Pyrosequencing Protocol.pdf

A. J. McKnight March 2004

Pyrosequencing Protocol Intro:

Pyrosequencing™ is a practically simple technique for accurate and consistent analysis of short / medium length DNA sequences...a cascade reaction produces only a positive or negative result. The methodology used in Pyrosequencing technology was developed in 1996 by researchers at the Royal Institute of Technology in Stockholm, Sweden. Since then, Pyrosequencing AB in Uppsala, Sweden has continuously refined the methodology. Pyrosequencing AB was founded in 1997. Became Biotage AB in 2004.

Materials:

MonoShaker, Vacuum Pump, Heating block… PSQ 96 Plate PSQ HS Nucleotide Dispensing Tips (p/n 40 - 0029) PSQ HS Reagent Dispensing Tips (p/n 40 - 0030) PSQ 96 SNP Reagent Cartridge (p/n 60 - 0134) PSQ HS Dispensing Tip Holder Box (p/n 60 - 0133) PSQ HS Dispensing Tip Storage Box (p/n 60 - 0122) PSQ 96 Sample Prep Thermoplate (p/n 60 - 0123) 96 well PCR plate (p/n 40 - 0028) Adhesive lid Streptavidin Sepharose™ (# 17-5113-01 from Amersham) Binding Buffer – pH 7.6 (10 mM Tris-HCL; 2 M NaCl; 1 mM EDTA; 0.1 % TweenTM 20) Denaturation solution – 0.2 M NaOH Wash Buffer – pH 7.6 (10 mM Tris-Acetate) Annealing Buffer – pH 7.6 (20 mM Tris-Acetate; 5 mM MgAc2) Primers – one of which is biotinylated Enzyme - DNA Polymerase, ATP Sulfurylase, Luciferase & Apyrase Substrate - Adenosine 5'phosphosulfate (APS) + Luciferin 18.2 mΩ dd H2O

Safety Issues: ♦ ♦ ♦ ♦ ♦

Powder free gloves & lab coats should always be worn correctly Allow all reagents to come to room temperature before use. Safety goggles must be worn when using reagents Read applicable MSDS sheets before handling reagents Specific fume hood regulations should be followed and the appropriate usage sheet signed

1

A. J. McKnight March 2004

Primer Design: Check for validated designs on Pyrosequencing website. Primer Design for PCR Product… 1. Shorter PCR fragments are optimal (< 200 bp) facilitating easier amplification, improved resolution and decreased bead consumption. Fragments up to 500 bp may be OK. 2. One primer (opposite sequence primer) should be biotin labelled for immobilisation to sepharose beads. ¾ Length = 18 – 24 bases ¾ Tm = 62 – 68 oC ¾ ≈ GC – AT distribution within primers where possible – preferably more GC rich in 5’ end and less in 3’ end for improved specificity. Try to avoid 3' GT. ¾ Avoid background signals from template loops with 6 bp match in 3` end. ¾ Kcal/mol of < 10 is preferable. ¾ Avoid primer dimer formation where possible ¾ HPLC purify biotinylated primer to improve signal strength. Free biotin will compete with biotinylated PCR product for streptavidin binding, thereby lowing signal intensity. ¾ Non-biotinylated primer should have NN tail added to 5' end to minimise template loops. 3. Check biotinylated primer carefully for hairpin loops and duplexes as excess biotinylated primer will cause background in pyrosequencing assay. 4. Biotinylated primers are particularly sensitive to storage so limit freeze / thaw cycles to a maximum of three and store in freezer (NOT fridge). Primer Design for Sequencing… 1. Optimal primer design software at http://techsupport.pyrosequencing.com - accessible to registered users only. 2. Copy and paste sequence of interest into the online software with the SNP positions noted by IUAPC codes – the program will accept regions up to 700 bases long, but < 200 bp is preferable. Name the SNP and “submit” for analysis. 3. The program will generate primers with a rating based on primer sequence, length, quality which may be examined by selecting, “Analysis Result, Detailed”. The program algorithm rates primers conservatively so medium or low scoring primers may be OK based on the general guidelines. 4. For SNP analysis, the sequencing primer should be positioned within 5 bases of the SNP. Ideally, there would be one base between the primers and SNP of interest, but the shorter the read, then the quicker the run time. 5. Follow the same design principles as above, but Tm may be lowered if required – primers with Tm = 40 oC are apparently being used with good results. The 3’ end should be as clean as possible. If unavoidable up to 5 C, G, T or 3 A polymers are acceptable. Longer polymers are beyond the pyrosequencer’s accurate range. 2

