Quantitative Reverse Transcription-PCR Assay ... - Semantic Scholar

Clinical Chemistry 45:9 1397–1407 (1999)

Molecular Diagnostics and Genetics

Quantitative Reverse Transcription-PCR Assay with an Internal Standard for the Detection of Prostate-specific Antigen mRNA Alice Ylikoski,1* Minna Sjo¨roos,1 Åke Lundwall,2 Matti Karp,1 Timo Lo¨vgren,1 Hans Lilja,2 and Antti Iitia¨3

Background: Circulating prostate cells can be detected with a reverse transcription-PCR (RT-PCR) assay for prostate-specific antigen (PSA) mRNA. We have developed a new quantitative RT-PCR method for measuring PSA mRNA. Methods: The method uses a PSA-like internal standard (IS) mRNA that is added into the sample at the beginning of the RNA extraction and coamplified by RT-PCR with the PSA in the sample. After PCR amplification, the IS and PSA products are selectively detected by hybridization in a microtitration plate using probes labeled with fluorescent europium chelates. Results: The method was validated with PSA and IS mRNAs and PSA-expressing cells to obtain a detection limit of 50 PSA mRNA copies (i.e., signal 2 times the mean of zero signal), linearity up to 106 copies, and detection of a single PSA-expressing cell. In preliminary evaluations, 60% (n 5 10) of the prostate cancer patients with skeletal metastases gave results above the detection limit (500 PSA mRNA copies in 5 mL of blood). The total number of PSA copies ranged from 900 6 200 to 44 100 6 4900 (mean 6 SD) in the samples, corresponding to ;1–100 PSA-expressing cells in 5 mL of blood. In the controls (n 5 34), none of the healthy females and 2 of 19 healthy males had detectable PSA mRNA [700 6 100 and 2000 6 900 (mean 6 SD) PSA mRNA copies in 5 mL of blood for the 2 males].

1 Department of Biotechnology, University of Turku, Tykisto¨katu 6 A, 6th Floor, FIN-20520 Turku, Finland. 2 Department of Clinical Chemistry, Lund University, University Hospital, S-20502 Malmo¨, Sweden. 3 InnoTrac Diagnostics Oy, Tykisto¨katu 6 A, 7th Floor, FIN-20520 Turku, Finland. *Author for correspondence. Fax 358-2-3338050; e-mail [email protected]. Received June 1, 1999; accepted June 15, 1999.

Conclusions: The assay provides sensitive and quantitative detection of PSA mRNA expression from blood samples and can be used to establish the clinically significant number of PSA mRNA copies in prostate cancer. © 1999 American Association for Clinical Chemistry

Because of their high sensitivity and diagnostic potential, reverse transcription-PCR (RT-PCR)4 amplification techniques have been used to detect circulating cancer cells shed by solid tumors, utilizing different markers for various tumor cells (1–3 ). For the detection of prostate cells in circulation, the most widely studied target transcript is prostate-specific antigen (PSA) (4 –12 ). However, based on the results to date, it is not yet clear whether RT-PCR will be of clinical value in the staging of prostate cancer. The efficiency of circulating tumor cells in causing metastases is controversial (13, 14 ), and more recently, basal PSA mRNA concentrations were detected with RT-PCR in individuals without prostate cancer (15–18 ). The expression of PSA in a number of healthy and malignant tissues, most notably the female breast, suggests the need for quantitative RT-PCR (QRT-PCR) assays to discriminate, if possible, the expression of the PSA gene from prostatic and non-prostatic cells (19 –24 ). After the development of quantitative PCR, the quantitative approach was also applied to RT-PCR, which has been an efficient technique for analyzing extremely low amounts of mRNA derived from cells or tissues. Quantification of PCR and RT-PCR products is based on the use of different calibrators that have been improved during the development of the quantitative assays. The first quantitative methods used external calibrators (25 ). In this approach the quantification was based on the measurement of the amount of amplification product in the 4 Nonstandard abbreviations: RT-PCR, reverse transcription-PCR; PSA, prostate-specific antigen; QRT-PCR, quantitative RT-PCR; IS, internal standard; modC, diaminohexanedeoxycytidine; nt, nucleotide(s); KLK1, tissue kallikrein; and KLK2, human glandular kallikrein 2.

1397

1398

Ylikoski et al.: Quantitative RT-PCR for PSA mRNA

exponential phase by reference to the dilution series of an external calibrator. However, with this type of assay the quantification was not accurate because of the variability in sample preparation and in the amplification reaction. Minor variations in the reaction conditions can be greatly magnified during the amplification process. The variations can be normalized by coamplifying the specific template with internal standard (IS) in the same reaction tube. Chelly et al. (26 ) reported the use of an endogenous IS, aldolase A, for the quantification of dystrophin gene transcripts in the sample. However, this approach allows only comparative quantification because of the differences in efficiency between the primer pairs and amplification of the endogenous calibrator and the target. For an accurate quantification, the IS and the target should be amplified with the same efficiency and the amplification products should also be of similar size. Ideally, the IS should share nearly the same sequence as the target itself so that they can be coamplified with the same primers. Moreover, the IS should contain a small difference in sequence with respect to the sample target to distinguish the target amplification product from the IS amplification product. The difference in the two targets should be as small as possible to obtain equal amplification but large enough to allow selective detection of each product. Many of the methods described with a target-like IS are based on the serial dilutions of sample or IS (27–30 ). These methods require preparing multiple tubes for quantification of one sample, and quantification is performed by comparing the amplification signal of the sample with the amplification signals obtained from various known amounts of IS. The simplest methods described for quantification with a target-like IS require preparation of only one tube for one sample (31–34). In these assays, the target transcripts are quantified using a constant number of IS copies in the sample and an external calibration curve. Here we describe a QRT-PCR assay with a target-like IS to study the expression of the PSA gene. The principle of the assay is shown in Fig. 1. The IS mRNA contains a 2-base pair deletion with respect to the PSA mRNA target. Variations in RNA extraction and RT-PCR amplification are controlled by adding the IS into the studied sample at the beginning of the total RNA extraction, after which the IS and target mRNAs are coamplified in RT-PCR reactions. PSA and IS amplification products are detected in streptavidin-coated microtitration wells using specific Eu31-labeled hybridization probes measured by timeresolved fluorometry. Time-resolved fluorescence technology provides a rapid, sensitive, and nonradioactive method for the detection of RT-PCR amplification products (35–37 ). Quantification of PSA copies required one reaction for one sample, and the number of PSA copies was calculated by comparing the PSA-to-IS fluorescence ratio of the sample to the ratio in a calibration curve covering the range of 50 to 106 copies of PSA mRNA. We also performed a preliminary evaluation of the method

Fig. 1. Principle of the QRT-PCR assay. Nucleated cells are collected from the blood sample, and total RNA extraction is performed after addition of a known amount of IS mRNA to the denatured cells. PSA mRNA in the sample and IS mRNA are coamplified by RT-PCR. One of the PCR primers is biotinylated (B), which produces biotinylated amplification product. The PSA and IS PCR products are detected with specific Eu31-chelate-labeled detection probes in the microtitration well-based hybridization assay. SA, streptavidin.

