matic fever, scarlet fever, and toxic shock syndrome have been suggested (3, 5, 12, 20). SLO is defined as a toxic, immunogenic protein released into the ...
INFECFION AND IMMUNITY, Sept. 1994, p. 4000-4004
Vol. 62, No. 9
0019-9567/94/$04.00+0 Copyright C) 1994, American Society for Microbiology
The Gene Encoding a New Mitogenic Factor in a Streptococcus pyogenes Strain Is Distributed Only in Group A Streptococci TAKASHI YUTSUDO,l* KOICHI OKUMURA,1 MAKOTO IWASAKI,1 AYAKO HARA,' SHIGEKI KAMITANI,2 WAKIO MINAMIDE,2 HISANAGA IGARASHI,' AND YORIO HINUMA' Shionogi Institute for Medical Science' and Shionogi Biomedical Laboratories,2
2-5-1 Mishima,
Settsu, Osaka 566, Japan
Received 27 April 1994/Returned for modification 10 June 1994/Accepted 30 June 1994
We recently cloned a gene encoding a new mitogenic factor (MF) from Streptococcus pyogenes NY-5. In the we determined the distribution of this MF gene (ml) by PCR based upon its sequence. Of 371 streptococcal group A strains isolated from clinical specimens, 370 (99.7%) were positive for mf. The strain that was negative for the MF gene was also negative for the streptolysin 0 gene (slo). Some streptococcal strains belonging to groups C and G were negative for mf but positive for slo. Group B strains were negative for both. Furthermore, we examined the presence of mf in 54 strains belonging to 28 families and found mf only in group A streptococci. These results indicate that mf is distributed specifically in group A streptococci and the presence of mf in clinical samples strongly suggests infection with group A streptococci. present study,
Streptococcus pyogenes group A produces more than 20 extracellular proteins, some of which are toxins, mitogens, or enzymes, whereas the characteristics of others remain unknown (2, 29). Streptolysin 0 (SLO) and streptococcal pyrogenic exotoxin (SPE) (or erythrogenic toxin) have been characterized, and roles for SLO and SPE (or erythrogenic toxin) in the pathogenesis of streptococcal infections such as rheumatic fever, scarlet fever, and toxic shock syndrome have been suggested (3, 5, 12, 20). SLO is defined as a toxic, immunogenic protein released into the extracellular medium by most strains of group A streptococci, as well as many strains of group C and G streptococci, particularly those causing human infections. Determination of anti-SLO antibody is diagnostic for streptococcal infections (9, 25, 27). SPE is considered to be a pathogenic agent of scarlet fever and has biological activities such as pyrogenicity, mitogenicity, enhancement of susceptibility to endotoxin shock, suppression of immunoglobulin M production, and enhancement of immunoglobulin G production. Three serologically distinct SPEs, SPEA, SPEB, and SPEC, have been reported (4, 18, 24), and the nucleotide sequences of the genes that encode them have been determined (11, 13, 16, 30). It is known that SPEs, staphylococcal toxic shock syndrome toxin 1, and enterotoxins A to E make up a family of superantigens (14, 21) that stimulate T cells by cross-linking variable parts of the T-cell receptor with major histocompatibility class II molecules on accessory cells (1, 6-8, 26, 31). We recently reported a novel mitogenic factor (MF) purified from a culture supernatant of S. pyogenes NY-5 (28), and the nucleotide sequence of the gene encoding the MF (mf) was determined (15). Here, we examined the distribution of mf in various strains by using PCR. The results indicate that mf is distributed only among group A streptococcal strains. MATERIALS AND METHODS Bacterial strains. A total of 371 clinical isolates of S. pyogenes and 15 streptococcal strains belonging to other groups were provided by Y. Takeda (Faculty of Medicine, Kyoto University, Kyoto, Japan). Twelve streptococcal strains were supplied by the Institute of Medical Science, University of *
Corresponding author. Phone: 81-6-382-2612. Fax: 81-6-382-2598.