A. J. McKnight March 2004

6. The program does not consider the position of potential template loops… actual risk of background is considerably higher if the stabilising bonds are clustered together and / or concentrated at the 3’ end. e.g. GAGAAACAGGGAGCCAAGAA TCCCTC TCCCCAGT

PCR Procedure: 1. Design required 3 primers (above) and label primers as follows: ¾ Biotinylated primer = Gene name / unique ID / Biotin ¾ Sequencing primer = Gene name / unique ID / Sequence ¾ Opposite PCR primer = Gene name / unique ID / PCR 2. Primers are currently ordered online from Biomers.net. Previously from ThermoHybaid online - Quote Reference # 0301001. 3. Prepare stock primer solutions at 100 µM with dd H2O. Further dilute the sequencing primer stock to 10 µM in annealing buffer. 4. Optimise PCR reaction (as below) for a strong PCR product of appropriate size with no excess primers or non-specific product apparent on 2.0 % agarose gel.

Pyrosequencing Software: 1. Double click the icon on the desktop to open the program – contact PI to obtain the username and password required for access. 2. Selected results may be output from this software to any package of choice. There is also a data exchange facility for import / export / backup between oracle databases. 3. The database should be fully backup up regularly.

Entering a new analysis region… 1. Input new regions under the “Sequence” tab. Copy and paste the sequence of interest, noting the forward and reverse primer names and sequences in appropriate boxes. Name the region and the position of known polymorphisms where necessary. 2. Highlight the sequence to analyse by pressing and holding the left mouse button – drag to lower grey area and release mouse button. The primer sequence and sequence should appear where described and the sequence primer highlighted in red in the input sequence above. Sequence primer and name may be edited where required.

3

A. J. McKnight March 2004

Entering a new assay… 1. Input new assays under the “Simplex Entries” or “Multiplex Entries” tab depending on the intended number of single or multiple SNP assays. 2. Name the assay and drag the pre-programmed sequence to analyse from the left window / frame in the software. 3. Click the “dispensation order” and the software will generate an appropriate nucleotide dispensation order for the assay. Verify the dispensation is reasonable and view the expected outcome by selecting the “histogram” button. Running an assay… 1. Place prepared plate into the instrument using the software to raise and lower the lid (“Open / Close” under the “Instrument” tab). 2. Perform “Tip Test” as when reagents were loaded. 3. Open previously setup assay, check appropriate figures and select, “Run”. 4. The pyrogram will be displayed throughout the run. When completed, select “OK” to close the run. Highlight appropriate wells with the mouse and selected, “Analyse” to check the computer’s prediction of results. If successful, a summary of genotypes may be found under the “Statistics” tab. Optimise a new assay using the AQ analysis tab.

Pyrosequencing Preparation: ¾ The substrate peak is pyroP contamination in the reaction - contamination from buffers in samples prep (esp. annealing buffer). The substrate peak is a good indication that the PCR reaction has been 'cleaned' from any PyroP before the addition of nucleotides. Height of peak depends on prep conditions and PCR optimisation. ¾ The rate of dNTP degradation by apyrase is slower than the rate of dNTP incorporation by polymerase, favouring sufficient incorporation of dNTPs. ¾ The rate of ATP synthesis by sulfurylase is faster than the rate of ATP hydrolysis by apyrase so that [ATP] and light production are ∝ to number of dNTPs incorporated. 1. Set the PE 9700 to continuous 80 oC and heat the pyrosequencing iron on top of the block. 2. Shake bottle of streptavidin sepharose beads until homogeneous solution is obtained. Pipette 2ul of bead solution into 38 µl of binding buffer (per sample volumes) to create sufficient mastermix - may be stored in the fridge for several days. 3. Depending on the strength of PCR reaction, place 5 – 15 µl of PCR product into a 96 well plate and make up to 40 µl with 18.2 mΩ dd H2O. 4