1399

Clinical Chemistry 45, No. 9, 1999

with blood samples from 10 prostate cancer patients and 34 healthy subjects.

Materials and Methods oligonucleotides Oligonucleotides, shown in Table 1, were synthesized with an Applied Biosystem DNA/RNA Synthesizer. Additional diaminohexanedeoxycytidine (modC) was added to the 59 ends of oligonucleotides to be labeled either with biotin or lanthanide chelates. The oligonucleotides to be biotinylated (f, i, and j) had one modC, and the oligonucleotides to be labeled with lanthanide chelates (g and h) had 20 modC at the 59 end. Synthetic PSA and IS oligonucleotide targets and 39 PSA PCR primer were biotinylated with N-hydroxysuccinimide ester (Sigma Chemical), and hybridization probes were labeled with Eu31 chelate (Wallac Oy). Lanthanide chelate labeling and biotinylation were carried out as described earlier (38, 39 ).

cell lines The PSA-expressing human prostatic carcinoma cell line LNCaP and the non-PSA-expressing mouse myeloma cell line SP2/0 were obtained from the American Type Culture Collection. The cell lines were cultured in flasks containing Dulbecco Modified Eagle Medium (Life Technologies) with 100 mL/L fetal bovine serum (Hyclone) and maintained in a 5% CO2 incubator at 37 °C. The medium for LNCaP culture was supplemented with 1 nmol/L synthetic hormone methyltrienolone (R1881; New England Nuclear). The cells were grown until near confluency, detached, washed with phosphate-buffered saline, and counted. The LNCaP cells were detached by trypsin-EDTA treatment. The SP2/0 samples containing 2.5 3 106 cells and the dilutions of LNCaP cells were stored at 270 °C until RNA extraction.

blood specimens Blood samples (5 mL) were collected from 10 patients with metastatic prostate cancer, 15 healthy female volunteers, and 19 healthy male volunteers. The healthy volunteers were included as controls in the study. All of the prostate cancer patients had skeletal metastases, and they were treated either by surgery or hormonal therapy (Table 2). The study protocol was in accordance with Helsinki Declaration of 1975, as revised 1983.

is For the preparation of the IS cDNA construct, 2 base pairs [nucleotides (nt) 602– 603] were deleted from pGEM3-PSA cDNA plasmid (40 ), using PCR primers a– d (Table 1). The deletion was introduced with gene splicing by the overlap extension technique (41 ). The constructed pGEM3-IS plasmid was transformed into Escherichia coli XL-2 Blue cells (Stratagene) and the 2-base pair deletion was confirmed by nucleic acid sequencing of the plasmid (nt 333– 814), using primers a and b.

in vitro production and purification of psa and is mRNAs AmpliScribeTM T7 transcription kit (Epicentre Technologies) was used for the in vitro production of PSA and IS mRNAs to be used in optimization and standardization of the RT-PCR assay. Linearized pGEM3-PSA and pGEM3-IS plasmids served as templates in the in vitro transcription, and the mRNAs produced in vitro were purified on an Oligod(T)-Cellulose Type 7 column (Pharmacia) according to the manufacturer’s instructions. The purified mRNA pellet was dissolved in diethylpyrocarbonate-treated water and stored in aliquots at 270 °C. The amount of mRNA was quantified by spectrophotometric analysis at 260 nm.

preparation of total rna EDTA blood (5 mL) was mixed with an equal volume of 20 g/L dextran in 9.0 g/L NaCl to allow red blood cells to

Table 1. Names, sequences, positions, labels, and degrees of labeling of oligonucleotides used in this study. Oligonucleotide

Construction of IS 59 primer 39 primer 59 mutation primer 39 mutation primer PCR 59 primer 39 primer Hybridization assay PSA probe IS probe PSA target DNA IS target DNA a b

2, no label. M, modC.

Name

Sequence

a b c d

59 59 59 59

CACACCCGCTCTACGATATGA GATGGTGTCATTGATCCACTT GTGTGCGCAATCACCCTCAGAAGG TGAGGGTGATTGCGCACACACGTC

e f

59 TGAACCAGAGGAGTTCTTGAC 59 MCCCAGAATCACCCGAGCAG

g h i j

59 59 59 59

(M)20 GCGCAAGTTCACCCTCAb (M)20 GTGCGCAATCACCCTC MCCTTCTGAGGGTGAACTTGCGCACACA MCCTTCTGAGGGTGATTGCGCACACACG

Nucleotide position

Label

Labels/oligonucleotide

333–353 794–814 592–617 587–612

2a 2 2 2

2 2 2 2

523–543 667–685

2 Biotin/2

2 1/2

596–612 594–601, 604–611 591–617 589–601, 604–617

Eu31 Eu31 Biotin Biotin

18 15 1 1

1400


Table 2. Patient samples and healthy controls studied. Sample

PSA mRNA copiesa in 5 mL of blood

Initial serum PSA, mg/L

Treatmentb

Prostate cancer patients (n 5 10) 1700 6 300

222.0

2

14 700 6 2700

5040.0

3

18 200 6 4700

64.2

Orchiectomy Antiandrogens, GnRH

1

4

900 6 200

NA

5

2000 6 800

NA

6

2

1690.0 5040.0

GnRH,c orchiectomy GnRH

GnRH, orchiectomy Orchiectomy

7

2

8

44 100 6 4900

17.4

9

2

100.0

NA

10

2

600.0

NA

GnRH Total androgen blockade

Healthy volunteers, female 11–25

2

ND

Healthy volunteers, male 26–32

2

ND

33

700 6 100

34

2000 6 900

ND

2

ND

35–44

ND

6SD. Treatment of prostate cancer patients having skeletal metastases. c GnRH, gonadotropin-releasing hormone; NA, information not available; ND, not determined. d 2, below detection limit (i.e., ,500 PSA mRNA copies in 5 mL of blood). a b

