ARTseq™ Ribosome Profiling Kit (Mammalian) Catalog Number: RPHMR12126
www.epicentre.com
Lit. # 360 • 3/2014 EPILIT360 Rev. C
1
Quick Protocol for ARTseq™ Ribosome Profiling Kit-Mammalian For experienced users only! The detailed procedure begins at Step 1 on page 6. Step
Procedure
A. Lyse cells and treat with ARTseq nuclease
1. 2. 3. 4. 5. 6. 7.
B. Purify lysate by size exclusion chromatography (SEC) or sucrose cushion ultracentrifugation
1.
2.
C. Ribo-Zero™ depletion of rRNA contamination from both Total and Ribosome-Protected Fragments (RPF) samples
Pages
Treat 5-50M cells with cycloheximide (0.1 mg/ml) and wash with cold PBS (+ cycloheximide). Add 800 µl Lysis Buffer and scrape cells into 1.5 ml tube on ice. Draw up and expel cells through a sterile pipette. Incubate 10 min on ice with gentle mixing. Spin @ 20,000 xg for 10 min @ 4°C. Transfer clarified lysate (~1 ml) to fresh tube on ice. Obtain A260 of lysate, make ~100 µl and 200 µl aliquots and keep on ice. Remove 100 µl aliquot and immediately add 10 µl of 10% SDS. Mix well and keep on ice for use as ‘Total RNA’ sample (see below in Step B.3). Remove 200 µl aliquot to fresh tube and add 5U of ARTseq nuclease per A260/ml of lysate. For example: 50 A260/ml x 0.2 ml x 5 U/A260 per ml = 50U ARTseq nuclease. Incubate 45 min @ RT with gentle agitation. After incubation add 15 µl SUPERase∙In™ and keep on ice or freeze in liquid nitrogen. Size Exclusion Chromatography (SEC) a. Equilibrate column by gravity with 3 bed volumes of cold 1X Mammalian Polysome Lysis Buffer. b. Spin column 4 min @ 600 xg. c. Place column in fresh collection tube, gently add 100 µl nuclease-treated sample to top of resin and spin 2 min @ 600 xg. Transfer flow-through to fresh tube on ice. Multiple columns per sample can be used if needed and samples pooled. d. Add 10 µl of 10% SDS to each eluted sample and extract RNA using Zymo RNA Clean & Concentrator™ kit see Part 2.A., Step 7.B. for modified protocol). Elute RNA with 26 µl NucleaseFree Water. Sucrose Cushion A sucrose cushion can be used as an alternative to the MicroSpin S-400 columns to purify monosomes. Please refer to Appendix 8 for details.
3.
Purify RNA from ‘Total RNA’ sample (taken in Step A.5., above) using Zymo RNA Clean & Concentrator kit (>17 nt protocol). Elute RNA with 26 µl Nuclease-Free Water.
1.
Follow Ribo-Zero protocol except omit the 50°C incubation (Step 3.C.3.) and RNA purification. Instead, purify Ribo-Zero treated RNA using Zymo RNA Clean & Concentrator kit. • For Total RNA use the >200 nt protocol. Elute RNA with ~21 µl Nuclease-Free Water. • For RPF samples (See Section 3.3 for modified protocol). Elute the RNA with ~11 µl Nuclease-Free Water.
6
7
8
a. Add 10 µl Denaturing Gel Loading Dye to RPF samples and heat RPF samples to 95°C for 5 min. b. PAGE purify ~28-30 nt RPFs; use the RNA Control Oligo included in the kits as a guide. c. Resuspend PAGE-purified RPFs in ~20 µl Nuclease-Free Water.
D. Fragment Total RNA and End-Repair both Total and RPF samples
1. Mix:
20.0 µl Total or RPF RNA sample
7.5 µl ARTseq PNK Buffer
27.5 µl Total
• Keep RPF samples chilled on ice. Do not heat fragment.
•
Heat fragment Total RNA sample at 94°C for 25 min and then hold @ 4°C.
•
Mix:
44.5 µl Nuclease-Free Water
3.0 µl ARTseq PNK
9
27.5 μl Sample
75.0 µl Total
•
Incubate 1 hour @ 37°C.
2. Purify each sample using Zymo RNA Clean and Concentrator kit. (See Section 5.5 for modified protocol).
2
•
Elute samples with 10 µl Nuclease-Free Water.
www.epicentre.com
Quick Protocol for ARTseq™ Ribosome Profiling Kit-Mammalian continued Step
Procedure
E. 3′ Adaptor Ligation
1. Mix: 8.0 µl RNA sample (or control) 1.0 µl ARTseq 3′ Adaptor 9.0 µl Total (Note: Be sure to include both CtrlP and CtrlN reactions) • Heat to 65°C for 2 min and then hold @ 4°C. 2. To the 9 µl from above, add: 3.5 µl ARTseq Ligation Buffer 1.0 µl DTT 1.5 µl ARTseq Ligase 15.0 µl Total • Incubate 2 hrs @ RT (~23°C) 3. Add 2 µl ARTseq AR Enzyme to each sample. Incubate for 30 min @ 30°C.
10
1. Prepare Reverse Transcription (RT) Master Mix on ice: 4.5 µl ARTseq RT Reaction Mix 1.5 µl DTT 6.0 µl Nuclease-Free Water 1.0 µl Episcript Reverse Transcriptase 13.0 µl Total • Add 13 µl Reverse Transcription Master Mix to each 17 µl ARTseq AR enzyme-treated sample from above. Incubate 30 min @ 50°C. • Add 1.0 µl ARTseq Exonuclease to each sample. Incubate 30 min @ 37°C, 15 min @ 80°C, hold @ 4°C. • Add 1.0 µl RNase Mix to each sample. Incubate 5 min @ 55°C, hold @ 4°C. • Purify each sample using Zymo RNA Clean and Concentrator kit (>17 nt protocol). Elute samples with 11 µl Nuclease-Free Water. 2. PAGE purify cDNA. • For Total RNA samples purify ~80-100 nt cDNA size range. • For RPF samples purify ~70-80 nt cDNA size range. • Precipitate gel purified cDNA and resuspend in 10 µl Nuclease-Free Water.
10
Prepare Circligase Master Mix on ice: 4.0 µl ARTseq Circligase Reaction Mix 2.0 µl ATP 2.0 µl MnCl2 2.0 µl Circligase 10.0 µl Total • Mix 10 µl cDNA samples with 10 µl Circligase Master Mix. Incubate 2 hrs @ 60°C. Hold @ 4°C.
