Rap1gap2 regulates axon outgrowth in olfactory ...

Molecular and Cellular Neuroscience 50 (2012) 272–282

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Neuroscience journal homepage: www.elsevier.com/locate/ymcne

Rap1gap2 regulates axon outgrowth in olfactory sensory neurons Benjamin Sadrian ⁎, Ting-Wen Cheng, Olivia Shull, Qizhi Gong ⁎ Department of Cell Biology and Human Anatomy, University of California, Davis, School of Medicine, One Shields Avenue, Davis, CA 95616, USA

a r t i c l e

i n f o

Article history: Received 16 April 2012 Revised 13 June 2012 Accepted 14 June 2012 Available online 23 June 2012 Keywords: OSN Axon outgrowth Axon guidance Rap small GTPase RapGAP

a b s t r a c t Olfactory sensory neurons (OSNs) extend their axons from the nasal epithelium to their odorant receptor-dependent locations in the olfactory bulb. Previous studies have identified several membrane proteins along the projection pathway, and on OSN axons themselves, which regulate this process; however, little is known about the signaling mechanisms through which these factors act. We have identified and characterized Rap1gap2, a novel small GTPase regulator, in OSNs during early postnatal mouse development. Rap1gap2 overexpression limits neurite outgrowth and branching in Neuro-2a cells, and counteracts Rap1-induced augmentation of neurite outgrowth. Rap1gap2 expression is developmentally regulated within OSNs, with high expression in early postnatal stages that ultimately drops to undetectable levels by adulthood. This temporal pattern coincides with an early postnatal plastic period of OSN innervation refinement at the OB glomerular layer. Rap1gap2 stunts OSN axon outgrowth when overexpressed in vitro, while knock-down of Rap1gap2 transcript results in a significant increase in axon length. These results indicate an important role of Rap1gap2 in OSN axon growth dynamics during early postnatal development. © 2012 Elsevier Inc. All rights reserved.

Introduction Olfactory sensory neurons (OSNs), located in the olfactory epithelium (OE), typically express one odorant receptor (OR) out of a repertoire of over 1000 OR genes (Buck and Axel, 1991; Chess et al., 1994; Malnic et al., 1999). OR gene choice establishes a population identity in which homotypic OSNs converge their axons toward specific target glomeruli in the OB (Mombaerts et al., 1996; Ressler et al., 1994; Wang et al., 1998). This process perpetuates throughout life as OSNs regenerate, thereby maintaining the projection map. Topographic specificity is coordinated through directive interactions between OSNs and their extracellular environment, as well as through OSN population sorting amongst themselves (Imai and Sakano, 2009; Miller et al., 2010). Axon guidance ligands, receptors and cell adhesion molecules are known to play critical roles in the development of primary olfactory connections (Cho et al., 2007; Cutforth et al., 2003; Serizawa et al., 2006; Taniguchi et al., 2003). Genetic experiments have provided seminal discoveries of signaling mechanisms involved in OSN axon growth and convergence by demonstrating that variable levels of cAMP and PKA activities can influence OSN convergence (Imai et al., 2006; Serizawa et al., 2006). The specific cell signaling mechanisms of OSN axon extension, guidance, glomerular innervation and retention of OB synaptic contacts, however, have yet to be elucidated.

⁎ Corresponding authors at: Department of Cell Biology and Human Anatomy, School of Medicine, University of California, Davis, CA 95616, USA. E-mail addresses: [email protected] (B. Sadrian), [email protected] (Q. Gong). 1044-7431/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2012.06.003