sediment at the bottom of the tube during a 45-min incubation at room temperature (42 ). The nucleated blood cells in the upper phase were pelleted by centrifugation at 4 °C and 2000g for 10 min. Samples were processed immediately, and the time from venipuncture to obtaining the cell pellet was no more than 1.5–2 h. If RNA extraction from the pelleted cells was performed later, the cell pellets were snap-frozen in liquid nitrogen and stored at 270 °C until RNA extraction. Total RNA was extracted from the pelleted nucleated blood cells, using a shortened acid guanidinium thiocyanate-phenol-chloroform method (43, 44 ). Briefly, a known amount of PSA or IS mRNA produced in vitro was mixed with the denatured cell lysate to control the efficiency of RNA extraction. After phenol-chloroform treatment, RNA in the aqueous phase was precipitated only once with one volume of cold isopropanol at 220 °C for 1 h. Samples were centrifuged at 4 °C and 10 000g for 20 min and washed twice with cold 700 mL/L ethanol. The RNA pellets were air dried and dissolved in 80 mL of diethylpyrocarbonate-treated water. RNA preparations were stored at 270 °C until analyzed with RT-PCR assay.

rt-pcr The PCR primers (primers e and f, Table 1) were designed to recognize only PSA transcripts and no other kallikreinlike transcripts. Both the 59 and 39 primers contained at their 39 end a sequence of 2– 4 nucleotides that recognized only PSA but not tissue kallikrein (KLK1) or human glandular kallikrein 2 (KLK2) sequences. Furthermore,

the primers spanned exon-intron boundaries to obtain mRNA-specific amplification and to avoid contamination from genomic DNA. In addition, one of the primers was biotinylated to capture the PCR products onto streptavidin-coated microtitration wells (DELFIATM; Wallac Oy). In each experiment, negative PCR samples, which contained either RNA template (no reverse transcription of RNA) or no template, were included to check for contamination. Blood cell RNA, in vitro produced PSA mRNA, or IS mRNA were used as samples for cDNA synthesis carried out with First-Strand cDNA Synthesis Kit (Pharmacia Biotech). PSA and IS mRNA samples were diluted in 20 mg/L E. coli tRNA (Boehringer Mannheim) solution, which was used as an inert carrier RNA solution. Each reaction (final volume, 15 mL) contained 8 mL of RNA sample and 0.2 mg of universal oligo-d(T)18 primer mixed in a reverse transcription reaction mixture. Before PCR amplification, the cDNA samples were heated at 95 °C for 5 min to denature the reverse transcriptase. A 5-mL cDNA sample was amplified under a layer of mineral oil (Sigma) in a 100-mL PCR reaction that consisted of 10 mmol/L Tris-HCl, pH 8.8; 50 mmol/L KCl; 1.0 mL/L Triton X-100; 3.5 mmol/L MgCl2; 100 mmol/L each dNTP; 0.035 mmol/L biotinylated 39 primer f; 0.065 mmol/L unlabeled 39 primer f; 0.2 mmol/L 59 primer e; and 1 U of DynaZymeTM II Recombinant DNA Polymerase (Finnzymes Oy). Before amplification, the PCR reactions were kept on ice. Amplification was carried out with a Perkin-Elmer Cetus DNA Thermal Cycler using the following PCR program: 95 °C for 30 s (3 min 30 s for the first cycle), 62 °C for 30 s, and 72 °C for 45 s (5 min 45 s for the last cycle) for 28 cycles.

detection of the pcr products by hybridization assay A 10-mL aliquot of PCR product and 50 mL of DELFIA Assay Buffer containing 1 mol/L NaCl was added into each streptavidin-coated microtitration well. Each PCR product was added into four wells; the first two replicas were detected with the PSA hybridization probe and the second two replicas with the IS hybridization probe. Biotinylated PCR products were captured onto the wells by incubation at room temperature with slow shaking for 30 min. After the capture reaction, the wells were washed three times with DELFIA Wash Solution, and 100 mL of 50 mmol/L NaOH was added into each well to denature the double-stranded PCR products. Denaturation was carried out by incubation at room temperature with slow shaking for 5 min, and the denatured DNA strand was removed by washing three times as described above. The captured DNA strand was detected by adding 100 mL of hybridization solution containing 20 pg/mL of detection probe (g or h; Table 1) in DELFIA Assay Buffer containing 1.0 g/L nonfat milk powder and 1 mol/L NaCl. The specific hybridization probes for PSA and IS were designed to contain a sequence with the greatest difference between


the sequences of PSA and the other kallikreins (KLK1 and KLK2). The hybridization probe for PSA (probe g) contained 8 mismatches with respect to the KLK1 sequence and 7 mismatches with respect to the KLK2 sequence, whereas the hybridization probe for IS (probe h) contained 10 and 9 mismatches with respect to the KLK1 and KLK2 sequences, respectively. After hybridization at 50 °C for 2 h, the wells were washed six times with 55 °C DELFIA Wash Solution. DELFIA Enhancement Solution (200 mL) was added into each well, and after shaking for 30 min at room temperature, the fluorescence of the Eu31 chelates was measured with a 1234 DELFIA Plate Fluorometer. All of the DELFIA reagents and instrumentation were from Wallac Oy.

Results hybridization assay The reaction conditions of the hybridization assay were optimized using biotinylated PSA and IS oligonucleotide targets (i and j; Table 1). The best efficiency in hybridization was obtained after a 2-h incubation with hybridization solution containing 20 pg/mL labeled detection probe, 1 mol/L NaCl to enhance the hybridization, and 1.0 g/L nonfat milk powder to block nonspecific background signal. Nonspecific binding of the IS probe to the PSA target was significantly decreased by using a hybridization temperature of 50 °C and a washing temperature of 55 °C after hybridization. The IS probe detected the PSA amplification product from 105 PSA mRNA molecules with 4.5% cross-reactivity when a hybridization and wash temperatures were 45 °C, and with 3.9% cross-reactivity when the hybridization and wash temperatures were 50 °C. However, the IS probe showed no cross-reactivity with the PSA target when a hybridization temperature of 50 °C, a washing temperature of 55 °C, and 103 to 106 PSA mRNA molecules for amplification were used. Slight (0.4%) cross-reactivity of the IS probe to the PSA target was detected only after amplification of 107 PSA mRNA molecules. The PSA probe showed no detectable crossreactivity with the IS amplification product when the different temperatures were tested and 103 to 107 IS mRNA molecules were used as templates in RT-PCR. The difference between the nonspecific binding of the IS probe to the PSA target and the PSA probe to the IS target is attributable to the stability of the mismatches. The mismatch between the IS probe and the amplification product of 107 PSA mRNA molecules is more stable than the mismatch between the PSA probe and the IS target.