11
Combine: 5.0 µl Circular cDNA or 1:5 dilution of Circular cDNA 16.0 µl Nuclease-Free Water 2.0 µl ARTseq Forward PCR Primer 2.0 µl ScriptMiner™ Index Indexed PCR Primer 25.0 µl 2X Phusion HiFi Master Mix 50.0 µl Total • Incubate at 98°C for 30 seconds. • Perform 9 cycles of 94°C for 15 seconds/55°C for 5 seconds/65°C for 10 seconds followed by 4°C Hold. • Purify samples using 1.8x AMPure beads. Elute purified samples from beads with 25 µl of 10 mM Tris pH 8.0. • Visualize samples: Run 2.5 µl on an 8% Native PAGE, or: Run 1 µl on Agilent Bioanalyzer High Sensitivity DNA Chip.
11
F. Reverse Transcription
G. Circularize cDNA with Circligase
H. PCR Amplification
3
Pages
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian) Kit Contents
Cat. #
Qty.
Storage
ARTseq™ Ribosome Profiling Kit
ASLPA1212
1 kit
–20°C
5X Mammalian Polysome Buffer
ASBHMR1212
1 bottle
–20°C
ScriptMiner™ Index PCR Primers (1-12)
SMIP2124
1 kit
–20°C
Filter Tubes
ASFT1212
1 pack
RT
Additionally Required Materials for Preparation and Isolation of Ribosome Protected Fragments – – – – – – –
Cycloheximide (50 mg/ml in Absolute Ethanol) SUPERase•In™ RNase Inhibitor (Life Technologies, Cat. No. AM2696) Phosphate-Buffered Saline (PBS) Liquid nitrogen 100% Isopropyl alcohol Ice cold 80% Ethanol NanoDrop® Spectrophotometer
Note: Cycloheximide is available from many vendors. We recommend preparing 15ml 50 mg/ml stock solution using Ethanol as the diluent. Compound is light-sensitive and can be stored up to 1 year at –20°C. Cycloheximide is toxic and proper personal protective equipment should be worn. Please see manufacturer's MSDS for more information. Additionally Required Materials for Purification of the Ribosome Protected Fragments – illustra™ MicroSpin™ S-400 HR Columns (GE Healthcare, Cat. No. 27-5140-01) – Sucrose Optional – 10% NP-40 (Thermo Scientific, Cat. No. 85124) – Sterile 22-25 gauge needle Additionally Required Materials for ARTseq Library Preparation – – – – – – – – – – – – – – – –
4
Ribo-Zero™ Magnetic Gold Kit (Human/Mouse/Rat) (Epicentre; Cat No. MRZG12324) RNA Clean & Concentrator™-5 kit (Zymo Research; Cat No. R1015) RNA Clean & Concentrator™-25 kit (Zymo Research; Cat No. R1017) Denaturing Gel Loading Dye (Ambion; Cat. No. 8546G) Native loading dye containing Bromophenol Blue 20/100 Oligo ladder at 1 ng/μl (IDT; Cat. No. 51-05-15-02) 12 or 15% Polyacrylamide/7-8M Urea/TBE gel Dark field transilluminator SYBR® Gold (Life Technologies) 0.5 ml and 1.5 ml tubes (sterile) 10% Polyacrylamide/7-8M Urea/TBE gel 8% Native TBE PAGE gel Phusion® Hi-Fi PCR Master Mix (NEB; Cat. No. M0531) Agencourt AMPure XP Beads (Beckman-Coulter; Cat. No. A63880) 20 bp Ladder (Bayou Biolabs; Cat. No. L-100) Sterile 20 gauge needle
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
Transcription
Translation 5’
3’
mRNA
Ribosome Add Cycloheximide Lyse cells
Cell Lysis 100 μl
Total RNA
200 μl
5’
5’
3’
3’
5’
Nuclease digestion and isolate monosomes
Ribosome Protected Fragments (RPFs) 5’
Nuclease Digestion
5’
3’ 5’
3’
Purify Monosomes Extract RNA
Extract RNA
Ribo-Zero™
Ribo-Zero™ RPF PAGE Purification
3’
3’
Extract and purify RNA
5’
Ribo-Zero
3’
PAGE Purify Ribosomal Protected Fragments 5’ 5’
3’ p 3’ p
5’
3’ p
End repair (Remove 3’ P) 5’ 5’
3’ OH 3’ OH
5’
Heat Fragment
3’ OH
3’ Adapter Ligation
End Repair
End Repair
3’ Adaptor Ligation
3’ Adaptor Ligation
Reverse Transcription
Reverse Transcription
PAGE Purification
PAGE Purification
Circularization
Circularization
PCR
PCR
5’
3’ OH
+
5’ Ap
X
Ligation + Adaptor removal (AR) enzymes (removes excess 5’ Ap–x primer) 5’
X
Reverse Transcription 5’
X
3’
dU
5’
(Exo I/RNase) PAGE Purify 3’
dU
Figure 1. Overview of the ARTseq™ workflow.
5’
Circularize dU
PCR Amplification with index
Sequencing
[email protected] • (800) 284-8474
5
ARTseq™ Ribosome Profiling Kit (Mammalian)
1. Preparation and Isolation of Ribosome Protected Fragments ARTseq™ Kit components used in this procedure: Kit Contents
5X Mammalian Polysome Buffer DTT (100 mM) 10% SDS 10% Triton® X-100
Volume
Cap Color
50 ml 2 x 1.5 ml
Clear
0.5 ml 2 x 1.25 ml
DNase I (1 U/µl)
100 µl
ARTseq™ Nuclease (10 U/µl)
150 µl
Red
Note: Briefly spin tubes to collect reagent at bottom of tubes. 1.A. Mammalian Cell Extract Preparation and Ribosome Footprinting 1. Prepare 1 ml of Mammalian Lysis Buffer for each sample. Chill the Mammalian Lysis Buffer to 4°C. To prepare 1ml of Mammalian Lysis buffer, combine the following: 200.0 µl 5x Mammalian Polysome Buffer 100.0 µl 10% Triton X-100 10.0 µl 100 mM DTT 10.0 µl DNase I (1U/µl) 2.0 µl 50 mg/ml Cycloheximide 10.0 µl 10% NP-40 (optional) or use Nuclease-Free Water 668.0 µl Nuclease-Free Water 1.0 ml Total 2. Grow adherent mammalian cells on 15 cm plates in liquid media. The required cell density will likely depend on the cell line and growth conditions. A cell density of 5-50 million cells/ml is acceptable (see Step 1.A.6). Treat the cells with Cycloheximide prior to lysis, aspirate the growth media and supplement the plate with fresh media containing Cycloheximide (final concentration 0.1 mg/ml) and incubate the cells for 1 minute. 3. Aspirate media and place cells on ice. Rinse cells with 10 ml of ice cold PBS supplemented with Cycloheximide (final concentration 0.1 mg/ml). 4. Aspirate and discard the PBS and add 800 μl of Mammalian Lysis Buffer to the plate. Scrape the cells extensively and (optionally) draw up and expel through a sterile 22-25 gauge needle to lyse the cells completely. Transfer the cell lysate to a fresh tube that has been chilled on ice. 5. Incubate 10 minutes on ice with periodic inversions. 6. Clarify the lysate by centrifugation for 10 minutes at 20,000 xg at 4°C. Transfer the supernatant to a fresh tube that has been chilled on ice. Expect to recover ~1 ml clarified lysate. 7. Prepare a 1:10 dilution of the collected lysate using Nuclease-Free Water. Use a water blank and a 1:10 dilution of Mammalian Lysis Buffer as standard. Record an A260 reading using a spectrophotometer. Calculate the A260/ml concentration of the lysate (see equation below). This number will be used to calculate the amount of ARTseq Nuclease to generate Ribosome Protected Fragments (RPFs) in Step 1.B.1. (A260 cell lysate – A260 Mammalian Lysis Buffer) x 10 dilution factor = A260/ml. 8. 9.