The Ras-related small GTPase Rap1 is a significant signaling hub in neuronal development, as it promotes neuronal process outgrowth (Chen et al., 2005; Kiermayer et al., 2005; Lu et al., 2000; York et al., 1998), midline commissure formation (Bilasy et al., 2011b), maturation of dendritic spines in hippocampus pyramidal neurons(Pak et al., 2001; Xie et al. 2005; McAvoy et al., 2009) and supports cortical neuron migration and orientation during development (Jossin and Cooper, 2011). Additionally, Rap is an integral component of multiple cell functions associated with proper nerve development; for example, cadherin and integrin-based cell adhesion (Kooistra et al., 2007), cytoskeletal remodeling (Birukova et al., 2007), sustained NGF-induced activation of ERK (Arevalo et al., 2004; Stork, 2005), and ephrin-induced cytoskeletal contraction (Aoki et al., 2004; Riedl et al., 2005). Rap1 switches between inactive (GDP-bound) and active (GTPbound) signaling states, which are delicately coordinated through interactions with Rap1 regulatory proteins. Guanine nucleotide exchange factors (RapGEFs) promote Rap1 activation by facilitating GDP dissociation from Rap1, allowing for subsequent binding of abundant intracellular GTP. GTPase activating proteins (RapGAPs) on the contrary, accelerate Rap1-GTP hydrolysis toward an inactive GDP-bound state. RapGEF and RapGAP expression, localization and activation are therefore tightly regulated to usher Rap1 signaling toward specific cellular outputs (Bos et al., 2007). The RapGAP superfamily of Rap regulators has in turn been shown to influence multiple dimensions of neuronal morphogenesis; specifically, the restriction of neuronal process outgrowth (He et al., 2006; Jordan et al., 2005) and shortening of dendritic spine length (McAvoy et al., 2009; Pak et al., 2001; Richter et al., 2007), of which are believed to occur primarily through RapGAP regulation of Rap1 (Spilker and Kreutz, 2010).

B. Sadrian et al. / Molecular and Cellular Neuroscience 50 (2012) 272–282

We report here the identification of a novel mouse RapGAP, called mouse Rap1gap2 (mRap1gap2). Biochemical and cell culture assays confirm mRap1gap2 possesses RapGAP activity. mRap1gap2 is expressed in brain and olfactory tissue, and is developmentally regulated in OSNs. mRap1gap2 significantly stunts OSN axon outgrowth in vitro when overexpressed, and results in dramatically elongated OSN axons when knocked down. These results indicate a role for mRap1gap2 in early development of the mouse olfactory system, likely through regulation of Rap1 signaling. Results Identification of mouse Rap1gap2 An annotated transcript named GTPase activating RanGAP-like 4 (Garnl4) was cloned from olfactory epithelium. Upon cloning of the full-length cDNA, we identified that the Garnl4 protein sequence contains a highly conserved RapGAP domain (Fig. 1A). We performed a phylogenetic tree analysis comparing RapGAP family protein sequences from mice and homologs from other species. We also included GAPs of other small GTPase subfamilies such as RacGAP, Rasa-1 (a RasGAP), and RanGAP (Fig. 1C). Garnl4 showed the closest amino acid sequence homology with human RAP1GAP2, and had significantly less homology to mouse Rap1gap1, which had the next greatest sequence homology to Garnl4 in the mouse genome. Human RAP1GAP2 was originally identified as the only known RapGAP expressed in platelets (Schultess et al., 2005). Protein sequence alignment of human RAP1GAP2 and Garnl4, which we will refer to as mouse Rap1gap2 (mRap1gap2) in the rest of the article, reveals over 95% sequence homology in the RapGAP domain (Fig. 1B). The mRap1gap2 amino acid sequence includes the RKRXXGN motif including the conserved “asparagine thumb”, which is critical for RapGAP enzymatic function (Daumke et al., 2004; Scrima et al., 2008). Though mRap1gap2 possesses molecular characteristics of a RapGAP, the enzymatic activity of mRap1gap2 has not been experimentally validated. In order to determine if mRap1gap2 is capable of deactivating Rap1, we performed a non-radioactive Rap1 activation assay (Franke et al., 1997). COS-7 cells were transfected at 85–90% efficiency with either the full-length mRap1gap2 coding sequence fused to GFP or with a GFP plasmid alone as a control. The active GTP-bound form of Rap1 was pulled down by the Ras-binding domain (RBD) of RalGDS, a downstream effector of activated Rap1, from COS-7 protein extracts. Active Rap1 levels were evaluated by immunoblotting. COS-7 cells with mRap1gap2 over-expression had significantly reduced levels of active Rap1 relative to the GFP only control. The levels of active Rap1 versus total Rap1 were quantified and compared between mRap1gap2 and GFP-only expressing cells (Rap1active:Rap1total). Rap1gap2 overexpression resulted in a significant decrease in active Rap1 pulled down versus GFP overexpression control pulldowns (mRap1gap2: mean=0.24± 0.026, n=3 vs. GFP: mean=0.52±0.006, n=3; one-way ANOVA: treatment×relative proportion of active Rap1 measured, F(3,8) =22.39, Tukey post-hoc test pb0.01, see Fig. 1D). Two different concentrations of mRap1gap2 plasmids were used for transfection in this assay to attain a dose-dependent effect. However, no difference was observed because the maximum efficiency was reached with the 10ug dose, providing a significant reduction of active Rap1 in this assay. The inactivation of Rap1 by mRap1gap2 was equivalently achieved by overexpression of human RAP1GAP2, used as a positive control. The human RAP1GAP2 ortholog of closest protein sequence homology to mRap1gap2, and has already been shown to decrease active Rap1 in a Rap1 activity assay under similar conditions (Schultess et al., 2005). Based on the protein sequence homology to human Rap1gap2 and our demonstration of Rap1GAP activity here, we have determined that the annotated transcript Garnl4 is the novel mouse Rap1gap2. We further examined the capacity of mRap1gap2 to regulate Rap1 in a neuronal cell context. Rap1 signaling has been shown to strongly