Tokyo, Tokyo, Japan. Eleven strains belonging to various families were provided by T. Honda (Research Institute for Microbial Diseases, Osaka University, Osaka, Japan). S. pyogenes NY-5 was provided by T. Nakahara (Saitama College of Health, Urawa, Japan). S. sanguis SSH-83 and KIH-T were provided by S. Hamada (Faculty of Dentistry, Osaka University). Detection by PCR. Bacteria were cultured with 5 ml of brain heart infusion broth (Difco Laboratories, Detroit, Mich.) for 24 h with shaking. Ten microliters of the bacterial culture was suspended in 100 ,ul of T,0E, buffer (10 mM Tris-HCl [pH 7.4], 1 mM EDTA) and boiled in a water bath for 5 min. Two microliters of DNA (equivalent to the 104 cells) of the boiled solution was amplified for 30 cycles by PCR in a 50-,ul reaction mixture containing 200 ,uM deoxynucleoside triphosphates, 0.25 U of AmpliTaq DNA polymerase (Takara Shuzo Co. Ltd., Kyoto, Japan), and 5 ,ul of 1ox PCR buffer (100 ,uM Tris-HCl [pH 8.3], 500 ,uM KCl, 15 ,uM MgCl2, 0.1% gelatin) on a TSR-300 thermal sequencer (Iwaki Glass Co. Ltd., Tokyo, Japan). The oligonucleotide primers were synthesized with a Cyclone Plus DNA synthesizer (Milligen/Biosearch). The primer sequences for mf and slo (the gene encoding SLO) are presented in Table 1. The working concentration of each primer was 1 ,uM. The temperature cycles used were as follows: 94°C for 40 s, 55°C for 90 s, and 72°C for 60 s for the MF gene and 94°C for 60 s, 52°C for 90 s, and 72°C for 90 s for the SLO gene. Amplified DNA fragments were promptly subjected to agarose gel electrophoresis to avoid degradation of PCR products (see Discussion). Forty-three bacterial strains (see Table 4) were cultured with tryptic soy agar containing horse blood. A colony was suspended in 500 pAl of distilled water, the turbidity was adjusted to a no. 1 McFarland standard (Eiken Chemical Co., Ltd., Tokyo, Japan), and then the colony was boiled for 10 min. Five microliters of the boiled material was used as a template for PCR. The primer sequences for the 16S and 23S rRNA reference genes are also presented in Table 1. The temperature cycles used were as follows: 94°C for 60 s, 62°C for 30 s, and 72°C for 120 s for 40 cycles for 16S rRNA and 95°C for 70 s, 62°C for 80 s, and 72°C for 50 s for 30 cycles for 23S rRNA (19, 23). Because of the extreme sensitivity of the PCR method, it was important to exclude potential false positives arising from contamination of samples. Thus, sample preparation was done 4000
4001
NEW MITOGENIC-FACTOR-ENCODING GENE IN S. PYOGENES
VOL. 62, 1994
TABLE 1. Sequences of the primers used for PCR amplification of the target genes Target gene
Amplicon size (bp)
Sequencea (5'-3')
Primer
808
MF-1 MF-2
ATGAATCTACTT7GGATCAAGA
SLO-1 SLO-2
AGAACACAATATACTGAATCAATGGGT
16S rRNA
Myco up Myco dw
AGAG'TfTGATCCT7GGCICAG GCCGTGAGATTlCACGAACA
600
23S rRNA
P23L189 P23R821
GAACTGAAACATCITAAGTACCC AGCl'l'CGGGGAGAACCAGCTA
633
mf slo
GAGTAGGTGTACCGT[ATGG 868
ACTTIrCGCCACCA7TCCCAAGC
a The sequences of the primers of the target genes, mf and slo, were designed in accordance with the descriptions of Iwasaki et al. (15) and Kehoe et al. (17), respectively. The sequences of the primers of the reference genes, those for the 16S and 23S rRNAs, were described by Kusunoki et al. (19) and Sawada et al. (23), respectively.