Optional Stopping Point (Freeze 100 µl aliquots of the lysate in liquid nitrogen and store at –80°C) ? For each cell lysis, create aliquots: 100 µl volume aliquot (for use in Step 1.A.9, Ribosome Protected Fragments) and 200 µl volume aliquot (for use in Step 1.B.1, Ribosome Protected Fragments). Keep on ice. To the 100 µl aliquot, add 10 µl of 10% SDS and mix. This material will be used as ‘Total RNA’ (non-footprinted RNA). Place on ice for purification in Step 2.A.7 or Step 2.B.5. Alternatively, the sample can be frozen in liquid nitrogen and stored at –80°C until ready for use.
1B. Mammalian Ribosome Footprinting with ARTseq Nuclease 1.
To the 200 μl aliquot of clarified lysate from step 1.A.8, add 5 Units of ARTseq Nuclease for each A260 of lysate.
For example, 50 A260/ml lysate X 0.2 ml lysate X 5 Units/A260 ARTseq Nuclease = 50 Units ARTseq Nuclease.
Optionally, titrate the ARTseq Nuclease digestion as described in Appendix 4.
2.
Incubate the reactions at room temperature for 45 minutes with gentle mixing. Freeze any unused lysate with liquid nitrogen and store at –80°C. Note: During incubation, prepare the MicroSpin S-400 columns as described in Step 2A to isolate the nuclease-digested monosomes.
3. 6
Stop the reactions by adding 15 µl SUPERase•In RNase Inhibitor and chill the samples on ice for use in Part 2. www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
2. Purify the Ribosome Protected Fragments Ribosome protected fragments can be purified by either MicroSpin S-400 columns (2.A.) or sucrose cushion ultracentrifugation (2.B.). Note: Do not purify the samples labeled as “Total RNA” with the Microspin S-400 spin columns. Keep these samples frozen for use in Step 2.A.7 or Step 2.B.5. 2.A. Purify monosomes using MicroSpin S-400 columns 1. For each sample, prepare 3 ml of 1X Mammalian Polysome Buffer: 600.0 μl 5X Mammalian Polysome Buffer 2400.0 μl Nuclease-Free Water 3.0 ml Total 2. Invert the MicroSpin S-400 columns several times to resuspend the resin. Tap out any bubbles that may form in the resin as it settles. 3. Open the column on both ends and allow the buffer to drip out under gravity. If the columns are not dripping freely, use a clean gloved finger to cover the top of the column. Press down gently to create pressure to initiate flow. 4. Equilibrate the resin by passing through ~3 ml of 1X Mammalian Polysome Buffer under gravity flow. This step may take up to an hour for buffer to flow through the column. Do not centrifuge. Be careful not to introduce bubbles into the resin. The columns will drip more freely once the 1X Mammalian Polysome Buffer replaces the original buffer in the columns. Note: Steps 2.A.2–2.A.4 can be done during the Ribosome Protected Fragment nuclease digestion (Step 1.B.2). Do not allow column to dry. Do not centrifuge the column. 5.
Attach a collection tube and spin for 4 minutes at 600 xg in a fixed angle table top centrifuge at room temperature. Discard flowthrough, and transfer columns to a 1.5 ml tube.
6. Immediately apply 100 μl of Ribosome Protected Fragment nuclease digestion (from Step 1.B.3). Keep remaining ~100 μl on ice or freeze in liquid nitrogen and store at –80°C in case needed in Part 2.A, Step 8.B. Centrifuge for 2 minutes at 600 xg and collect the flow through. Add 10 µl of 10% SDS. This material will be used as ‘Ribosome Protected RNA’. 7. Purify both Total RNA samples and Ribosome Protected RNA samples: A. Purify the Total RNA samples using the Zymo Research RNA Clean & Concentrator-25 kit. Follow the kit protocol for >200 nt RNA. Elute the samples from the columns with 26 µl Nuclease-Free Water (expect to recover ~25 µl). B. Purify the Ribosome Protected RNA samples using Zymo RNA Clean & Concentrator-25 kit using a modified protocol optimized for small fragment purification: a) In Zymo protocol Step 1, use 220 μl Binding Buffer (from Zymo Kit) b) In Zymo protocol Step 2, use 495 μl Absolute Ethanol c) Continue with purification according to the manufacturer’s instructions d) Elute the samples with 26 µl of Nuclease-Free Water (expect to recover ~25 µl) 8. Quantify by NanoDrop. You will need about 1-5 μg of Total RNA and 1-5 μg Ribosome Protected RNA for the Ribo-Zero rRNA removal treatment in Step 3. A. If < 1-5 μg of Total RNA has been collected, repeat Step 1.A.9 with remaining lysate to achieve desired amount. B. If < 1-5 μg of Ribosomal Protected RNA has been collected, repeat Step 2 with unused clarified lysate (from Step 1.B.3) to achieve desired amount. 9. Continue to Step 3.A. Removal of rRNA using Ribo-Zero.
2.B. Purify Monosomes by Sucrose Cushion A sucrose cushion can be used as an alternative to the MicroSpin S-400 columns to purify monosomes. Please refer to Appendix 8 for details.