1401

agarose gels to check the size and quality of the purified mRNAs. The expected 1.5-kb bands of the purified IS and PSA mRNAs were observed on the gels.

validation of the rt-pcr assay During optimization of the PCR, the efficiency of the amplification as a function of primer concentrations was studied by analysis of different dilutions of the PCR amplification products with the hybridization assay. The dilution experiments showed the highest amount of amplification product was obtained using 0.1 mmol/L biotinylated 39 primer (primer f) and 0.2 mmol/L 59 primer (primer e). In addition, the dilution experiments revealed the large excess of biotinylated primer competed with the biotinylated PCR product for the biotin binding sites of the solid phase. The amount of the biotinylated 39 primer was reduced to avoid the dilution step of the amplification products before the hybridization assay and to obtain reliable detection of the amplification products. Part of the biotinylated 39 primer was replaced with unlabeled 39 primer to adjust the total concentration of these two forms of 39 primers to 0.1 mmol/L. The optimal primer concentrations were 0.035 mmol/L biotinylated 39 primer, 0.065 mmol/L unlabeled 39 primer, and 0.2 mmol/L 59 primer. The RT-PCR assay was validated by first studying the efficiency of PCR amplification of full-length IS and PSA cDNA targets and then the performance of RT-PCR amplification of IS and PSA mRNA targets. The amplification of RT-PCR and PCR reactions were compared using different dilutions of PSA and IS molecules. The reactions contained 105 IS copies in each of the PSA dilutions of 103 to 107 molecules. PCR and RT-PCR amplifications produced similar fluorescence signals and

is and psa mRNA The pGEM3-IS plasmid was confirmed to contain the desired 2-base pair deletion by nucleic acid sequencing of the plasmid (nt 333– 814). IS and PSA mRNAs produced in vitro were purified on Oligo-d(T)-Cellulose columns to obtain pure IS and PSA mRNAs containing the poly(A) tail. The purified IS and PSA mRNAs were run on 0.7%

Fig. 2. Comparison of RT-PCR and PCR reactions. Performance of PCR was tested with various known amounts of PSA cDNA with 105 copies of IS cDNA (Œ). Performance of RT-PCR was tested with corresponding amounts of PSA mRNA with 105 copies of IS mRNA (f).

1402


or logN c 5 logN i 1 c@log~1 1 f !# where c is the number of amplification cycles, Ni is the initial amount of target, Nc is the amount of product generated after c amplification cycles, and f is the amplification efficiency. In a plot of logNc vs cycle number, the slope of the curve is log(1 1 f ). As shown in Fig. 4, PSA and IS mRNA targets are reverse transcribed and amplified with the same efficiency. The curves for logNc vs cycle number generated for the PSA and IS products should be parallel (i.e., equal slopes) if the amplification efficiency of the two targets is the same. In other words, a plot of the log ratio of PSA/IS vs amplification cycles will generate a horizontal line if the efficiency of the amplifications is the same for both targets.

rna extraction

Fig. 3. Demonstration of independent amplification of PSA and IS mRNA. Various known amounts of PSA mRNA were amplified with 104 (f, PSA signal; M, IS signal) or 105 (Œ, PSA signal; ‚, IS signal) IS mRNA copies. The reference values were PSA mRNA amplified without IS mRNA (F, PSA signal).

PSA to IS ratios, which indicated that the reverse transcription and PCR reactions performed equally (Fig. 2). Interference between the amplification of the PSA and IS targets was studied by amplifying various known amounts of one target mRNA with a constant amount of the other target mRNA. Reactions containing a dilution of only one target were used as reference. Fig. 3 shows the result of the amplification of various numbers of PSA molecules with and without the constant amount of IS molecules. After coamplification with PSA, the fluorescence signal of 104 IS molecules remained almost unchanged, whereas the signal of 105 IS molecules decreased as the number of PSA targets increased. This indicates the use of not more than 104 IS mRNA copies for coamplification with PSA to obtain a wide linear range for the quantification of PSA mRNA. The results show that 103 to 106 copies of PSA mixed with 104 copies of IS are amplified independently from each other until the amplification reaches the saturation phase. Furthermore, the saturation phase of PCR had a similar effect on both targets because the PSA/IS ratios of the amplification products were linear, as shown in Fig. 2. Similar results were obtained from amplification of various numbers of IS mRNA with constant amounts of PSA mRNA (data not shown). The amplification efficiency of the two targets was determined by amplifying the same amount of mRNA molecules for different numbers of PCR cycles, and the determination of the efficiency was based on the equation for exponential growth (45 ): N c 5 N i ~1 1 f ! c

RNA was first extracted by the traditional guanidinium thiocyanate-phenol-chloroform method described by Chomczynski and Sacchi (43 ), but no IS amplification product was recovered from the blood cell samples to which IS mRNA had been added before RNA extraction. However, some of the IS signal was recovered after additional purification of the RNA pellet with 700 mL/L ethanol. Therefore, a modified version of the guanidinium thiocyanate-phenol-chloroform method (44 ) was used. This method differed from the traditional one in the second RNA precipitation and ethanol washes of the pellet. To further study the efficiency of RNA extraction, various known amounts of PSA mRNA with constant amounts of IS mRNA molecules were mixed with denatured nucleated blood cells extracted from EDTA blood

Fig. 4. Amplification efficiency. Fluorescence signals of PCR products with 103 copies of PSA (F) or IS (f) mRNA amplified for different number of cycles. Œ, ratio of PSA/IS fluorescence signals.