in a laminar-airflow biosafety cabinet in a biosafety level 2 facility and PCR was performed in a separate room. Southern hybridization. The DNA in gel was denatured in an alkaline solution and transferred to a nylon membrane (Hybond-N+; Amersham Int. plc., Amersham, United Kingdom). Hybridization was carried out in solution (6x SSC [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 5x Denhardt's solution, 0.5% sodium dodecyl sulfate [SDS], 0.5 mg of heparin per ml) at 65°C overnight. The probe for hybridization was prepared as follows. mf was amplified by PCR with the primers described in Table 1 and with the genomic DNA extracted from S. pyogenes NY-5 as the template. The amplified DNA fragment, whose sequence was confirmed by direct sequencing with the dsDNA Cycle Sequencing System (Bethesda Research Laboratories, Inc., Gaithersburg, Md.), was labeled with the Multiprime DNA Labeling System (Amersham) with [a-32P]dCTP (111 TBq/ mmol; Du Pont/NEN Research Products, Boston, Mass.) as the probe. After hybridization, the membrane was washed with 2x SSC-0.5% SDS at room temperature for 5 min and twice with lx SSC-0.5% SDS at 42°C for 15 min each time. After that, the membrane was rinsed with 0.1X SSC-0.5% SDS at 42°C for 1 h. The hybridization signal was visualized with a FUJIX BA100 Bio-Image Analyzer (Fuji Photo Film Co. Ltd., Tokyo, Japan) and also by exposure to X-ray film (Eastman Kodak Co., Rochester, N.Y.). Nucleotide sequence accession numbers. The group C and G slo nucleotide sequence data are in the DDBJ, EMBL, and GenBank databases under accession numbers D16824 and D16825, respectively, and the B. cereus hemolysin nucleotide sequence data have been assigned accession no. D21270.
with Southern hybridization, is sensitive enough to detect mf in a single cell. Distribution of the MF gene in clinical isolates of S. pyogenes. A total of 371 group A strains isolated from clinical samples were studied. Among these, 370 isolates (99.7%) were positive for both mf and slo as revealed by PCR with Southern hybridization. One isolate was negative for both mf and slo. This isolate was bacteriologically, serologically, and biochemically re-evaluated, and we confirmed that it was an S. pyogenes strain. These 370 isolates were also tested for the other SPE genes (25b). The frequencies of detection of the other spe genes were 12.9% (48 strains) for speA, 98.9% (367 strains) for speB, and 71.2% (264 strains) for speC. The most predominant among the three spe genes was speB, although the frequency of speB (98.9%) was less than that of mf (99.7%). Distribution of the MF gene in other groups of streptococci and in various bacterial families. Figure 2 shows representative PCR results of detection of mf and slo in various groups of streptococci, and Table 2 summarizes the PCR data together with those on hemolytic activity. A total of 25 strains were studied: 7 of group B (1 standard strain and six clinical isolates), 7 of group C (three standard strains and four clinical isolates), 3 standard strains of group D (group D streptococcal strains were transferred to the genus Enterococcus according to Bergey's Manual of Systematic Bacteriology [25a]), 7 of group G
1B
(A\) r S. pt) 'C2cL'.%
VS
-l Lf-
RESULTS
Specificity and sensitivity of the PCR procedure. Overnight cultures of S. pyogenes NY-S were processed by PCR to detect mf as described in Materials and Methods. The detection sensitivity of the PCR was evaluated with serially diluted S. pyogenes cultures containing various numbers of viable cells. As shown in Fig. 1, the predicted 808-bp band was amplified from S. pyogenes but not from the control, Eschenichia coli. Southern hybridization (Fig. 1B) showed that the amplified 808-bp bands were derived from mf, confirming the PCR specificity. Specific PCR products were detected in samples containing more than 500 cells by ethidium bromide staining and in samples containing just 1 cell by Southern hybridization. The results showed that our PCR procedure, complemented
m\
x Wx k%V
W .
U-
V-.
v k
X ..
M
_C-4
f)
C4
-
;e x V1, V
Ic
11-
V-
v-
r)
X X
86 8 bp
+a
+b
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
a Two stained bands appeared on an agarose gel. One band was identical in size to the sio gene, whereas the other band was smaller, as shown in Fig. 3. b Two bands were evident on an agarose gel. They were both smaller than the slo gene (Fig. 3). c Provided by S. Hamada. The other strains were supplied by T. Honda.