[email protected] • (800) 284-8474
7
ARTseq™ Ribosome Profiling Kit (Mammalian)
Kit components used for ARTseq library preparation. Component Name
Volume
Cap Color
End Repair ARTseq™ PNK Buffer ARTseq™ PNK
150 µl 45 µl
Yellow
3′ Adaptor Ligation ARTseq™ RNA Control
20 µl
ARTseq™ 3′ Adaptor
15 µl
ARTseq™ Ligation Buffer
49 µl
ARTseq™ Ligase
22 µl
ARTseq™ AR enzyme
28 µl
DTT (100 mM) Nuclease-Free Water
2 x 1.5 ml 1.5 ml
Yellow
Clear
Reverse Transcription ARTseq™ RT Reaction Mix
65 µl
EpiScript™ Reverse Transcriptase
15 µl
ARTseq™ Exonuclease
15 µl
ARTseq™ RNase Mix
15 µl
Blue
CircLigase ARTseq™ CL Reaction Mix
72 µl
MnCl2
30 µl
CircLigase™
28 µl
ATP
30 µl
Green
PCR ARTseq™ Forward PCR Primer ScriptMiner™ Index PCR Primers
75 µl 12 Indexes
Green Yellow; separate box
Extras Glycogen
200 µl
10% SDS
500 µl
Ammonium Acetate Filter Tubes
Clear
1.2 ml
Red
24 filter tubes
N/A
3. Ribo-Zero Depletion 1. Use 1-5 μg of Ribosome Protected RNA and 1-5 µg of the Total RNA samples that were generated at the end of Part 2. 2. Follow the Ribo-Zero kit procedure with the following exceptions A. Omit 50°C incubation step (Step 3.C.3 of the Ribo-Zero kit procedure). B. Do not purify the rRNA depleted samples as stated in the Ribo-Zero procedure. Instead, follow the purification procedure below (Step 3.3). 3. Purify both Ribo-Zero treated Total RNA samples and Ribo-Zero treated Ribosome Protected RNA samples: A. Purify the Ribo-Zero treated Total RNA samples using the Zymo Research RNA Clean & Concentrator kit. Follow the kit protocol for >200 nt RNA. Elute the samples from the columns with 21 µl Nuclease-Free Water (expect to recover ~20 µl). Keep on ice or store at –20°C until ready for use in Part 5. B. Purify the Ribo-Zero treated Ribosome Protected RNA samples using Zymo RNA Clean & Concentrator-5 kit. Adjust each sample volume to 100 μl with Nuclease-Free Water. Purify the reactions using a modified Zymo Research RNA Clean & Concentrator kit protocol: a) In Zymo protocol Step 1, use 200 μl Binding Buffer (from Zymo Kit) b) In Zymo protocol Step 2, use 450 μl Absolute Ethanol c) Continue with purification according to the manufacturer’s instructions. d) Elute the samples with 11 µl of Nuclease-Free Water (expect to recover ~10 µl). Quantify by NanoDrop. Expect to recover ~5-20% of input. e) Proceed to Part 4. 8
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
4. PAGE Purify the Ribosome Protected Fragments The Ribosome Protected Fragments will be ~28-30 nts in length. The ARTseq RNA Control that is provided in the kit will be used as a size marker. The ARTseq RNA Control contains two oligos of 28 nts and 30 nts in length (see Appendix 1). Do not PAGE purify the Ribo-Zero treated Total RNA samples. Keep these samples on ice or store at –20°C until ready for Part 5. 1. Prepare ARTseq RNA Control, samples, and ladder for PAGE gel. A. Add 5 µl of the ARTseq RNA Control from the kit to a tube. Add 5 µl of denaturing gel loading dye. B. Mix the Ribosome Protected RNA samples (10 µl) with 10 µl of denaturing gel loading dye (total volume = 20 µl). C. To prevent cross contamination, prepare a ladder aliquot (4 μl IDT 20/100 ladder, 1 μl water, and 5 μl denaturing gel loading dye) to load between each Ribosome Protected RNA sample or ARTseq RNA control. 2. Denature the samples and ladder by incubating at 95°C for 5 minutes. Place the tubes immediately on ice. The ARTseq RNA Control will be used as a size marker. 3. Load the 10 µl aliquots of each sample and ladder onto a 12% or 15% Urea-Polyacrylamide gel. Run the gel at 180V until the bromophenol blue band reaches bottom of the gel (~210V*hr; 180V for 70 min). Store the remaining samples at –20°C. 4. Stain the gel with SYBR Gold and visualize the RNA using a Dark Field Transilluminator (emits a blue light). 5. For each sample, excise the gel slices corresponding to the 28 nt and 30 nt control RNA as a reference. Cut even if footprints are not visible. The ladder is overloaded to make size selection easier. However, this tends to oversaturate eye vision making visualization of the ribosome protected fragments challenging. Note: Also excise the 28 nt and 30 nt ARTseq RNA Control oligo bands. See Appendix 4, Figure 2 for example. 6. Transfer the gel slices to 0.5 ml tubes with a hole punched in bottom using a sterile 20 gauge needle, and close the tube cap. Place the 0.5 ml tubes inside a 1.5 ml tube and centrifuge for 2 minutes at ~12,000 xg in a microcentrifuge to disrupt the gel slices. 7. Remove and discard the 0.5 ml tubes. To each 1.5 ml collection tube, add to each eluted sample: 400.0 µl Nuclease-Free Water 40.0 µl 5M Ammonium Acetate ~2.0 µl 10% SDS 8. Gently rock samples at room temperature for 1-2 hours or 4°C overnight to elute the RNA from the disrupted gel slices. 9. Transfer the slurry to 1.5 ml filter tubes provided, and centrifuge for ~3 minutes at 2,300 xg to separate disrupted gel pieces from the eluted RNA solution. 10. Use a large orifice 1 ml pipette tip or trim the end of a 1 ml pipette tip. Carefully pipette the aqueous solution into new 1.5 ml tubes. To each tube add 2 µl Glycogen and 700 µl of 100% Isopropanol and store at –20°C for >1 hour. 11. Centrifuge tubes at >12,000 xg at 4°C for 20 minutes to pellet the Ribosome Protected RNA. Wash the RNA pellet with ice cold 80% Ethanol and air dry. 12. Resuspend in the appropriate amount of Nuclease-Free Water as stated below: A. For the Ribosome Protected RNA samples, resuspend the RNA pellet in 20 µl of Nuclease-Free Water. Proceed to Part 5 or freeze the samples at –20°C. B. For the ARTseq RNA control, resuspend the RNA pellet in 8 µl of Nuclease-Free Water for use in Part 6. Store on ice or at –20°C until ready to use in Part 6.