Fig. 5. Comparison of PSA/IS ratios of amplification products after RNA extraction and RT-PCR amplification. Two different dilution series contained various known amounts of PSA mRNA with 103 molecules of IS mRNA. f, the result from RT-PCR-amplified dilution series containing pure PSA and IS mRNAs in tRNA carrier solution. Œ, the amplification result from extracted blood RNA samples containing PSA and IS mRNAs.

collected from healthy female volunteers. Total RNA was extracted from the samples, and one-tenth of each RNA preparation was reverse transcribed. For comparison, corresponding PSA and IS mRNA dilutions were performed in tRNA carrier solution to be reverse transcribed into single-stranded cDNA. The amplification results of these two dilution series were compared (Fig. 5). Although the recovery in RNA extraction varied considerably, and ranged from 50% to 80%, the ratio of PSA/IS in the RNA extracted and in the reference samples stayed almost the same, which illustrated the need to add IS mRNA at the beginning of the RNA extraction step.

1403

tion of PSA mRNA copies in a sample (Fig. 6). The detection limit of the QRT-PCR assay was set as 2 timesthe mean of the zero signal, which corresponded to a detection limit of 50 PSA copies in RT-PCR when 28 PCR cycles were used. The assay was linear up to 106 input molecules of PSA in the RT-PCR reaction. When one-tenth (8 mL of 80 mL) of each sample was analyzed, the limit of detection corresponded to 500 PSA mRNA copies in 5 mL of blood or in 5 3 106 to 10 3 106 nucleated blood cells. The constant amount of 103 IS mRNA molecules was chosen to be the smallest suitable amount of IS mRNA that allowed a wide linear range for quantification of PSA mRNA. Furthermore, the independent amplification of the PSA and IS targets and the equal amplification efficiency of these two targets allowed the use of 103 IS mRNA molecules. In addition, the presence of the slight cross-reactivity (0.4%) of the IS hybridization probe detected with the high amount of PSA amplification product (from 107 or more mRNA molecules) could be avoided by adjusting the calibration curve points up to no more than 106 input molecules of PSA mRNA. The reproducibility (within-run) of the RT-PCR assay was tested (n 5 5) with samples containing 50, 104, and 106 PSA mRNA copies (and 103 IS mRNA copies for quantification). The CVs were 13%, 2.5%, and 14%, respectively. In addition, the reproducibility of the assay was studied with dilution series (n 5 4) containing 1 to 103 LNCaP cells in 2.5 3 106 PSA-negative SP2/0 cells (Fig. 7). The SP2/0 RNA did not yield amplification product in the PSA RT-PCR assay. This method detected 1 LNCaP cell in 2.5 3 106 SP2/0 cells. The mean number of PSA mRNA copies was 1.3 3 103 in 1 LNCaP cell, with an SD of 800.

detection limit and reproducibility During the optimization, we first determined the detection limit and linearity of the PSA and IS hybridization assays to detect DNA targets separately from the detection characteristics of the whole QRT-PCR assay. The detection limit (2 times the mean of the zero signal in the hybridization assay) and the linearity of the PSA and IS hybridization assays were determined with synthetic PSA and IS oligonucleotide targets (targets i and j; Table 1). The detection limit of the PSA hybridization assay was 4.8 3 108 synthetic DNA molecules and that of the IS hybridization assay was 3.2 3 108 synthetic DNA molecules (data not shown). Both hybridization assays were linear up to 3.0 3 1010 molecules. For the whole QRT-PCR assay, a calibration curve was generated using various known amounts of PSA mRNA molecules containing 103 IS mRNA copies for quantifica-

Fig. 6. Calibration curve of the developed QRT-PCR assay for PSA mRNA. The curve was built with a constant amount of 103 IS mRNA copies and a 28-cycle PCR protocol.

1404


Fig. 7. Mean number of PSA mRNA copies in 1–1000 LNCaP cells. Error bars, SD of four samples.

quantification of psa mRNA molecules The QRT-PCR assay was further validated with blood samples from prostate cancer patients and healthy controls. The RNA samples were analyzed three times to confirm the results. Sixty percent of the samples from prostate cancer patients with skeletal metastases (n 5 10) gave results above the detection limit with the total number of PSA mRNA copies ranging from 900 6 200 to 44 100 6 4900 (mean 6 SD) in 5 mL of blood (Table 2). None of the 15 healthy female controls and 2 of 19 healthy male controls had PSA mRNA signals above the detection limit [700 6 100 and 2000 6 900 (mean 6 SD) copies of PSA mRNA in 5 mL of blood (Table 2) for the 2 male volunteers].

Discussion The QRT-PCR assay described here provides a specific and sensitive method for quantifying PSA mRNA transcripts from blood samples. To date, many of the QRTPCR assays have used DNA calibrators that are added into the sample at the PCR amplification step (29, 46 ). DNA calibrators, however, do not control the variations during reverse transcription; therefore, the use of RNA calibrators has been suggested (27, 28 ). The present QRTPCR assay differs from other PSA RT-PCR assays described previously by enabling accurate quantification of PSA mRNA copies with the help of a PSA-like IS mRNA added into the studied sample at the beginning of the RNA extraction. The yield in RNA extraction was between 50% and 80%; therefore, IS mRNA was needed to normalize the variations from the beginning of the assay. For the production of IS mRNA, the PSA-like IS cDNA was constructed by means of a splice overlap extension PCR method (41 ). This produced a 2-base pair deletion in