A. J. McKnight March 2004

4. Shake the bead mix and pipette 40 µl into each well containing PCR product. Place plate on Monoshaker at maximum setting and agitate for at least 5 minutes to maintain dispersion of beads. 5. Prepare mastermix of 0.3 µM sequencing primer in 15 µl of annealing buffer and pipette 15 µl into appropriate wells of the white pyrosequencing reaction plate. 6. Place clear troughs into appropriate spaces on black rack with the extra water trough laid to the right. Fill with ~ 180 ml of 18.2 mΩ water, 70 & ethanol and wash buffer respectively. Add ~ 120 ml of denaturation solution and 18.2 mΩ water to the remaining toughs. 7. Prime the vacuum prep tool (VPT) by placing in water to wash filter probes. Switch the Monoshaker off and place plate on bench. Lower VPT into the plate and ensure all liquid has been sucked uniformly across the plate – capture must occur within 3 minutes of ceased agitation. 8. Move VPT though:

70 % ethanol – 5 seconds Denaturation solution – 5 seconds Wash Buffer - 5 seconds

9. Tip the VPT backwards beyond the vertical to drain remaining liquid from the tubes. Return to the horizontal and release the vacuum. 10. Place the VPT into the white plate and gently agitate the tool. Move the VPT in concentric circles and gently tap within the wells to release the beads into the sequencing primer. 11. Turn the vacuum on and drain the remaining water trough with the VPT. Turn the pump off and return VPT to the pink trough for storage. 12. Cover plate with adhesive film and heat at 80 oC for 4 minutes using the pyrosequencing iron on the PE 9700. Remove plate from heat and allow to cool to rtp before placing in the instrument. PSQ™ Reagent Dispensing…Filter Tips should NOT be used. ¾ Reagent kit (p/n 40-0024) contains sufficient reagents for 30 * 96 samples on the PSQ HS 96A system ¾ Store nucleotides and freeze dried enzyme & substrate (lights) mixtures at 4 – 8 oC. until expiry date on kit (< 1 year) ¾ It is not recommended to subject frozen reagents to more than 2 freeze / thaw cycles and under no circumstances should nucleotides be frozen ¾ The Cartridge should be stored in the Tip Box Holder when not in the instrument, as should the tips in the Tip Storage Box. Transport assembled dispensing cartridge in

5

A. J. McKnight March 2004

PSQ HSdispensing tip box holder when not in use to prevent dust particles clogging the tip heads of NDTs. ¾ RDTs should be used no more than 20 times 1. Dissolve the enzyme / substrate in 620 µl of 18.2 mΩ dd H2O and swirl gently to mix solution. Do Not vortex. 2. Leave reagents at rtp for 5 – 10 minutes before loading….may be stored for up to 5 days at 4 – 8 oC or may be frozen at -20 oC for long term storage. 3. Hold enzyme needle tipped and pipette required amount smoothly down the narrowest corner of the needle to avoid air bubbles in the solution. Fill the substrate and nucleotide needles in the same manner and load into the reagent cartridge as each tip is filled. ES on top & ACGT below:

4. Load filled cartridge into the pyrosequencer head and perform “Tip Test”. Open the pyrosequencer software by double clicking the desktop icon. Under the “Instrument” tab select “Test”. Insert a blank plate under the hood and click, “OK”. The pyrosequencer will dispense liquid from each tip – when run has finished, click, “OK” and remove test plate. Check plate has droplets in appropriate wells: D5 – Enzyme D8 – Substrate E5 – A E6 – C E7 – G E8 _ T If test is successful, then proceed with run. If not, then clean the needles and repeat. If needles persist in blocking, then replace from stocks. 5. For re-use within the hour, store the cartridge at rtp and run tip test before further use. For reuse > 1 hour, < 24 hours later, clean RDTs and store with NDTs in box in the fridge. For reuse > 24 hours later, clean both RDTs and NDTs immediately after use. 6. Fill RDTs with 18.2 mΩ water and shake empty down the sink. Repeat three times. Fill each needle with water and cover top hole to squirt water through the tip head and ensure no blockages. Store needles in black storage box and ensure outer cover of needles is dry before use.