5. Fragment and End Repair In this step, the Ribo-Zero treated Total RNA samples are heat fragmented. Both the fragmented Total RNA samples and the Ribosome Protected RNA samples are then end-repaired to prepare them for the 3′ Adaptor Ligation step (Part 6). RNA end-repair is performed using ARTseq PNK in the absence of ATP. 1.
Add to each of the Total RNA and Ribosome Protected RNA samples, on ice: 20.0 µl RNA sample 7.5 µl ARTseq PNK Buffer 27.5 µl Total volume
Hold the Ribosome Protected RNA samples on ice for use in Part 5, Step 3. 2. Heat fragment only the Total RNA samples for 25 minutes at 94°C. Then, place on ice or hold at 4°C. 3. To perform end repair, to the heat fragmented Total RNA sample and the Ribosome Protected RNA sample add and mix throughly:
44.5 µl Nuclease-Free Water 3.0 µl ARTseq PNK 27.5 µl Sample from Step 5.1 75.0 µl Total
[email protected] • (800) 284-8474
9
ARTseq™ Ribosome Profiling Kit (Mammalian)
4. Incubate the samples for 1 hour at 37°C. 5. Adjust each sample volume to 100 µl with 25 µl Nuclease-Free Water. Purify the reactions using a modified Zymo Research RNA Clean & Concentrator-5 kit protocol: A. In Zymo protocol Step 1, use 200 µl Binding Buffer (from Zymo Kit) B. In Zymo protocol Step 2, use 450 µl Absolute Ethanol C. Continue with purification according to the manufacturer’s instructions D. Elute the RNA with 10 µl of Nuclease-Free Water and expect to recover ~8 µl Proceed with the 3′Adaptor Ligation procedure in Part 6. ?
Optional Stopping Point (Store samples at ≤–20° C)
6. 3′ Adaptor Ligation Positive and Negative Controls: It is useful to include both positive and negative controls. The positive control will also be used in downstream PAGE Gels. Reactions to include:
CtrlP: Positive Control = PAGE-purified ARTseq RNA Control from Part 4, (Step 12.B).
CtrlN: Negative Control= no RNA (mock reaction; use 8 µl Nuclease-Free Water).
1.
Mix on ice:
8.0 µl RNA samples from Part 5 (or control) 1.0 µl ARTseq 3' Adaptor 9.0 µl Total volume In a thermocycler with heated lid, heat denature the samples for 2 minutes at 65°C and then Hold at 4°C. 2. While the denaturing reaction is proceeding, make the Ligation Master Mix. For each reaction, prepare: 3.
3.5 µl 1.0 µl 1.5 µl 6.0 µl
ARTseq Ligation Buffer 100 mM DTT ARTseq Ligase Total volume
Add 6 µl of the Ligation Master Mix to each of the denatured RNA samples. Mix thoroughly by pipetting several times. Centrifuge briefly to consolidate sample at bottom of tube. Incubate at room temperature (23°C) for 2 hours. ?
Optional Stopping Point (Store samples at ≤ –20°C)
4. Add 2 µl of ARTseq™ AR Enzyme to each reaction and mix thoroughly by pipetting. Incubate at 30°C for 30 minutes.
7. Reverse Transcription 1. For each reaction, prepare the Reverse Transcription Master Mix on ice:
4.5 µl ARTseq RT Reaction Mix 1.5 µl 100 mM DTT 6.0 µl Nuclease-Free Water 1.0 µl EpiScript Reverse Transcriptase 13.0 µl Total volume
2. Add 13 µl of the Reverse Transcription Master Mix to each reaction and mix well by pipetting. 3. Incubate the reactions for 30 minutes at 50°C in a thermocycler with heated lid. 4. Add 1 µl of ARTseq Exonuclease to each reaction and incubate for:
37°C for 30 minutes
80°C at 15 minutes
4°C Hold ?
Optional Stopping Point (Store samples at ≤–20°C)
5. Add 1 µl ARTseq RNase Mix to each reaction. Mix and incubate for 5 minutes at 55°C. Place the reactions on ice or hold at 4°C.
10
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
8. PAGE Purify the cDNAs 1. Add 18 µl of Nuclease-Free Water to each reaction. Reaction volumes are now 50 µl. 2. Purify the samples using Zymo Research RNA Clean & Concentrator kit. Follow manufacturer’s protocol for >17 nt RNA. Elute the cDNA with 11 µl of Nuclease-Free Water and expect to recover ~10 µl. ?
Optional Stopping Point (Store Samples at ≤–20°C)
3. Prepare samples and ladder for PAGE gel. A. Add 10 µl volume of denaturing gel loading dye to each sample and the ARTseq RNA control. B. Separate each sample or ARTseq RNA control with an aliquot of the IDT 20/100 Oligo ladder (4 μl ladder, 1 μl water, and 5 μl denaturing loading dye) to avoid cross-contamination. 4.
Heat the samples to 95°C for 5 minutes and then place on ice.
5. Load 10 µl of each sample onto a single lane of a 10% Polyacrylamide/7-8M Urea/TBE gel. Freeze the remaining 10 µl of sample at –20°C. 6. Adjust power supply to 180V and run gel until Bromophenol Blue dye completely migrates out of gel (~180V*hr; 180V for 60 min). Stain gel with SYBR gold and visualize under Dark Field Transilluminator. (See Appendix 7 for more information). 7. Excise the gel slices. Excise even if material is not visible. The ladder is intentially overloaded to make size selection easier. However, this tends to oversaturate eye vision making visualization of the cDNA bands difficult. A. For the Ribo-Zero treated Total RNA samples cut ~80-100 nt. B. For the Ribosome Protected Fragments, CtrlN and CtrlP controls, cut ~70-80 nt. Note: In the CtrlP sample a distinct cDNA product migrating at 73-75 nt should be clearly visible and excised for use as a positive control. It is also a helpful size marker for comparison to the Ribosome Protected samples. Excise also the same region for the CtrlN sample for use as the negative control. The size ranges are higher than the previous gel purification due to the addition of the 3′ Adaptor and RT primer. 8. Transfer the gel slices to a 0.5 ml tube with a hole punched in bottom with a 20 gauge needle and close cap. Place the 0.5 ml tube inside of a 1.5 ml tube and centrifuge for 2 minutes at ~12,000 xg in a microcentrifuge to disrupt the gel slice. 9. Remove and discard the 0.5 ml tube. To the 1.5 ml tube, add:
400.0 µl Nuclease-Free Water 40.0 µl 5M Ammonium Acetate ~2.0 μl 10% SDS Shake the samples at 37°C for ~1 hour (or overnight at room temperature) to elute the cDNA from the disrupted gel slices.