(Fs) 2 3 4
mf
6 7 -,I 8 91 011 1 21 3 1 4
o
FIG. 2. Detection of mf (A) and slo (B) in various streptococcal groups by PCR. Lanes: 1, S. intermedius SIM446 (group not identified); 2, S. pyogenes SIM779 (group A); 3, S. equisimilis SIM780 (group C); 4, S. equisimilis SIM781 (group C); 5, Enterococcus durans SIM791; 6, S. pyogenes SIM793 (group A); 7, S. canis SIM794 (group G); 8, S. zooepidemicus SIM795 (group C); 9, Enterococcusfaecium SIM796; 10, S. canis SIM797 (group G); 11, S. agalactiae SIM798 (group B); 12, Enterococcus faecalis SIM799; 13, S. pyogenes NY-5 (group A); 14, Escherichia coli; M, HaeIII-digested 4)X174 DNA molecular size markers. The values, 808 and 868 bp, to the left of the panels represent the theoretical sizes of amplified mf (A) and slo (B).
(2 standard strains and five clinical isolates), and 1 unknown strain. Of these 25 strains, none was positive for mf. A total of 13 strains of groups C and G were positive for slo. slo was not detected in one group C strain, S. zooepidemicus SIM795, even though it had hemolytic activity on a blood agar plate. The nucleotide sequence data for slo of groups C and G showed that they share more than 95% homology with that of S. pyogenes (22). Several standard strains, including those belonging to other families, were also examined (Table 3). All were negative for mf. Bacillus cereus RIMD206001 and Enterococcus faecalis RIMD3116001 were positive for slo. B. cereus showed two PCR-amplified bands on an agarose gel (Fig. 3). The band with the predicted size reacted with the slo probe by Southern hybridization, whereas the other band did not (data not shown). This hybridized DNA fragment amplified from B. cereus seemed to be a novel hemolysin gene because the nucleotide sequence of this fragment showed homology with that of the alveolysin gene of B. alvei (10). The PCR bands seen in E. faecalis did not hybridize with the slo probe, and the nucleotide sequences of these bands had no homology with
M
2 3 4 5 6 7 8
9
1O
12
13
TABLE 2. Detection of the genes encoding the MF protein and SLO in streptococci by PCR Bacteriuma
Streptococcus pyogenes SIM779 Streptococcus pyogenes SIM793 Streptococcus agalactiae SIM798 Streptococcus equisimilis SIM780 Streptococcus equisimilis SIM781 Streptococcus zooepidemicus SIM795 Enterococcus durans SIM791 Streptococcus canis SIM794 Streptococcus canis SIM797 Streptococcus intermedius SIM446 Enterococcus faecium SIM796 Enterococcus faecalis SIM799
Groupb mf slo
Hemolysisc
A A
+ +
+ +
+ +
B
-
-
-
+ +
-
-
+ +
+ + + + + +
NDd
-
-
D D
-
-
C C C D G G
a All strains were from the Institute of Medical Science, University of Tokyo. The strains and Lancefield serotyping groups were verified by Shionogi Biomedical Laboratories and corrected if necessary. b According to Lancefield group serotyping. c Hemolysis was observed around the colony on the blood agar base plate. d ND, not determined.
FIG. 3. PCR of slo from various bacterial strains. Lanes: 1, B. RIMD206001; 2, Pseudomonas aeruginosa RIMD1603002; 3, Salmonella enteritidis RIMD1933001; 4, Staphylococcus aureus RIMD310917; 5, E. faecalis RIMD3116001; 6, Streptococcus mutans RIMD3125001; 7, Micrococcus luteus RIMD1303002; 8, Corynebacterium diphtheriae RIMD343044; 9, Leuconostoc mesenteroides
cereus
RIMD1204002; 10, Streptococcus sanguis SSH-83; 11, Streptococcus sanguis KIH-T; 12, Streptococcus pyogenes NY-5; 13, E. coli; M, molecular size markers. The value at the right indicates the theoretical size of amplified slo.