6

A. J. McKnight March 2004

Allele Quantitation ¾ Check for validated designs on Pyrosequencing website: publications, protocols and assay design. ¾ Applications:

Association studies in DNA pools SNP confirmation ⇒ use 10 DNA to assess pools CpG methylation ⇒ treat with bisulfite & measure C>T SNP Hematopoetic chimerism Heteroplasmy in mtDNA etc…

¾ Recent Publications: o

Lavebratt C, Sengul S, Jansson M, Schalling M. Pyrosequencing trade mark -based SNP allele frequency estimation in DNA pools. Hum Mutat., Jan 2004; 23(1): 92-7.

o

Shifman S, Pisante-Shalom A, Yakir B, Darvasi A. Quantitative technologies for allele frequency estimation of SNPs in DNA pools. Mol Cell Probes. 2002 Dec;16(6):429-34.

o

Inbar E, Yakir B, Darvasi A. An efficient haplotyping method with DNA pools. Nucleic Acids Res 2002 Aug 1;30(15):e76

o

Wasson, J., Skolnick, G., Love-Gregory, L., Permutt, M.A. Assessing Allele Frequencies of Single Nucleotide Polymorphisms in DNA Pools by Pyrosequencing Technology. BioTechniques 32:1144-1152 (May 2002)

o

Neve, B., Froguel, P., Corset, L., Vaillant, E., Vatin, V., Boutin, P., Rapid SNP Allele Frequency Determination in Genomic DNA Pools by Pyrosequencing. BioTechniques 32:11381142 (May 2002)

o

Gruber JD., Colligan PB., Wolford JK., Estimation of single nucleotide polymorphism allele frequency in DNA pools using Pyrosequencing. Human Gen. 2002 May; 110:395-401

Allele frequency = relative peak height (100%)… Relative peak height = height of peak1 / (height of peak1 + height of peak2) ¾ Can detect allele frequencies between 5 – 95 % ¾ Requires signal intensities of at least 200 units for a single peak ¾ Expected standard deviation is 1 – 2 % between expected Vs measured allele frequencies ¾ PCR and Assay design is conducted as before with the following criteria: o o o o o

An essential amplicon size < 200 bp with strong, specific PCR product SNP on no account in a homopolymer ⇒ do-able, but results are most unimpressive Avoid A polymorphisms where possible ⇒ requires additional optimisation No background present at SNP position Check even amplification of both alleles ⇒ i.e. spike samples 7

A. J. McKnight March 2004

¾ Recommended controls: o Sequencing primer ⇒ checks for stable 3' end dimer formation o PCR fragment ⇒ checks for template loops o Negatice PCR samples + Pseq ⇒ checks stable 3' dimer formation & contamination ¾ Use the warnings and comments under the well info tab to optimise AQ reactions… ¾ Low peak problems may be caused by: o Insufficient PCR o Bad quality biotinylated PCR primer ⇒ only way to test is to reorder (~ 20 % of pyro problems) o Excess Biotinylated PCR primer o Faulty annealing buffer ⇒ causes low, wide peaks Solutions include using more template, making new buffers, optimising PCR. ¾ Background from: o o o o o

Fragments with stable 3' end will be extended by DNA pol & cause background Mispriming of Pseq within PCR fragment Interaction between Pseq and non-specific PCR product Secondary structures Dimers & hairpin loops ⇒ have most influence on weak samples.

Solutions include adding SSB (0.5 – 2.5 ug), changing dispensation order, comparing the theoretical output to raw data and editing the reference peaks (only if known), creating a mismatch in the 3' end or subtracting non-specific signal (advanced options tab). ¾ Preferential amplification of one allele is evident by large frequency variation between replicates / skewed allele ratios. N.B. May have increased background depending on the well position to the light. CCD camera & overly fussy software on occasion.

Pooling DNA requires accurate [DNA] and a minimum of handling errors. Pyro has no known upper limit to the pool sizes, however the lowest number of samples the company has assessed has been 50. Pyro may be used to check the pools – this method is very time consuming and tedious, however very good. ~ 100 samples are screened for a ‘good’ SNP. Different samples are then mixed in pools and compared to known genotypes. Protocol is available on the company website.