10. Transfer the slurry to a new 1.5 ml filter tube and centrifuge for ~3 minutes at 2,300 xg to separate the shredded gel pieces from the eluted cDNA solution. 11. Use a large orifice 1 ml pipette tip or trim the end of a 1 ml pipette tip. Carefully pipette the aqueous solution to new 1.5 ml tubes. To each sample, add 2 µl Glycogen and 700 µl 100% Isopropanol Alcohol. Mix and store at –20°C for >1 hour. 12. Centrifuge at >12,000 xg @ 4°C for 15 minutes to pellet the cDNA. Wash the pellet with ice cold 80% Ethanol and air dry. Resuspend the cDNA pellet in 10 µl of Nuclease-Free Water. 13. Proceed to Part 9 or freeze the samples at –20°C.
9. Circularize the cDNA 1.
For each sample prepare CircLigase Master Mix on ice:
4.0 µl ARTseq CircLigase Reaction Mix 2.0 µl ATP 2.0 µl MnCl2 2.0 µl CircLigase 10.0 µl Total volume per reaction 2. Add 10 µl of the CircLigase Master Mix to each reaction. Mix the tubes contents by gentle mixing and briefly centrifuge. Incubate the reactions at 60°C for 2 hours, then place on ice or hold at 4°C.
10. PCR Amplification Too much template or too many PCR cycles can result in “overamplification” – the appearance of higher-than-expected molecular weight bands, smeared PCR products, and adapter dimer-derived products. Examples of overamplified samples can be seen in Appendix 5. For most samples, use 1-5 μl of the circularized cDNA from Part 9. Nine PCR cycles will typically yield sufficient amounts of the correct PCR product.
[email protected] • (800) 284-8474
11
ARTseq™ Ribosome Profiling Kit (Mammalian)
A good starting strategy is to set up two PCR reactions for each sample. For one PCR reaction, use 5 μl of 1:5 dilution (with water) of the circularized cDNA as template. For the second PCR, use 5 μl of undiluted circularized cDNA. The remaining circularized cDNA (~14 μl) can be retained and stored at –20°C in case the template input and/or PCR cycle number need to be optimized. Note: A) Choose one of the ScriptMiner Index PCR Primers (provided) for use as the Reverse PCR Primer in the PCR reaction. B) If pooling libraries for sequencing later, be sure to check the indices for color balance during sequencing. See end of Appendix 2 for recommendations on indices combinations for sequencing. C) The PCR reaction is optimized for use with the 2X Phusion Master Mix (NEB; cat. no. M0531) 1.
Prepare the PCR Master Mix. For each sample, combine on ice:
16.0 µl Nuclease-Free Water 2.0 µl ARTseq Forward PCR Primer 2.0 µl ScriptMiner Index PCR primer of choice 25.0 µl 2X Phusion Master Mix 45.0 µl Total volume per reaction
2.
Add 45 µl of the PCR Master Mix to each of the 5 µl samples of both 1:5 diluted and undiluted cDNA. Mix the tubes thoroughly.
3.
Place all tubes in PCR thermocycler and run the following program:
98°C for 30 seconds
94°C for 15 seconds
55°C for 5 seconds
65°C for 10 seconds
9 cycles
4.
Purify the PCR products using 90 μl (1.8X) of Agencourt® AMPure® XP beads. Purify according to the manufacturer’s instructions. Elute the libraries with 25 µl of Nuclease-Free Water or 10 mM Tris-HCl pH 8.0.
4°C Hold
5.
Remove 2.5 μl aliquots from each PCR reaction to a new tube at room temperature. Add 1.5 μl water and 1 μl of 6x Native Gel Loading Dye containing Bromophenol Blue
6.
Load 5 µl of PCR reaction aliquots from Step 10.5 and 20 bp ladder on an 8% Native PAGE-1xTBE. Run the gel at 200V until bromophenol blue reaches bottom of gel (~83V*hr; 200V for 25 min). Stain gel with SYBR Gold and visualize under UV light or Dark Field Transilluminator.
7.
The expected size of the PCR-amplified library is 140-160 bp. Select the tubes that contain the correct PCR product for purification and sequencing. Note: If excess adaptor-only product (~113 bp) is observed, PAGE-purify the desired product using an 8% native polyacrylamide gel (see Appendix 6).
Optional: If necessary or desired, prepare more PCR amplified products using the 14 µl of cDNA retained from above. Increase or decrease the amount of input cDNA and/or the number of PCR cycles to obtain optimal yield of the desired 140–160 bp amplicon(s). See Appendix 5 for example.
8.
The size distribution of the library can alternatively be characterized using the Agilent High Sensitivity DNA Assay. See Appendix 6 for more details.
9.
Proceed to sequencing. See Appendix 3 for sequencing information.
11. Appendices Appendix 1 ARTseq Sequences: Control RNA oligos (two): 5′ NNGUACACGGAGUCGACCCGCAACGCNN 3′ (28 nts) 5′ NNGUACACGGAGUCAAGACCCGCAACGCNN 3′ (30 nts) 3′ Adaptor: 5′ AGATCGGAAGAGCACACGTCT 3′ Forward PCR Primer: 5′ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACG 3′ 12
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
Appendix 2 The sequences of the ScriptMiner Index PCR Primers function as the Reverse PCR primers in the ARTSeq procedure. The index sequence for each primer is underlined and index bases have been colored to assist in balancing of laser colors during sequencing index reads. See below for for recommended index combinations. Index 1 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 2 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 3 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 4 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 5 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 6 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 7 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 8 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 9 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 10 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 11 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Index 12 PCR Primer 5' CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3'
Recommended Index Combinations for Sequencing Library Pools Duplex (two indices)
Index 06 and Index 12
(Perfect base color balance)
Triplex (three indices)
Index 04 and Index 08
Add one: Index 01, 02, 05, 06, 09, or 10
Triplex (three indices)
Index 07 and Index 11
Add one: Index 01, 02, 05, 06, 09, or 10
Triplex (three indices)
Index 02 and Index 09
Add one: Index 03, 04, 07, 08, 11, or 12
Four or more indices
Index 06 and Index 12
Add any other indexes
Appendix 3 Sequencing an ARTseq Ribosome Protected Fragment. Purified, Adaptor-tagged ARTseq libraries are compatible with Illumina® TruSeq™ Cluster Kits and can be sequenced using the Illumina sequencing platforms. With the ARTseq library prep kit, the sequence generated by Read 1 is that of the sense strand of the original RNA. Recommended sequencing read length for ARTseq libraries is 51 cycles (Read 1 only or Read 1 plus Index Read); BioAnalyzer analysis of prepared libraries shows approximately 150 bp fragments (see Appendix 6). Actual insert size is approximately 30 nt (See Appendix 6). Sequencing Read 1 requires either HP6 or HP10 primer; HP6 is included in the TruSeq PE Cluster Kits (e.g. PE-401-3001). HP10 is the Read 1 primer included in the MiSeq™ Reagent Kits (MS-102-2001, MS-102-2002, MS-102-2003, MS-102-3001, and MS-102-3003). The Index Read requires 7 cycles (6 base barcodes) and requires HP12 primer which is included in TruSeq Dual Index Sequencing Primer Box (FC-121-1003, PE-121-1003). See Appendix 2 for pooling suggestions. Note: To use IEM (Illumina's Experiment Manager) select TruSeq LT to access appropriate barcodes.