NEW MITOGENIC-FACTOR-ENCODING GENE IN S. PYOGENES
VOL. 62, 1994
TABLE 4. Absence of the MF gene in all of 43 strains except S. pyogenes NY-5 Bacterium
rRNAa gene
mf
Aeromonas hydrophila ID-2 Bacillus cereus JCM2152 Bacillus subtilis JCM1465 Branhamella catarrhalis ATCC 25238 Citrobacter freundii CIb (SBL 1097)C
Clostridium perfringens CI(SBL 3098) Corynebacterium xerosis ATCC 373 Enterobacter aerogenes CI(SBL10105) Enterobacter cloacae CI(SBL10106) Enterococcus faecalis CI(SBL40102) Escherichia coli ATCC 25922 Flavobacterium sp. CI(SBL1024) Gordona sputi JCM3228 Haemophilus influenzae ATCC 10211 Kiebsiella pneumoniae CI(SBL10104) Legionella pneumophila CI(SBL1061) Micrococcus varians ATCC 15306 Mycobacterium avium CI(SBL 3223) Mycobacterium bovis GIFU12851 Mycobacterium chelonae CI(SBL 3216) Mycobacterium intracellulare CI(SBL 3224) Mycobacterium kansasii CI(SBL 3225) Mycobacterium tuberculosis CI(SBL 3222) Neisseria gonorrhoeae CI(SBL 2146) Neisseria meningitidis 1ID854 Nocardia asteroides JCM 3384 Pasteurella multocida CI(SBL1134) Proteus mirabilis CI(SBL1099) Pseudomonas aeruginosa ATCC 27853 Rhodococcus aichiensis CM 6046 Salmonella typhimurium ATCC 14028 Serratia marcescens CI(SBL 1100) Staphylococcus aureus ATCC 29213 Staphylococcus capitis ATCC 27840 Staphylococcus caprae CCM 3573 Staphylococcus epidermidis ATCC 14990 Staphylococcus haemolyticus ATCC 29970 Staphylococcus hominis ATCC 27844 Staphylococcus intermedius ATCC 29663 Staphylococcus saprophyticus ATCC 15305 Staphylococcus wameri ATCC 27836 Streptococcus pyogenes NY-5' Yersinia pseudotuberculosis CI(SBL 1038)
+
+
+ + +
+
The 23S rRNA gene was examined as an internal control for all but three strains. b CI, clinical isolate. Serial storage number of the clinical isolate at Shionogi Biomedical Laboratories (SBL). d The 23S rRNA gene was undetectable in this strain. The mycobacterial 16S rRNA gene was amplified instead of the universal 23S rRNA gene in this strain. This strain was used for purification of the MF protein as described a
previously (28).
that of slo (data not shown), suggesting that they were not related to slo. We performed further studies on the distribution of mf in an additional 43 standard laboratory strains and clinical isolates belonging to 23 families. Detection of genes for either 23S or 16S rRNA was done as a reference for DNA extraction. As shown in Table 4, mf was detected only in S. pyogenes even in this study.
DISCUSSION The distribution of mf and slo in various streptococci and in various bacterial strains belonging to other families was exam-
4003
ined by PCR. Essentially all of the clinical isolates of group A streptococci tested contained both mf and slo. In contrast, none of the other streptococci belonging to groups B, C, D, and G contained mf. slo was found in group C and G streptococci but not in groups B and D. The frequency of detection of mf was higher than that of any genes encoding SPE. In addition, mf was not found in 53 other strains belonging to 27 families except group A streptococci. These results indicate that mf is a useful marker for group A streptococci. When crude DNA extracts from bacteria having mf were used as templates, the PCR fragments were rapidly degraded and did not appear on agarose gels after 3 h of incubation. The degradation seems to be due to the heat-stable nuclease activity of the MF protein (15) which is secreted into culture supernatants and present in the PCR mixture. Thus, as described in Materials and Methods, we subjected the PCR products to agarose gel electrophoresis promptly after the PCR to avoid degradation of the amplified DNA fragments. When the culture supernatant was removed by centrifugation and the cells washed with buffer were used for DNA extraction, degradation of the PCR products was stopped (data not shown). Digestion with proteolytic enzymes, such as proteinase K and trypsin, was also effective in preventing degradation of the PCR products. One of these procedures is therefore necessary to avoid false-negative reactions caused by the nuclease activity of MF protein. Streptococci produce many