8

A. J. McKnight March 2004

Haplotyping ¾ Check for validated designs on Pyrosequencing website: publications, protocols and assay design. ¾ Applications:

Out-of-phase sequencing (chromosome specific). Allele specific PCR and sequencing

¾ Out-of-Phase Sequencing…only works if the SNPs are close together. Similar to multiplex anlysis where the multiplex design dispensation order is created manually. Essentially chromosome specific “stop” without the other SNP position. Peaks will be half heights with the dispensation order used to separate the chromosomes. The current longest published haplotype involves SNPs 27 bases apart. o See Pyro file for sample pyrograms of dispensation orders / real data results. ¾ AS-PCR haplotyping… 3' end of one primer at SNP position with primer variants complementary to each allele.

9

A. J. McKnight March 2004

Multiplex Analysis ¾ Check for validated designs on Pyrosequencing website: publications, protocols and assay design. ¾ Advantages:

Decreases cost per genotype Increases speed and efficiency of genotyping studies

¾ Multiplexing…one Pseq can analysis several SNPs in one fragment. Alternatively, one sequencing primer is prepared per SNP and run in one reaction. o See Pyro file for sample pyrograms of dispensation orders / real data results. ¾ Design Issues:

Compatible PCR primers for each fragment Unique sequencing primers for each SNP Dispensation order to generate unique peaks for each fragment

Amplicon < 150 bp Add NN tail to 5' end of unbiotinylated primer to avoid template loop formation Similar Tm and % GC for all primers – check interactions across all primers Design reference peaks as close as possible to SNP as intensity will decrease with sequence length o Need strong, specific PCR product for all fragments with no background signal at the SNP positions. Also, even amplification of both alleles showing the expected sequence pattern. o o o o

¾ Recommended controls:

Each Pseq only and all together PCR fragment only and all together Negative PCR product and all Pseq primers Each template with each and alternate primers

10

A. J. McKnight March 2004

Anything which forms a stable 3’ end can be extended by the DNA polymerase and cause background!

Troubleshooting…

¾ Background from PCR fragment loops / mispriming of sequence primer within PCR fragment has the same effect on all samples - amount of background is ∝ to the amount of template ¾ Background from sequencing primer-dimers / hairpin loops have the largest effect on weak samples. 2o structures affect enzyme kinetics and give distorted or unexpected sequence pattern – often with wide peaks ¾ Background from neg. PCR controls / non-specific PCR products have the largest effect on poorly amplified samples – primers are exhausted in well amplified samples with less non-specific amplicons ¾ Shift / drop off will also lead to spurious peaks / apparent background in the reaction ♦ Controls for pyrosequencing reaction: a. b. c. d. e. f. g.

Sequencing primer only Biotinylated primer only Biotinylated primer + sequencing primer Template only Negative PCR sample Annealing buffer only Check for background peaks in negative dispensations

♦ Background from sequencing primer: 1. Redesign primer - If there is a mismatch in the 3’-end, there will not be any background! 2. (Background from template can therefore often be avoided by simply extending the 5’-end of the non-biotinylated PCR primer with one base 3. For mispriming to template use single stranded DNA binding protein (SSB) 4. 0.5-2.5 µg Single Strand Binding protein (SSB) should be added after the annealing step to remove secondary structure. 5. Include extra step in sample preparation - Include extra transfer step to fresh annealing buffer after primer annealing step. ♦ Background from Template: 1. Change the dispensation order to move template background away from the SNP position

11

A. J. McKnight March 2004

2. Low signal from: a. b. c. d. e. f.

Template amount Excess biotin/biotinylated primer Bad quality biotinylated primer Unspecific fragment Buffers, reagents Enzyme properties

♦ Peaks in negative dispensation… 1. Check PCR reaction for non-specific products using appropriate controls 2. Check sequence and select a negative dispensation order where the background signal will have no effect on the SNP assay. If a high risk of background signal is predicted (e.g. primer design for sequencing, step 6), then this bases would not be used as negative dispensation. The background generated from this site would be GTTTCT, but if the sequence to analyse is c/tattca, the background will have no effect as long a G is not used as negative dispensation.

Blocked NDTs… Blocked RDTs may be cleaned as above. If blockages are still apparent, then immerse needles in 18.2 mΩ water for one hour and repeat cleaning procedure. Head not moving / dispensing reagents…Ensure lid is closed correctly. There is a magnetic seal, without which the pyrosequencer will not operate. Place a strong magnet over the lid to remagnetise the small magnet present on the hood. Open and close the lid and rerun the instrument.

