stromelysin, takes place in response to the mitogenic pathway controlled encompassing nucleotides -1279 to -1240 is critical for inby PDGFIPC-PLC/ras through a PKC-independent mecha- duction of stromelysin by PDGF/PC-PLC. Also, we demonnism. This route does not involve T R E which is responsible strate at a gene transcriptional level that the signalingmechforactivation by PMAbutdispensable for induction by anisms utilized by PDGF/PC-PLC differ fromthose triggered by PMA/PKC. The involvement of PMA-insensitive PKC PDGF/PC-PLC. Great effort is being invested by several groups t o identify isotypes in the transduction of signals generated following critical steps inmitogenic signal transduction pathways, par- activation of PC-PLC is an intriguingpossibility that deserves further investigation. ticularly, phospholipid degradation, which is potently activated following stimulation with growth factors (27, 32), is Acknowledgments-The technical assistance of M Jesus Sanchez the core of recent intenseresearch. Although most of the work has been focused on the phosphoinositide turnover (27), a is greatly appreciated. We thank Dr. Markku Kurkinen for the fullnumber of studies demonstrate the existence of phosphati- length stromelysin promoter mutants. dylinositide-independent signal transductioncascades involvREFERENCES ing the phosphodiesterase-mediatedhydrolysis of phosphati1. Lau, L. F., and Nathans, D. (1987) Proc. Natl. Acad. Sci. U. S. A . dylcholine (30-36). Recently, evidence has accumulatedshow84, 1182-1186 ingthatactivation of PLC-catalyzed hydrolysis of phos2. Holt, J. T., Gopal, T. V., Moulton, A. D., and Nienhius, A. W. phatidylcholine is sufficient to mimic a significant portion of (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 4794-4798 the PDGFmitogenic signal (34). PLC-mediated PC hydrolysis 3. Nishikura, K., and Murray, J. M. (1987) Mol. Cell. Biol. 7, 639has also been shown t o be stimulated by the product of ras 649 oncogene, rus p21 (31, 33, 36), whose role in mitogenic cas4. Kelly, K., Cochran, B. H., Stiles, C. D., and Leder, P. (1983) Cell 35,603-610 cades has been demonstrated (41, 43). More recent results in 5. Greenherg, M. E., and Zeef, E. B. (1984) Nature 311, 433-438 Xenopus oocytes show that PC-PLC activation is required for 6. Krujier, W., Cooper, J. A,, Hunter, T., and Verma, I. M. (1984) mitogenic signal transduction (36). Therefore, a11 these data Nature 312, 711-716 permit one to suggest that PC-PLC activation appears to be 7. Verma, I. M., and Sassone-Corsi, P. (1987) Cell 51, 513-514 critically involved in pathways controlling cell growth and 8. Curran, T., and Franza, B.R., Jr. (1988) Cell 55, 395-397 tumor transformation. Herewe show that PC-PLC activation 9. Rauscher, F. J., Cohen, D. R., Curran, T., Bos, T . J., Vogt, P. K., Bohmann, D., Tjian, R., and Franza, B. R. (1988) Science 240, is important for stromelysin induction. 1010-1016 Since PC hydrolysis generates diacylglycerol, a logical hypothesis should contemplate PKC as an important interme- 10. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imhra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987) Cell diary in the activation of stromelysin expression by PDGF/ 49, 729-739 PC-PLC. However, the results presented here clearly dem11. Schonthal, A., Herrlich,P.,Rahmsdorf,H.J.,andPonta, H. onstrate that PMA/PKC is not required for stromelysin in(1988) Cell 54, 325-334 duction in response t o these stimuli, which is in very good 12. Ostrowski, L. E., Finch, J., Krieg, P., Matrisian, L., Patskan, G., O'Connel, J. F., Phillips, J., Slaga, T . J., Breathnach, R., and agreement with the notion that this route is not necessary Bowden, G. T . (1988) Mol. Carcinog. 1, 13-19 either for activation of DNA synthesis in Swiss 3T3 fibro13. Goldfarh, R. H., and Liotta, L. A. (1986) Sernin. Thrornb. Heblasts (34) nor for oocyte maturation2 in response to PLCmostasis 12,294-307 mediated hydrolysis of PC. However, thecloning of new 14. Matrisian, L. M., Bowden, G. T., Krieg, P., Furstenherger, G., distantly related membersof the PKC family of isoenzymes, Briand, J. P., Leroy, P., and Breathnach, R. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 9413-9417 like z-PKC, have been reported recently (44, 45). A detailed 15. Basset, P., Bellocq, J . P., Wolf, C., Stoll, I., Hutin, P., Limacher, analysis of the biochemical properties of this PKC isotype J. M., Podhajcer, 0. L., Chenard, M. P., Rio, M. C., and reveals that it does not bind PMA, is not stimulated by this Chamhon, P. (1990) Nature 348, 699-704 pharmacological agent, and presumablywould be resistant to 16. Schmid, T . M., Mayne, R., Jeffrey, J. J., and Linsenmayer, T. F. down-regulation by phorbol esters (44, 45). Therefore, if a (1986) J. Bid. Chern. 261, 4184-4189 PKC is to be the target of PC-PLC-mediated mitogenic sig- 17. Hibhs, M. S., Hasty, K. A., Seyer, J. M., Kang, A. H.,and Mainardi, C. L. (1985) J . Biol. Chern. 260, 2493-2500 nals, this isotype appears to be a good candidate. In this regard, it is noteworthy that recent studies are beginning to 18. Murphy, G.,McAlpine, C. G., Poll, C. T., and Reynolds, J. J. (1985) Biochirn. Biophys. Acta 831, 49-58 characterize a PKC from yeast which, like z-PKC, is insen19. Okada, Y., Nagase, H., and Harris, E. D., Jr. (1986) J . Riol. Chem. sitivetoPMA.Geneticstudies with this enzyme strongly 261, 14245-14255 suggest that it may play a critical role in cell cycle control 20. Saus, J., Quinones, S., Otani, Y., Nagase, H., Harris, E. D., Jr., (46, 47). and Kurkinen, M. (1988) J. Biol. Chem. 263,6742-6745 21. Quinones, S., Saus, J., Otani, Y., Harris, E. D., Jr., and Kurkinen, Comparison of the stromelysin promoter sequences from M. (1989) J. Biol. Chem. 264,8339-8344 human (21), rabbit (48), and rat (14, 49) reveals a very high degree of sequence similarity between -400 and -1 base pair 22. Kerr, L. D., Holt, J. T., and Matrisian, L. M.(1988) Science 242, 1424-1427 position of the promoters. In this regard, it must be noted 23. McDonnel, S . E., Kerr, L. D., and Matrisian, L. M. (1990) Mol. that recent evidence indicates that the TRE present at -70 Cell. Biol. 10, 4284-4294 to -64 base pair position in the stromelysin promoter plays 24. Matrisian, L. M., Glaichenhaus, N., Gesnel, M. C., and Breathnach, R. (1985) EMBO J . 4, 1435 some role in the induction of rat stromelysin (transin) (22) by epidermal growth factor. Our results in human (this paper)25. Kerr, L. D., Miller, D. B., and Matrisian, L. M. (1990) Cell 61, 267-278 and Swiss 3T3 fibroblasts (not shown) clearly indicate that 26. Nishizuka, Y. (1986) Science 233, 305-312 although a PKC-dependent pathway for induction through 27. Berridge, M. J . (1989) Nature 341, 197-205 the TRE actuallyexists,neitherPDGF,PC-PLC,norras 28. Williams, L. T. (1989) Science 243, 1564-1570