the PSA cDNA fragment in the middle of the hybridization area of the PSA detection probe. The deletion allowed us to design a specific detection probe for the IS. The difference between the PSA and IS sequences was kept as small as possible to obtain equal amplification of the two targets in RT-PCR and to perform an accurate quantification of PSA mRNA copies in the sample. The use of IS mRNA enabled the analysis of multiple samples with a single set of calibrators over a wide range (50 to 106 PSA mRNA copies in one reverse transcription reaction) without multiple assays for the titration of each sample. The clinical utility of RT-PCR assays in the staging of prostate cancer has been controversial. Results have shown that a preoperatively positive PSA RT-PCR result can predict the final pathological stage and prognosis in radical prostatectomy patients (6, 8, 10 –12 ). However, some studies have shown that a positive PSA RT-PCR result does not correlate with the pathological stage of prostate cancer or biochemical tumor recurrences (5, 15, 47 ). In addition to the controversial results obtained from cancer samples, the expression of the PSA gene in individuals without prostate cancer (15–18 ), in healthy human tissue (21, 22 ), and in breast tumors (19, 20, 22 ) has suggested the need for more quantitative and standardized RT-PCR procedures to demonstrate the clinical utility of the assay in the molecular staging of prostate cancer. Israeli et al. (5 ) used a nested PCR (two rounds of PCR, 25 cycles each) approach to improve the detection limit of an RT-PCR assay and analyzed the products by electrophoresis and ethidium bromide staining, achieving a sensitivity of 1 PSA-expressing cell in 106 MCF-7 cells. Similarly, Jaakkola et al. (6 ) used nested PCR (30 cycles each) and obtained a detection limit of 1.6 PSA-expressing cells in 106 blood leukocytes. Katz et al. (8 ) reported detection of 1 PSA-expressing cell in 105 lymphocytes by using a single PCR, Southern blotting, and digoxigeninenhanced detection of the PCR products. In QRT-PCR approaches, improved sensitivities have been obtained (15, 17, 48 ). Sokoloff et al. (15 ) reported the detection of 1 prostate cancer cell in 10 mL of whole blood or in 10 3 106 to 20 3 106 peripheral blood lymphocytes. O’Hara et al. (17 ) reported a single PSA cDNA molecule sensitivity and detected PSA cDNA from 10 of 63 normals in the range of 1–20 copies/106 white blood cells. Corey et al. (48 ) reported the detection of 1 prostate cancer cell in 108 peripheral blood mononuclear cells. They used an internal control, IC-PSA/pGEM-3Z cDNA plasmid, to control the variations in amplification and a detection limit control (PSA/pGEM-3Z cDNA plasmid), which corresponded to the detection of approximately 5 copies of PSA cDNA plasmid. Galvan et al. (9 ) obtained a detection limit of 160 molecules of PSA-pA75 cDNA plasmid with a signal-to-background ratio of 10. Furthermore, they reported the detection of 1 LNCaP cell in 106 HL-60 cells. Gala et al. (18 ) tested different number of PCR cycles and obtained at 2 3 25 cycles a detection of 1 copy of PSA


cDNA from pGEM-PSA7 plasmid and ;1.9 LNCaP cells in 106 peripheral blood mononuclear cells. The controversy on the utility of RT-PCR methods in molecular staging is probably attributable to the variations between different assays. As the detection sensitivities have improved, the number of reports on basal or illegitimate expression of PSA mRNA copies has also increased. Based on the results to date, it has been suggested that more standardized and quantitative RT-PCR assays should be used to study the clinical utility of the RT-PCR assays in the management of prostate cancer patients (17, 18, 47, 49). Special attention should be paid to variations during sample collection and preparation to obtain RNA with good quality and quantity. Equally important is standardization of the assay conditions in RT-PCR amplification and in detection of the amplification products to obtain reproducible and reliable results. In our study, variations during RNA extraction of the sample, RT-PCR amplification, and detection of the amplification products were controlled with a PSA-like IS. PSA and IS targets were coamplified by RT-PCR, and after a single PCR, the PSA and IS amplification products were detected in separate streptavidin-coated microtitration wells with specific Eu31-chelate-labeled oligonucleotide probes. The use of only one PCR with a relatively small number of cycles (28 cycles) obviated the possibility of contamination associated with a high number of PCR cycles or nested PCR. The use of 28 cycles produced a detection limit of 50 PSA copies and linearity up to 106 copies. In addition to the 28 PCR cycles, the cancer samples were amplified for 35 PCR cycles (data not shown). When quantified, the number of PSA copies was shown to be approximately the same regardless of whether 28 or 35 cycles were used. However, the use of 35 cycles produced a higher background and higher risk for contamination. Therefore, the use of 28 cycles was preferred. The specific oligonucleotide hybridization assay performed in microtitration wells allowed simultaneous detection of large numbers of samples and was more practical to perform than analyses based on gel electrophoresis, Southern transfer, and membrane hybridization. The use of lanthanide chelates and time-resolved fluorometry provided a rapid, accurate, and nonradioactive method (35–37 ). In addition, the time-resolved fluorescence technology provided numerical results that were easy to interpret and useful for quantification. Different steps of the assay were optimized one at a time to obtain a low limit of detection and high specificity of the RT-PCR assay for PSA mRNA. The identical efficiency of amplification of the PSA and IS targets allowed quantification of PSA mRNA copies in samples. In addition, the PSA and IS targets were amplified independently from each other until the amplification reached the saturation phase. The saturation phase had an effect on the amplification of the PSA and IS samples when the total number of target molecules was high (106 to 107 PSA molecules, 105 IS

1405

molecules). During the saturation phase, the amount of IS amplification product from 105 molecules decreased, and the increase in the amount of PSA amplification product from 106 to 107 molecules reached a plateau as well (Fig. 3). With this method, we could detect 1 LNCaP cell in 2.5 3 106 SP2/0 cells with a mean of 1.3 3103 (6 800) PSA mRNA copies in 1 LNCaP cell. The limit of detection was 500 PSA mRNA copies in 5 mL of blood or in 5 3 106 to 10 3 106 nucleated blood cells. Therefore, the limit of detection could correspond to ;1 PSA mRNA-producing cell in 5 3 106 to 4.2 3 107 nucleated blood cells if each prostate cancer cell contains 500-2100 copies of PSA mRNA. We determined the number of PSA mRNA copies in peripheral blood samples from 10 patients with metastatic prostate cancer, 19 healthy male subjects, and 15 healthy female subjects. In prostate cancer patients with skeletal metastases, 60% gave a result above the detection limit with the total number of PSA mRNA copies ranging from 900 6 200 to 44 100 6 4900 (mean 6 SD) in 5 mL of blood. This corresponded to approximately 1–100 PSA-expressing cells in 5 mL of blood or in 5 3 106 to 10 3 106 nucleated blood cells. However, the different therapies of the prostate cancer patients might have had an effect on the expression and number of PSA mRNA copies (6 ), or the poorly differentiated prostate cancer cells may have lost their ability to express PSA (50 ). None of the 15 healthy female controls and 2 of 19 healthy male controls had a PSA signal above the detection limit [700 6 100 and 2000 6 900 (mean 6 SD) copies of PSA mRNA in 5 mL of blood for the 2 male volunteers]. Gala et al. (18 ) studied the PSA expression in nondiseased blood samples and reported PSA mRNA in 11.8% (2 of 17) and 28.6% (4 of 14) of healthy men and women, respectively. However, after multiple testing, the positivity for PSA mRNA dropped to 3.0% in men and 9.8% in women. Our results of the three analyses of the same RNA samples showed that 40% (4 of 10) of the patients with advanced prostate cancer were negative and 10% of the healthy male controls were positive for PSA mRNA, which questions the clinical value of RT-PCR for PSA mRNA in the diagnosis and monitoring of prostate cancer (50 ). Although, PSA is one of the most specific tumor markers, the finding of PSA mRNA in samples from healthy donors restricts the ability of RT-PCR assays to detect micrometastatic tumor cells. This reflects the lack of tumor specificity of PSA (51 ). Another drawback of this assay is that it cannot distinguish whether the number of PSA mRNA copies indicates a few cells that contain many PSA mRNA molecules or many cells that contain a few PSA mRNA molecules. However, this quantitative assay provides a valuable tool for further studies to establish the clinically significant number of PSA mRNA copies and to determine the number of PSA mRNA copies in PSA-expressing cells. Furthermore, the clinical utility of this quantitative assay needs to be demonstrated by studying a more extensive