[email protected] • (800) 284-8474
13
ARTseq™ Ribosome Profiling Kit (Mammalian)
ARTseq libraries have sufficient complexity for single-sample-per-lane sequencing; multiplexing is optional and therefore generous PhiX spike-ins (to prevent registration issues) is not needed. PhiX may be added to monitor error rates during sequencing, if desired. The minimum recommended number of reads for each sample library is 40 million. For guidance on analyzing sequencing data, please refer to the ARTseq™ Bioinformatics User Guide. Appendix 4. Optimizing nuclease digestion to generate the Ribosome Protected Fragments. Ribosome Protected Fragments (RPF) can be contaminated with partially degraded tRNA fragments. Therefore, it may be desirable to first optimize the ARTseq™ Nuclease digestion step in order to maximize RPF recovery and minimize contaminations. The ARTseq Nuclease is provided at a concentration of 10 U/µl. 1.
Set up a titration series of ARTseq Nuclease using individual aliquots of cell lysate. For example, to four separate 200 µl aliquots of the cell lysate, add 0.3 µl (3 Units), 1 µl (10 Units), 3 µl (30 Units) and 6 µl (60 Units) of the ARTseq Nuclease respectively. For example, 50 A260/ml lysate X 0.2 ml lysate X 5 Units/A260 ARTseq Nuclease = 50 Units ARTseq Nuclease.
2.
Incubate the reactions at room temperature for 45–60 minutes.
3.
Stop the reactions by adding 15 µl of SUPERase•In RNase Inhibitor and chill the samples on ice.
4.
Purify 100 µl of each reaction using the MicroSpin S-400 columns and extract RNA as described in Part 2.1 through 2.8 of the standard procedure. Freeze the remaining sample in liquid nitrogen and store at –80°C.
5.
Prepare ARTseq RNA Control, Ribosome Protected Fragment samples, and ladder for PAGE gel. A. Add 1 µl of the ARTseq RNA Control from the kit to a 0.5 ml tube. Add 9 µl of denaturing gel loading dye. B. For each of the resuspended Ribosome Protected Fragment (RPF) samples from Appendix 4.4, mix 250 ng with denaturing gel loading dye up to 10 μl final volume. C. Prepare a ladder aliquot (2 μl IDT 20/100 ladder, 3 μl water, and 5 μl denaturing gel loading dye).
6.
Heat all samples to 95°C for 5 minutes. Place the tubes immediately on ice. The ARTseq RNA Control (28 nts and 30 nts) oligo will be used for size marker.
7.
Load 10 µl aliquots of each sample onto a 12 or 15% Urea-Polyacrylamide gel. Run the gel at 180V until bromophenol blue band reaches bottom of the gel (~210V*hr; 180V for 70 min). Stain the gel with SYBR Gold. Visualize gel with UV light or Dark Field Transilluminator.
8.
Continue Ribo-Zero rRNA removal (Part 3.A) with the titrated sample from Appendix 4.4 that has a distinct RPF band similar to the bracketed region of the 60 Unit sample shown in Figure 2.
Figure 2. Denaturing PAGE analysis of the effect of increasing amounts of ARTseq Nuclease on Ribosome Protected Fragment recovery. 60 Units of ARTseq Nuclease was optimal to observe RNase-resistant material corresponding to the size of RPFs (bracket).
14
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
Appendix 5. Effect of over-amplifying Ribosome Protected cDNA. Over-amplification of the Ribosome Protected Fragments in Part 10 (PCR Amplification) can lead to the appearance of higher-thanexpected amplicons, smeared amplicons and adapter-dimer products. In the example shown, 9 cycles of PCR yielded the optimal amount of the expected PCR product.
Figure 3. Effect of PCR cycle number on product size. “+” libraries were prepared from the 28 nt ARTseq Control RNA; “-“ negative control (no RNA) library (band appearing at ~120 bp in 12 and 15 cycles is adaptor dimer); S1 and S2; Ribosome protected samples.
Appendix 6. BioAnalyzer profiles of ARTseq libraries and optional gel purification.
A
B
Figure 4. BioAnalyzer profiles of ARTseq libraries. ARTseq libraries made from two Ribosome Protected mRNA samples, amplified for nine cycles of PCR and purified using AMPure beads. Samples were analyzed by Agilent High Sensitivity DNA Assay. A) A ‘good’ sample. The ~140-160 bp peak is the expected size range and no further purification needed. B) A sample containing an excessive amount of adaptor dimer amplified product (~120 bp) compared to the desired product (~140-160 bp). This sample should be purified further using the PAGE purification procedure.
[email protected] • (800) 284-8474
15
ARTseq™ Ribosome Profiling Kit (Mammalian)
PCR PAGE Purification 1. Prepare samples, positive control, and ladders for PAGE gel. A. For each ~25 µl PCR sample to be purified and the amplified positive control, add 6 µl of Native Gel Loading Dye containing Bromophenol Blue. B. Separate samples with a 5 µl 20 bp ladder aliquot or an aliquot of diluted 1 µl Native Gel Loading Dye containing Bromophenol Blue, 5 µl water. 2.
Load 15 µl per lane (samples split across two lanes) of a 6 or 8% Native PAGE-1xTBE gel using a ladder or Native Gel Loading Dye containing Bromophenol Blue aliquot between samples to avoid cross contamination.
3. Adjust to 200V and run gel until Bromophenol Blue dye reaches the bottom of the gel (~83V*hr; 200V for 25 min). Stain gel with SYBR gold and visualize under Dark Field Transilluminator. Note: Chill SYBR gold solution and stain gel at 4°C to avoid diffusion of signal in gel. 4. Excise the uppermost band (~140-160 bp) being careful to avoid the adaptor dimer (~113 bp). 5.