273

influence neurite extension and branching in Neuro-2a and PC12 cells (Kiermayer et al., 2005; Ma'ayan et al., 2009). To test Rap1gap2 function in a neuronal cell model in which Rap1 influence in neurite outgrowth has been established, we transfected Neuro-2a cells and performed a neurite outgrowth assay (Goshima et al., 1993). Twenty-four hours after transfection Neuro-2a cells were serum-starved and induced to extend neurites for 8 h, and then fixed for neurite measurement. Cells extending a process longer than two times their cell body diameter were quantified for total neurite length per cell in comparison with GFP only transfection control cells. Overexpression of Rap1 resulted in a significant increase in total neurite length per cell (Rap1 WT: mean±SE=95.29±7.85μm, n=81 vs. GFP: 70.91±4.15μm, n=86; one-way ANOVA: treatment×total neurite length per cell, F(4,355) = 12.78, Tukey post-hoc test pb0.01, Figs. 2A, C, F). This result is in agreement with previous studies, which have shown Rap1-induced neurite outgrowth in heterologous cell systems of a neuronal origin (Hisata et al., 2007; Jordan et al., 2005; Lu et al., 2000). We also observed a significant increase in the frequency and length of fillipodial outgrowths along these processes (data not shown). To test for a role in neurite outgrowth for Rap1gap2 in a neuronal system, we overexpressed Rap1gap2 as a full-length myc fusion construct in the same Neuro-2a outgrowth assay. Overexpression of Rap1gap2 resulted in a lower average total neurite length per cell that was not significantly different from GFP only control transfections (Rap1gap2: mean±SE=55.54± 3.95μm, n=81 vs. GFP: 70.914.15 μm, n=86; one-way ANOVA with Tukey post-hoc test, p>0.05, see Figs. 2D, F). We reasoned that Rap1 activation levels were either endogenously basal in Neuro2a within this outgrowth assay system, or Rap1 signaling toward neurite outgrowth is supported by redundancy from other signaling pathways, and therefore the lack of significant reduction of neurites with Rap1gap2 overexpression does not indicate a failure of Rap1gap2 to regulate Rap1 activity. To confirm this, we overexpressed a dominant-negative Rap1(S17N) mutant in Neuro-2a cells and examined neurite outgrowth. Again, we observed a slight reduction of average total neurite length per cell similar to Rap1gap2 overexpression but not to a significant degree relative to GFP controls (Rap1(S17N): mean±SE56.18± 3.33μm, n=87 vs. GFP: 70.91±4.15 μm, Tukey post-hoc test, n=86, see Figs. 2A, B, F). While overexpression of Rap1 displays a significant increase in neurite length, deactivation of Rap1 did not, whether with Rap1gap2 overexpression or dominant negative Rap1(S17N) overexpression. Due to this limitation, we utilized Rap1overexpression as a baseline of Rap1 influence on neurite outgrowth as described above in order to test whether the novel mouse Rap1gap2 could counter Rap1 activity in Neuro-2a cells. Neuro-2a cells were co-transfected with Rap1 and Rap1gap2-myc for the neurite outgrowth assay. Rap1gap2 prevented Rap1-induced outgrowth, resulting in significantly shorter neurite lengths compared to cells transfected with Rap1 only (Rap1 WT+Rap1gap2: mean±SE=54.09±3.26μm, n=85 vs. Rap1 WT only: 95.29±7.85μm, n=81; one-way ANOVA: treatment×total neurite length per cell, F(5,401) =12.78, Tukey post-hoc test pb0.001; Fig. 2F). Rap1gap2 overexpression alone also significantly reduced the degree of branching per cell compared to a GFP only control in the same Neuro-2a outgrowth assay (Rap1gap2: mean±SE=1.46 branches per cell±0.18, n=81 vs. GFP: 0.79 branches per cell±0.13, n=86; one-way ANOVA: treatment×number of primary branches per cell, F(5,401) =7.32, pb0.05, see Fig. 2G). The data we have presented here collectively conclude that mouse Rap1gap2 is a novel RapGAP, and validates a regulatory capacity against Rap1-induced neurite outgrowth. mRap1gap2 expression is restricted in the nervous system Members of the RapGAP gene family generally exhibit differential expression patterns in specific cell populations and tissue types (reviewed in Spilker and Kreutz, 2010). Human RAP1GAP2, which has amino acid sequence homology closest to mRap1gap2, was isolated from platelets, but is also expressed in the central nervous system