extracellular proteins. In particular, group A streptococci are known to be very important pathogens. Such extracellular proteins with various biologic activities may play roles in the pathogenesis of group A streptococcal infection. Identification of mf specifically in group A streptococci and its high incidence in clinical isolates of group A streptococci suggest that the MF protein is important in the pathogenesis of streptococcal infections. Our PCR procedure for detection of mf should be useful for the diagnosis of streptococcal infections. ACKNOWLEDGMENTS We gratefully acknowledge Y. Takeda, T. Honda, S. Hamada, M. Yoshikawa, and T. Tomita for providing the reference strains. We also thank 0. Yoshie for critical reading of the manuscript. REFERENCES 1. Abe, J., J. Forrester, T. Nakahara, J. A. Lafferty, B. L. Kotzin, and D. Y. M. Leung. 1991. Selective stimulation of human T cells with streptococcal erythrogenic toxins A and B. J. Immunol. 146:37473750. 2. Alouf, J. E. 1986. Streptococcal toxins (streptolysin 0, streptolysin S, erythrogenic toxin), p. 635-691. In F. Dorner and J. Drews (ed.), Pharmacology of bacterial toxins. Pergamon Press, New York. 3. Bahr, G. M., A. M. Yousof, K. Behbehani, H. A. Majeed, S. Sakkalah, K. Souan, L. Jarrad, C. Geoffroy, and J. E. Alouf. 1991. Antibody levels and in vitro lymphoproliferative responses to Streptococcus pyogenes erythrogenic toxin A and mitogen of patients with rheumatic fever. J. Clin. Microbiol. 29:1789-1794. 4. Barsumian, E. L., C. M. Cunningham, P. M. Schlievert, and D. W. Watson. 1978. Heterogeneity of group A streptococcal pyrogenic exotoxin type B. Infect. Immun. 20:512-518. 5. Bohach, G. A., D. J. Fast, R D. Nelson, and P. M. Schlievert. 1990. Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnesses. Crit. Rev. Microbiol. 17:251-272. 6. Choi, Y., A. Herman, D. Diguisto, T. Wade, P. Marrack, and J. Kappler. 1990. Residues of the variable region of the T-cellreceptor P-chain that interact with S. aureus toxin superantigens. Nature (London) 346:471-473. 7. Dellabona, P., J. Peccoud, J. Kappler, P. Marrack, C. Benoist, and
4004
8. 9.
10.
11. 12.
13.
14.
15.
16.
YUTSUDO ET AL.
D. Mathis. 1990. Superantigens interact with MHC class II molecules outside of the antigen groove. Cell 62:1115-1121. Fleischer, B., and H. Mittrucker. 1991. Evidence for T cell receptor-HLA class II molecule interaction in the response to superantigenic bacterial toxins. Eur. J. Immunol. 21:1331-1333. Fox, K., J. Turner, and A. Fox. 1993. Role of beta-hemolytic group C streptococci in pharyngitis: incidence and biochemical characteristics of Streptococcus equisimilis and Streptococcus anginosus in patients and healthy controls. J. Clin. Microbiol. 31:804-807. Geoffroy, C., J. Mengaud, J. E. Alouf, and P. Cossart. 1990. Alveolysin, the thiol-activated toxin of Bacillus alvei, is homologous to listeriolysin 0, perfringolysin 0, pneumolysin, and streptolysin 0 and contains a single cysteine. J. Bacteriol. 172:73017305. Goshorn, S. C., and P. M. Schlievert. 1988. Nucleotide sequence of streptococcal pyrogenic exotoxin type C. Infect. Immun. 56:25182520. Hackett, S. P., and D. L. Stevens. 1993. Superantigens associated with staphylococcal and streptococcal toxic shock syndrome are potent inducers of tumor necrosis factor-,8 synthesis. J. Infect. Dis. 168:232-235. Hauser, A. R., and P. M. Schlievert. 1990. Nucleotide sequence of the streptococcal pyrogenic exotoxin type B gene and relationship between the toxin and the streptococcal proteinase precursor. J. Bacteriol. 172:4536-4542. Imanishi, K., H. Igarashi, and T. Uchiyama. 1990. Activation of murine T cells by streptococcal pyrogenic exotoxin type A. J. Immunol. 145:3170-3176. Iwasaki, M., H. Igarashi, Y. Hinuma, and T. Yutsudo. 1993. Cloning, characterization and overexpression of a Streptococcus pyogenes gene encoding a new type of mitogenic factor. FEBS Lett. 331:187-192. Johnson, L. P., J. J. L'Italien, and P. M. Schlievert. 1986. Streptococcal pyrogenic exotoxin type A (scarlet fever toxin) is related to Staphylococcus aureus enterotoxin B. Mol. Gen. Genet.