12

A. J. McKnight March 2004

Additional Information: Summary ⇒ Label PCR product using Biotin and immobilise on streptavidin coated sepharose beads. Instrument parameters

⇒

Enzyme pulse time: Substrate pulse time: Reagent pressure: Nucleotide pulse time: Nucleotide pressure: Block temperature: Mixer frequency: Cycle time: Reagent priming time: Nucleotide priming time: Reagent priming pressure: Nucleotide priming pressure:

22 22 400 10.4 650 28 50 56 100 100 400 650

ms ms mbar ms mbar o C Hz s ms ms mbar mbar

PCR Optimisation… 1. Maintain low biotinylated primer concentrations to limit interference with assay. Ideally ≤ 10 pmol in 50 µl PCR reaction (0.2 µM). 2. Standard starting reaction uses 10 ng DNA in 15 µl PCR reaction with 125 µM of each nucleotide. 3. TaqGold is gradually activated during amplification and ∴ requires more cycles than protocols with ordinary Taq. For the best yield and consumption of all biotinylated primers, run 45 – 50 PCR cycles. New England Biolabs HotStart Taq has been used with success in our lab. 4. Optimise annealing temperature of new primers on MJ tetrad running a gradient of 45 – 65 oC with a control DNA. 5. Increased [MgCl2] will lead to higher incorporation rate and efficiency for TaqGold, but may also increase risk of incorporation errors (sloppy enzyme action). More MgCl2 will also stabilize dimer formation increasing the risk for mispriming or stabilising 2o structures in the template…will decrease amplification efficiency for GC rich templates. Lowered MgCl2 increases stringency but decreases yield. 6. Add 5 % DMSO for very GC rich fragments. Alternatively, exchange part of deoxyguanosine with deoxyinosine (dI: dG is the recommended starting point) or add SSB. SSB may be added to the E needle and dispensed as ‘normal’. Typical protocol ⇒

95 oC – 5 min 95 oC – 15 sec TA – 30 sec 72 oC – 15 sec 72 oC – 5 min 4 oC – ∞

45 cycles

13

A. J. McKnight March 2004

Contact Details: Marie Ellow, Frida Lysholm & Jenny Dunker. Pyrosequencing AB Vallongatan 1, SE-75228 Uppsala Sweden Tel: (+46) (0) 18565900 Fax: (+46) (0) 18591922 http://www.pyrosequencing.com or http://www.biotage.com Tech support on (+46) (0) 18516565 or [email protected]

Local contact: Connor Drysdale Brennan & Company 00 353 (1)868 552019 [mobile]

•

Verified assay protocols are frequently updated at: http://www.pyrosequencing.com/pages/application_assay_protocols.html

•

Application notes / papers / posters etc. http://www.pyrosequencing.com/pages/notes_and_posters.html http://www.pyrosequencing.com/pages/publications.html

14

A. J. McKnight March 2004

Theory… Step 1 ƒ Sequencing primer hybridized to PCR amplified ssDNA , template ƒ Primer and template incubated with: DNA polymerase ATP sulphurylase Luciferase Apyrase Adenosine 5’ phosphosulphate Luciferin Step 2 ƒ Addition of deoxynucleotide ƒ Incorporation by DNA polymerase & release of pyrophosphate (PPi) in equimolar quantity to incorporated nucleotide Step 3 ƒ ƒ ƒ ƒ ƒ

PPi + APS → ATP luciferin + ATP + O2 → oxyluciferin + AMP + PPi + CO2 + Light Detection of light with CCD-camera ⇒ Peak in pyrogram Luciferase does not use dATPaS as substrate ⇒ dATPaS is used in the Pyrosequencing reaction Degradation of unincorporated nucleotides and ATP by apyrase ⇒ Light is switched off and the solution conditioned for the next nucleotide addition

Step 4 ƒ Addition of next nucleotide & process starts over again. A complementary strand is built up and sequence is determined by peaks in a pyrogram the height of the peak is proportional to the amount of incorporated nucleotides. Multiplex reactions are carried out simultaneously within the plate. X-Y drive

A

C

G

Positioning

T

Reagent cartridge

Ink jet delivery

96 well plate

Mixer and thermostat

15

A. J. McKnight March 2004

16