274


Fig. 1. Garnl4 is a novel mouse Rap1GAP. A) Full length Garnl4 amino acid sequence contains a highly conserved Rap1GAP homology. In addition, Garnl4 (mRap1gap2) possesses a TKXT motif shown to enable binding of synaptotagmin-like protein 1 in human RAP1GAP2. B) Full length amino acid sequence alignment of both human RAP1GAP2 isoforms 1 [NP_055900.4] against mouse Rap1gap2 [mRap1gap2 — NP_001015046.1, formerly named Garnl4] illustrates the high degree of amino acid sequence similarity, especially in their RapGAP domain (outline box), which includes the vital asparagine thumb catalytic center RKRXXGN (inset box). C) Phylogenetic tree analysis of Garnl4 in comparison with other small GTPase GAPs from mice and other species. Abbreviations: d = drosophila, h = human, m = mouse, n = nematode, z = zebrafish. This comparison includes mouse Rangap, as the putative gene annotation Garnl4 was originally labeled (GTPase activating RanGAP-like 4) despite carrying the least sequence identity presented here. Garnl4 is most closely related to human RAP1GAP2. Scale bar 1.0=100 amino acid sequence point variations. D) Mouse Rap1gap2 (Garnl4) has RapGAP activity. Assay controls included pull down of hyperactivated Rap1 through extract incubation with the non-hydrolyzable GTPγS analog and negligible pulldown of deactivated Rap1 in which extract was incubated with GDP. Active Rap1 that is pulled down decreased in COS-7 cell extracts that overexpressed Rap1gap2-GFP (Garnl4-GFP) versus GFP vector control. E). Band intensity relative to total Rap1. A human RAP1GAP2 construct was used as an additional positive control for this assay.

(Schultess et al., 2005). To characterize tissue expression of mRap1gap2, we generated an antibody specific to the C-terminus of mRap1gap2 (see Experimental methods section). The peptide antigen chosen diverges greatly in sequence identity from other mouse RapGAPs. The specificity of our mRap1gap2 antibody was confirmed by immunoblotting and immunostaining (Fig. 3A). Soluble protein extracts of various mouse tissues were immunoblotted with this antibody to study endogenous mRap1gap2 expression. We detected mRap1gap2 protein in the cerebral cortex, hippocampus, and olfactory bulb. Expression of mRap1gap2 in the cerebellum, retina and various non-neuronal tissues was not detected (Fig. 3B).

mRap1gap2 expression is developmentally regulated in olfactory sensory neurons To better understand mRap1gap2's function in olfactory development, we characterized its expression pattern in the OE and the OB from which mRap1gap2 was originally detected. mRap1gap2 staining was found in the OE at embryonic day 16 (E16), the earliest stage examined (Fig. 4). Immunostaining did not overlap with olfactory marker protein (OMP), a marker for mature olfactory sensory neurons. mRap1gap2 immunostaining appeared in the apical layer of the OE at this stage and was likely expressed by sustentacular cells