1406


number of healthy controls and prostate cancer cases with a broader range of cancer stages. In conclusion, this QRT-PCR assay provides sensitive, quantitative, and linear detection of PSA gene expression from blood samples. The method involves the use of an IS mRNA that is coextracted and coamplified with PSA mRNA in the sample. This allows an accurate quantification of PSA mRNA copies in the sample. This assay can be used to establish the clinically significant number of PSA mRNA copies in prostate cancer cases. The ultimate impact of this technique in the molecular staging of prostate cancer will require continued investigation.

This work was supported by grants from the Biomed 2 Program, area 4.1.7. (Contract BMH4-CT96-0453); the Swedish Cancer Society (Project 3555); the Faculty of Medicine at Lund University Hospital, Malmo¨; the Crafoord Foundation; the Gunnar, Arvid and Elisabeth Nilsson Foundation; and Fundacion Frederico S.A. We thank Teija Ristela¨ for reviewing the linguistic form of the text.

References 1. Smith B, Selby P, Southgate J, Pittman K, Bradley C, Blair GE. Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction. Lancet 1991;338:1227–9. 2. Komeda T, Fukuda Y, Sando T, Kita R, Furukawa M, Nishida N, et al. Sensitive detection of circulating hepatocellular carcinoma cells in peripheral venous blood. Cancer 1995;75:2214 –9. 3. Mattano LA Jr, Moss TJ, Emerson SG. Sensitive detection of rare circulating neuroblastoma cells by the reverse transcriptasepolymerase chain reaction. Cancer Res 1992;52:4701–5. 4. Moreno JG, Croce CM, Fischer R, Monne M, Vihko P, Mulholland SG, Gomella LG. Detection of hematogenous micrometastasis in patients with prostate cancer. Cancer Res 1992;52:6110 –2. 5. Israeli RS, Miller WH Jr, Su SL, Powell CT, Fair WR, Samadi DS, et al. Sensitive nested reverse transcription polymerase chain reaction detection of circulating prostatic tumor cells: comparison of prostate-specific membrane antigen and prostate-specific antigenbased assays. Cancer Res 1994;54:6306 –10. 6. Jaakkola S, Vornanen T, Leinonen S, Rannikko S, Stenman U-H. Detection of prostatic cells in peripheral blood: correlation with serum concentrations of prostate-specific antigen. Clin Chem 1995;41:182– 6. 7. Hamdy FC, Lawry J, Anderson JB, Parsons MA, Rees RC, Williams JL. Circulating prostate specific antigen-positive cells correlate with metastatic prostate cancer. Br J Urol 1992;69:392– 6. 8. Katz AE, Olsson CA, Raffo AJ, Cama C, Perlman H, Seaman E, et al. Molecular staging of prostate cancer with the use of an enhanced reverse transcriptase-PCR assay. Urology 1994;43: 765–75. 9. Galvan B, Christopoulos TK, Diamandis EP. Detection of prostatespecific antigen mRNA by reverse transcription polymerase chain reaction and time-resolved fluorometry. Clin Chem 1995;41:1705–9. 10. Katz AE, De Vries GM, Begg MD, Raffo AJ, Cama C, O’Toole K, et al. Enhanced reverse transcriptase-polymerase chain reaction for prostate specific antigen as an indicator of true pathologic stage in patients with prostate cancer. Cancer 1995;75:1642– 8.

11. Cama C, Olsson CA, Raffo AJ, Perlman H, Buttyan R, O’Toole K, et al. Molecular staging of prostate cancer. II. A comparison of the application of an enhanced reverse transcriptase polymerase chain reaction assay for prostate specific antigen versus prostate specific membrane antigen. J Urol 1995;153:1373– 8. 12. Olsson CA, De Vries GM, Raffo AJ, Benson MC, O’Toole K, Cao Y, et al. Preoperative reverse transcriptase polymerase chain reaction for prostate specific antigen predicts treatment failure following radical prostatectomy. J Urol 1996;155:1557– 62. 13. Fadlon EJ, Rees RC, McIntyre C, Sharrard RM, Lawry J, Hamdy FC. Detection of circulating prostate-specific antigen-positive cells in patients with prostate cancer by flow cytometry and reverse transcription polymerase chain reaction. Br J Cancer 1996;74: 400 –5. 14. Rinker-Schaeffer CS, Partin AW, Isaacs WB, Coffey DS, Isaacs JT. Molecular and cellular changes associated with the acquisition of metastatic ability by prostatic cancer cells. Prostate 1994;25: 249 – 65. 15. Sokoloff MH, Tso CL, Kaboo R, Nelson S, Ko J, Dorey F, et al. Quantitative polymerase chain reaction does not improve preoperative prostate cancer staging: a clinicopathological molecular analysis of 121 patients. J Urol 1996;156:1560 – 6. 16. Smith MR, Biggar S, Hussain M. Prostate-specific antigen messenger RNA is expressed in non-prostate cells: implications for detection of micrometastases. Cancer Res 1995;55:2640 – 4. 17. O’Hara SM, Veltri RW, Skirpstunas P. Basal PSA mRNA levels detected by quantitative reverse transcriptase polymerase chain reaction (Q-RT-PCR-PSA) in blood from subjects without prostate cancer [Abstract]. J Urol 1996;155:418A. 18. Gala J-L, Heusterspreute M, Loric S, Hanon F, Tombal B, Van Cangh P, et al. Expression of prostate-specific antigen and prostate-specific membrane antigen transcripts in blood cells: implications for the detection of hematogenous prostate cells and standardization. Clin Chem 1998;44:472– 81. 19. Monne M, Croce CM, Yu H, Diamandis EP. Molecular characterization of prostate-specific antigen messenger RNA expressed in breast tumors. Cancer Res 1994;54:6344 –7. 20. Zarghami N, Diamandis EP. Detection of prostate-specific antigen mRNA and protein in breast tumors. Clin Chem 1996;42:361– 6. 21. Clements J, Mukhtar A. Glandular kallikreins and prostate-specific antigen are expressed in the human endometrium. J Clin Endocrinol Metab 1994;78:1536 –9. 22. Yu H, Diamandis EP, Levesque M, Giai M, Roagna R, Ponzone R, et al. Prostate specific antigen in breast cancer, benign breast disease and normal breast tissue. Breast Cancer Res Treat 1996;40:171– 8. 23. Diamandis EP. Prostate specific antigen—its usefulness in clinical medicine. Trends Endocrinol Metab 1998;9:310 – 6. 24. Diamandis EP, Yu H. Non-prostatic sources of prostate-specific antigen. In: Oesterling JE, ed. Prostate-specific antigen: the best prostatic tumor marker. The Urologic Clinics of North America, Vol. 24. Philadelphia, PA: WB Saunders, 1997:275– 82. 25. Syva¨nen A-C, Bengtstro¨m M, Tenhunen J, So¨derlund H. Quantification of polymerase chain reaction products by affinity-based hybrid collection. Nucleic Acids Res 1988;16:11327–38. 26. Chelly J, Kaplan J-C, Maire P, Gautron S, Kahn A. Transcription of the dystrophin gene in human muscle and non-muscle tissues. Nature 1988;333:858 – 60. 27. Becker-Andre´ M, Hahlbrock K. Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel approach by a PCR aided transcript titration assay (PATTY). Nucleic Acids Res 1989; 17:9437– 46. 28. Wang AM, Doyle MV, Mark DF. Quantitation of mRNA by the polymerase chain reaction. Proc Natl Acad Sci U S A 1989;86: 9717–21.