203:354-356. 17. Kehoe, M. A., L. Miller, J. A. Walker, and G. J. Boulnois. 1987. Nucleotide sequence of the streptolysin 0 (SLO) gene: structural homologies between SLO and other membrane-damaging, thiolactivated toxins. Infect. Immun. 55:3228-3232. 18. Kim, Y. B., and D. W. Watson. 1970. A purified group A streptococcal pyrogenic exotoxin. J. Exp. Med. 131:611-628. 19. Kusunoki, S., Y. Murata, W. Minamide, and K. Uchida. 1992. Rapid and direct detection of Mycobacterium tuberculosis complex and mycobacteria in sputum by advanced method, PCR. J. Jpn. Assoc. Infect. Dis. 66:1682-1691. 20. Lee, P. K., and P. M. Schlievert. 1989. Quantification and toxicity
INF'ECT. IMMUN.
of group A streptococcal pyrogenic exotoxins in an animal model of toxic shock syndrome-like illness. J. Clin. Microbiol. 27:18901892. 21. Marrack, P., and J. Kappler. 1990. The staphylococcal enterotoxins and their relatives. Science 248:705-711. 22. Okumura, K., A. Hara, T. Tanaka, I. Nishiguchi, W. Minanide, H. Igarashi, and T. Yutsudo. Cloning and sequencing the streptolysin O gene of group C and group G streptococci. DNA Sequence, in press. 23. Sawada, N., Y. Iwamura, T. Shimizu, and H. Hayashi. 1992. Detection and identification of pathogenic bacteria by polymerase chain reaction with primers from DNA sequence of ribosomal RNA. Jpn. J. Bacteriol. 47:607-616. 24. Schlievert, P. M., K. M. Bettin, and D. W. Watson. 1977. Purification and characterization of group A streptococcal pyrogenic exotoxin type C. Infect. Immun. 16:673-679. 25. Schwartz, R. H., R. J. Knerr, K. Hermansen, and R. L. Wientzen. 1993. Acute epiglottitis caused by 3-hemolytic group C streptococci. Am. J. Dis. Child. 136:558-559. 25a.Sneath, P. H. A., N. S. Mair, M. E. Sharpe, and J. G. Holt (ed.). 1986. Bergey's Manual of Systematic Bacteriology, vol. 2. The Williams & Wilkins Co., Baltimore. 25b.Takeda, Y., et al. Unpublished data. 26. Tomai, M. A., P. M. Schlievert, and M. Kotb. 1992. Distinct T-cell receptor VP3 gene usage by human T lymphocytes stimulated with the streptococcal pyrogenic exotoxins and pep M5 protein. Infect. Immun. 60:701-705. 27. Turner, J. C., A. Fox, K. Fox, C. Addy, C. Z. Garrison, B. Herron, C. Brunson, and G. Betcher. 1993. Role of group C beta-hemolytic streptococci in pharyngitis: epidemiologic study of clinical features associated with isolation of group C streptococci. J. Clin. Microbiol. 31:808-811. 28. Yutsudo, T., H. Murai, J. Gonzalez, T. Takao, Y. Shimonishi, Y. Takeda, H. Igarashi, and Y. Hinuma. 1992. A new type of mitogenic factor produced by Streptococcus pyogenes. FEBS Lett. 308:30-34. 29. Wannamaker, L. W. 1980. The extracellular products of group A streptococci, p. 177-184. In S. E. Read and J. B. Zabriskie (ed.), Streptococcal diseases and the immune response. Academic Press, Inc., New York. 30. Weeks, C. R, and J. J. Ferretti. 1986. Nucleotide sequence of the type A streptococcal exotoxin (erythrogenic toxin) gene from Streptococcus pyogenes bacteriophage T12. Infect. Immun. 52:144150. 31. White, J., A. Herman, A. M. Pullen, K Kub, J. W. Kappler, and P. Marrack. 1989. The VP-specific superantigen staphylococcal enterotoxin B. Cell 56:27-35.