275

Fig. 2. Rap1gap2 inhibits Rap1-induced neurite outgrowth. Neuro-2a cells were transfected with Rap1 and Rap1gap2 experimental constructs. Neuro-2a cell morphology was evaluated 32 h after transfection. A–C) Neuro-2a cells transfected with Rap1 (C) showed a dramatic increase in total neurite length per cell over cells transfected with GFP only in (A). This effect was neutralized when a dominant negative version of Rap1 was overexpressed with endogenous wild type Rap1 (B). D) mRap1gap2 overexpression mimicked this effect of neurite length reduction, implicating an analogous effect of Rap1 deactivation. E) Co-transfection of mRap1gap2 with wild-type Rap1 offset the Rap1-induced effects of longer neuritis. F) Neurite outgrowth was quantified as total neurite length per cell. mRap1gap2 was effective in reducing Rap1-induced increases in neurite outgrowth. One-way ANOVA and Tukey post-hoc test analysis: Rap1 WT versus GFP control, and Rap1 WT versus Rap1 WT+Rap1gap2 co-transfection * pb0.01. G) All co-transfections containing mRap1gap2 significantly reduced the number of primary branches per cell as well. Statistical significance determined by one-way ANOVA and Tukey post-hoc test versus GFP control and versus Rap1 WT transfection * pb0.05. Scale bar=20 μm.

(Fig. 4A). At P0, mRap1gap2 expression was detected in the neuronal layer of the OE, co-localizing with OMP expressing OSNs. OSN axon bundles were also shown positive for mRap1gap2 expression. In addition, sustentacular cells in the OE showed continuous expression of mRap1gap2 (Fig. 4D). In staining of adult tissue, mRap1gap2 expression was no longer detected in the OE (Fig. 4G). The postnatal upregulation of mRap1gap2 protein expression is consistent with the transcript expression pattern detected independently by qRT-PCR (data not shown). We also examined the expression pattern of mRap1gap2 in the OB from which its annotated transcript was originally detected. mRap1gap2 protein signal was surprisingly not detected in resident cell populations of the OB. Rather, Rap1gap2 staining in the OB was sequestered to the olfactory nerve layer and glomerular layer, again co-localizing with OMP. Therefore, the mRap1gap2 immunoblot signal we detected from OB extracts actually came from olfactory sensory axons at the olfactory nerve layer and glomerular layer. mRap1gap2 expression was detected in the OB olfactory nerve layer (ONL) at P0, the earliest stage examined for the OB. mRap1gap2 immunostaining signal persisted strongly in the olfactory nerve layer as well as in most glomeruli of the OB at P7 (Fig. 5A). At P28, mRap1gap2 immunostaining signal began to decrease in the glomerular layer of the OB (Fig. 5D). During this period, a subpopulation of glomeruli became negative for mRap1gap2 expression, while others remained positive. No patterns were apparent. By P42, mRap1gap2 expression was not detectable in the OB (Fig. 5G). mRap1gap2 regulates OSN axon outgrowth in vitro Rap1 has been shown to promote neurite outgrowth and branching in cortical neurons in vitro (Chen et al., 2005), and a conditional knockout of the Rap1 activator Rapgef2 resulted in a disruption of commissural axon extension across the cortical midline (Bilasy et al., 2011a). These findings imply that Rap1 activity is vital to proper axon outgrowth. To directly test whether the Rap1 regulator mRap1gap2 has a functional role in OSN axon outgrowth, we designed a shRNA to knock-down

mRap1gap2 in cultured primary OSNs. The knock-down efficiency of the shRNA (Rap1gap2-RNAi) was evaluated by co-transfecting COS-7 cells with a myc-tagged mRap1gap2 expression vector and our shRNA construct. A 90% knock-down of mRap1gap2 was achieved by the shRNA when compared to co-transfection with a GFP vector control (Fig. 6A). We also designed a control shRNA (Control-RNAi) by changing four nucleotides from the original mRap1gap2 target transcript (see Experimental methods section). No change in protein signal was observed when the mutated shRNA (Control-RNAi) was co-transfected with mRap1gap2 into COS-7 cells compared GFP only control vector co-transfection with mRap1gap2 (Fig. 6B). These results indicate ineffective knock-down and an insignificant non-specific effect of the shRNA vector backbone on mRap1gap2 Primary OSN culture is not readily transfected. We therefore produced lentiviral particles that were delivered at the time of the plating in order to achieve genetic manipulation of OSNs in vitro (Chen et al., 2008). To assess the knock-down efficiency of our Rap1gap2 shRNA in OSNs in vitro, OSNs were infected with either lentivirus carrying either a GFP control vector, or the Rap1gap2 RNAi vector containing the shRNA confirmed above. Co-immunostaining of GFP-positive (infected) OSNs with mRap1gap2 antibody showed lower staining intensity in OSNs expressing mRap1gap2 RNAi compared to the GFP vector backbone (Fig. 6C), thereby confirming efficient knock-down of mRap1gap2 in OSNs by viral delivery of our mRap1gap2 shRNA construct in vitro. To determine if knocking down Rap1gap2 in OSNs affects axon outgrowth in vitro, cultured OSNs were infected with lentiviruses expressing either GFP as a control, myc-tagged mRap1Gap2 for overexpression, shRNA for mRap1gap2 knock-down (Rap1gap2-RNAi), or a negative control version of the shRNA design with four mutated bases (RNAi control). The average axon length in the GFP control culture was normalized to 100%. Measurements of axon length in the experimental groups were thus presented as a percentage relative to the mean axon length of the GFP control after three independent trials (Fig. 6D). mRap1gap2 over-expression stunted OSN axon outgrowth compared to GFP control