29. Gilliland G, Perrin S, Blanchard K, Bunn HF. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proc Natl Acad Sci U S A 1990;87: 2725–9. 30. Lundeberg J, Wahlberg J, Uhle´n M. Rapid colorimetric quantification of PCR-amplified DNA. Biotechniques 1991;10:68 –75. 31. Price T, Aitken J, Simpson ER. Relative expression of aromatase cytochrome P450 in human fetal tissues as determined by competitive polymerase chain reaction amplification. J Clin Endocrinol Metab 1992;74:879 – 83. 32. Tsuruta H, Matsui S, Oka K, Namba T, Shinngu M, Nakamura M. Quantitation of IL-1b mRNA by a combined method of RT-PCR and an ELISA based on ion-sensitive field effect transistor. J Immunol Methods 1995;180:259 – 64. 33. Bortolin S, Christopoulos TK, Verhaegen M. Quantitative polymerase chain reaction using a recombinant DNA internal standard and time-resolved fluorometry. Anal Chem 1996;68:834 – 40. 34. Bortolin S, Christopoulos TK. Quantitative RT-PCR combined with time-resolved fluorometry for determination of BCR-ABL mRNA. Clin Chem 1996;42:1924 –9. 35. Syva¨nen A-C, Tchen P, Ranki M, So¨derlund H. Time-resolved fluorometry: a sensitive method to quantify DNA-hybrids. Nucleic Acids Res 1986;14:1017–28. 36. Syva¨nen A-C, Laaksonen M, So¨derlund H. Fast quantification of nucleic acid hybrids by affinity-based hybrid collection. Nucleic Acids Res 1986;14:5037– 48. 37. Soini E, Lo¨vgren T. Time-resolved fluorescence of lanthanide probes and applications in biotechnology. CRC Crit Rev Anal Chem 1987;18:105–54. 38. Sund C, Ylikoski J, Hurskainen P, Kwiatkowski M. Construction of europium (Eu31)-labelled oligo DNA hybridization probes. Nucleosides Nucleotides 1988;7:655–9. 39. Dahle´n PO, Iitia¨ AJ, Skagius G, Frostell Å, Nunn MF, Kwiatkowski M. Detection of human immunodeficiency virus type 1 by using the polymerase chain reaction and a time-resolved fluorescence based hybridization assay. J Clin Microbiol 1991;29:798 – 804. 40. Lundwall Å, Lilja H. Molecular cloning of human prostate specific antigen cDNA. FEBS Lett 1987;214:317–22.

1407

41. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989;77:51–9. 42. Muller A, Hermann J, Fuchs D, Prager J, Burger E, Kob D, et al. Transplantation of major ABO-incompatible bone marrow: removal of red blood cells by dextran sedimentation. Folia Haematol Int Mag Klin Morphol Blutforsch 1989;116:475–9. 43. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156 –9. 44. Jung R, Lu¨bcke C, Wagener C, Neumaier M. Reversal of RT-PCR inhibition observed in heparinized clinical specimens. Biotechniques 1997;23:24 – 8. 45. Raeymaekers L. Quantitative PCR. Theoretical considerations with practical implications. Anal Biochem 1993;241:582–5. 46. Rong H, Ji H, Pernow Y, Sjo¨stedt U, Bucht E. Quantification of parathyroid hormone-related protein mRNA by competitive PCR and time-resolved lanthanide fluorometry. Clin Chem 1997;43: 2268 –73. 47. Israeli RS, Miller WH, Su SL, Samadi DS, Powell CT, Heston WDW, et al. Sensitive detection of prostatic hematogenous tumor cell dissemination using prostate specific antigen and prostate specific membrane-derived primers in the polymerase chain reaction. J Urol 1995;153:573–7. 48. Corey E, Arfman EW, Liu AY, Vessella RL. Improved reverse transcriptase-polymerase chain reaction protocol with exogenous internal competitive control for prostate-specific antigen mRNA in blood and bone marrow. Clin Chem 1997;43:443–52. 49. Slawin K, O’Hara SM, Song W, Gottenger E, Wang D, Veltri RW, et al. Comparison of results obtained using different RT-PCR-PSA assay methods on a single set of clinical specimens [Abstract]. J Urol 1996;155:417A. 50. Diamandis EP, Yu H. Prostate cancer, prostate-specific antigen, and the polymerase chain reaction [Editorial]. Clin Chem 1995; 41:1177–9. 51. Pelkey TJ, Frierson HF Jr, Bruns DE. Molecular and immunological detection of circulating tumor cells and micrometastases from solid tumors [Review]. Clin Chem 1996;42:1369 – 81.