' A. Garcia de Herreros andJ. Moscat, unpublished observations.

29. Carpenter, G., and Cohen, S. (1990) J . Rid. Chem. 265, 77097712

22602

Regulation Expression of Stromelysin

:30. Moscat, J., Cornet, M. E., Diaz-Meco, M. T.,Larrodera, P., Lopez-Alaiion, D., andLopez-Barahona, M. (1989) SOC.Trans. 17,988-991 31. Price, B. D., Morris, J. D. H., Marshall, C. J., and Hall, A. (1989) J . Biol. Chern. 264, 16638-16643 32. Exton, J. H. (1990) J. Biol. Chem. 265, 1-4 33. Lopez-Barahona, M., Kaplan, P. L., Cornet, M. E., Diaz-Meco, M. T., Larrodera, P., Diaz-Laviada, I., Municio, A. M., and Moscat, J. (1990) J. Biol. Chern. 265, 9022-9026 34. Larrodera, P., Cornet,M. E., Diaz-Meco,M. T., Lopez-Barahona, M., Diaz-Laviada, I., Guddal, P. H., Johansen, T., and Moscat, J. (1990) Cell 61, 1113-1120 35. Diaz-Laviada, I., Larrodera,P., Diaz-Meco, M. T., Cornet, M. E., Guddal, P. H., Johansen, T., and Moscat, J . (1990) EMBO J. 9,3907-3912 36.Garcia de Herreros, A,, Dominguez, I., Diaz-Meco, M. T.,GraP. H., Johansen, T., and ziana, G., Cornet, M.E.,Guddal, Moscat, J. (1991) J. Biol. Chem. 266, 6825-6829 37. Selden, R. F., Howie, K. B., Rowe, M. E., Goodman, H. M., and Moore, D. D. (1986) Mol. Cell. Biol. 6, 3173-3179 38. Graham, F. L., and van der Eb, A. J. (1973) Virology 52, 456467

39. Gorman, C.M., Moffat, L.F., and Howard,B. H. (1982) Mol. Cell. Biol. 2, 1044-1051 Trans. 17, 271-273 40. Little, C. (1988) Biochern. SOC. 41. Smith,M. R., DeGudicibus, S. J., and Stacey, D. W. (1986) Nature 320, 540-543 42. Owen, R. D., and Ostrowski, M. C. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 3866-3870 43. Barbacid, M. (1987) Annu. Reu. Biochm. 56, 779-827 44. Ono, Y., Fujii, T., Ogita,K.,Kikkawa, U., Igarashi, K., and Nishizuka, Y. (1988) J. Biol. Chern. 263,6927-6932 45. Ono, Y., Fujii, T., Ogita, K., Kikkawa, U., Igarashi,K., and Nishizuka, Y. (1989) Proc. Natl. Acad. Sci. U. S. A, 86, 30993103 46. Ogita, K., Miyamoto, S., Koide, H., Iwai, T., Oka, M., Ando, K., Kishimoto, A,, Ikeda, K., Fukami, Y., and Nishizuka, 1. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5011-5015 47. Levin, D. E., Fields,F. O., Kunisawa, R., Bishop, J. M., and Thorner, J. (1990) Cell 62, 213-224 48. Frisch, S. M., Clark, E. J., and Werb, Z. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 2600-2604 49. Matrisian, L. M., Leroy, P., Ruhlmann, C., Gesnel, M. C., and Breathnach, R. (1986) Mol. Cell. Biol. 6, 1679-1686