Transfer the gel slices to a 0.5 ml tube with hole punched in bottom with a 20 gauge needle and close cap. Place the 0.5 ml tube inside of a 1.5 ml tube and centrifuge for 2 minutes at ~12,000 xg in a table top microfuge to disrupt gel slice.
6. Remove and discard the 0.5 ml tubes. To the 1.5 ml tubes, add:
400.0 µl Nuclease-Free Water 40.0 µl 5M Ammonium Acetate ~2.0 μl 10% SDS Gently rock the samples at 37°C for ~1 hour (or overnight at room temperature) to elute the PCR products from the disrupted gel slices.
7. Transfer the slurry to new 1.5 ml filter tubes and centrifuge for ~3 minutes at 2,000 xg to separate the disrupted gel pieces from the eluted PCR product solution. 8. Use a large orifice 1 ml pipette tip or trim the end of a 1 ml pipette tip. Carefully pipette the aqueous solution to new 1.5 ml tubes. To each, add 2 µl Glycogen and 700 µl 100% Isopropanol Alcohol. Mix each tube and store at –20°C for >1 hour. Note: It has not been observed that the addition of Glycogen has interfered with downstream applications. However, some prefer to use GlycoBlue™ with a dye added to better visualize the pellet. This is not advised for this step since the dyes can interfere with the quantification of nucleic acid concentration. 9. Centrifuge the tubes at >12,000 xg at 4°C for 15 minutes to pellet the PCR products. Wash the pellet with cold 80% Ethanol and air dry. 10. Resuspend the pellet in 15 µl of Nuclease-Free Water or 10 mM Tris-HCl pH 8.0. Pool tubes of same sample together (sample volume = 30 μl). 11. Check 1 μl of each. Sample on the BioAnalyzer using the Agilent High Sensitivity DNA Assay. (see Figure 4).
16
www.epicentre.com
ARTseq™ Ribosome Profiling Kit (Mammalian)
Appendix 7. Positive and Negative Controls. Note: CtrlP and Sample cDNA at 70-100 nt may/may not be visible on purification gel. Continue to excise gel regions within this range. The ladder is overloaded to make size selection easier but tends to make visualization of the cDNA bands difficult.
Figure 5. PAGE purification of cDNA. The cDNA reactions from the CtrlN (lanes 2 & 3) and CtrlP (lanes 5 & 6) samples from Part 8.6 of the protocol. To purify, excise gel regions corresponding to sizes ~70-80 nt for RPF samples and the CtrlN and CtrlP samples (see white dotted lines) and extract the cDNA as described in the protocol. 73 and 75 nt cDNA products should be observed in the CtrlP lane(s) corresponding to the 28 nt and 30 nt control RNA oligos. For Ribo-Zero treated Total RNA samples, excise the size range ~80-100 nt and extract the cDNA as described in the protocol.
Appendix 8. Purify Monosomes by Sucrose Cushion 1.
For each sample, prepare 1ml of Sucrose Cushion Buffer as follows:
200.0 μl 5X Mammalian Polysome Buffer 0.5 g Sucrose 5.0 μl SUPERase•In (20 U/μl) 140.0 μl MgCl2 (25 mM) 5.0 μl DTT (100 mM) 2.0 μl Cycloheximide (50 mg/ml) Bring solution up to 1 ml with Nuclease-Free Water.
2.
Carefully layer 200 μl of the ARTseq Nuclease/SUPERase•In treated lysate over 1 ml of ice cold Sucrose Cushion Buffer in an appropriate ultracentrifuge-compatible tube.
3.
Pellet the ribosomes by centrifugation at 4°C for 4 hours at 70,000 rpm in a TLA-110 rotor.
4.
Remove the supernatant and resuspend the RNA pellets in 100 μl Nuclease-Free Water or 10 mM Tris-HCl pH 7.0. Add 10 μl of 10% SDS. This material will be used as "Ribosome Protected RNA." Store samples at –80°C or proceed to next step.
5. Purify both Total RNA samples and Ribosome Protected RNA samples: A. Purify the Total RNA samples using the Zymo Research RNA Clean & Concentrator kit. Follow the kit protocol for >200 nt RNA. Elute the samples from the columns with 26 µl Nuclease-Free Water (expect to recover ~25 µl). B. Purify the Ribosome Protected RNA samples using Zymo RNA Clean & Concentrator-25 kit using a modified protocol optimized for small fragment purification:
6.
a) In Zymo protocol Step 1, use 220 μl Binding Buffer (from Zymo Kit)
b) In Zymo protocol Step 2, use 495 μl Absolute Ethanol
c) Continue with purification according to the manufacturer’s instructions
d) Elute the samples with 26 µl of Nuclease-Free Water (expect to recover ~25 µl)
Quantify by NanoDrop. You will need about 1-5 μg of Total RNA and 1-5 μg Ribosome Protected RNA for the Ribo-Zero rRNA removal treatment in Step 3. A. If < 1-5 μg of Total RNA has been collected, repeat step 1.A.9 with unused clarified lysate to achieve desired amount. B. If < 1-5 μg of Ribosomal Protected RNA has been collected, repeat step 1.B and 2.B with unused clarified lysate to achieve desired amount.
7.
Continue to Step 3.A. Removal of rRNA using Ribo-Zero.
Reference: Ingolia, N.T. Genome-Wide Translational Profiling by Ribosome Footprinting. Methods in Enzymology 470:119-142 (2010).
[email protected] • (800) 284-8474
17
ARTseq™ Ribosome Profiling Kit (Mammalian) ARTseq and Ribo-Zero are trademarks of Epicentre, Madison, Wisconsin. Agencourt and AMPure are registered trademarks of Beckman Coulter, Inc., Brea, California. Illumina is a registered trademark and MiSeq and TruSeq are trademarks of Illumina, Inc., San Diego, California. NanoDrop is a registered trademark of NanoDrop Technologies, Inc., Wilmington, Delaware. Phusion is a registered trademark of NEB, Ipswich, MA. SYBR is a registered trademark of Molecular Probes, Inc., Eugene, Oregon. Clean & Concentrator is a trademark of Zymo Research Corp., Irvine, CA. Illustra and MicroSpin are trademarks of GE Healthcare, Fairfield, CT. GlycoBlue is a trademark of Life Technologies, Carlsbad, CA. SUPERase∙In is a trademark of Life Technologies, Carlsbad, CA.
Visit our technical blog: epicentral.blogspot.com
18
www.epicentre.com