276


Fig. 3. mRap1gap2 tissue expression. Immunoblotting of COS-7 cell extracts overexpressing a Rap1gap2-GFP fusion construct shows the binding specificity of the custom mRap1gap2 antibody. A) Anti-GFP immunoblotting shows the same band detected by anti-mRap1gap2 immunoblotting. mRap1gap2 immunocytochemistry (A′) with mRap1gap2-GFP overexpression in COS-7 cell demonstrate co localization of GFP with mRap1gap2. The neighboring non-transfected cell shows only DAPI chromatin staining. B) Immunoblotting of mouse tissue extracts with the mRap1gap2 antibody shows an 80 kDa protein product exclusively in brain and olfactory tissue. COS-7 cells overexpressing mRap1gap2-GFP were included as a positive control for our antibody's ability to specifically detect mRap1gap2. GFP-tagged control band is shifted higher (106 kDa) than the endogenous mRap1gap2 detected due to the added 237aa of the E-GFP fluor tag. Scale bar=20 μm in A′.

virus exposure (Rap1gap2-myc: normalized mean±SE=57.3%±2.6, n=195; GFP control: 100%±4.3; n=191, one-way ANOVA: treatment×total axon process lengths, F(3,590) =44.02, Tukey post-hoc test, pb0.05, Figs. 6D and E). These results are comparable to our Neuro-2a data, where total neurite outgrowth decreased with Rap1gap2 overexpression (Fig. 2D). Conversely, introducing Rap1gap2 shRNA expressing resulted in a significant increase of OSN axon length in vitro compared to the control (Rap1gap2-RNAi: normalized mean± SE=166.3%±14.5, n=112 vs. GFP control: 100%±4.3; Tukey post-hoc test, pb0.01) while the control shRNA did not change the outgrowth of OSN axons (control shRNA: normalized mean±SE=97.3%±5.3, n=96 vs. GFP control: 100%±4.3; Tukey post-hoc test pb0,01, Figs. 6D and E). These data indicate that Rap1gap2 plays an inhibitory role in OSN axon outgrowth. Discussion Development of olfactory sensory axon projections is highly regulated during development, yet few signaling molecules have been identified in this process. In this study we identified a novel small GTPase regulator mRap1gap2 in the developing olfactory system. mRap1gap2 shows transient expression at the protein level in OSNs, which are upregulated at birth and progressively downregulated to undetectable levels by adulthood. Our data indicate mRap1gap2 restricts neurite outgrowth and branching in the Neuro-2a heterologous cell system, limits axon extension in OSN primary culture when overexpressed, and results in overgrown OSN axon processes when knocked down. We found that mRap1gap2 protein sequence possesses an asparagine thumb catalytic residue universal to all previously cloned RapGAPs. This feature endows RapGAPs with a unique catalytic mechanism complementary to Rap small GTPases. This is specifically due to the fact that Rap proteins lack a Gln61 residue found in the catalytic center of all other Ras family GTPases (Daumke et al., 2004; Scrima et al., 2008). This variation of mechanism results in an exclusive regulatory relationship between RapGAPs and their cognate Rap GTPases (Sot et al., 2010), as opposed to GAP regulation crossover that is known to occur between members of other GTPase subfamilies. mRap1gap2 possesses the

conserved asparagine thumb motif and a 95% protein sequence homology with human Rap1GAP2 between GAP domains (Fig. 1A). As human Rap1GAP2 has previously been shown effective in deactivating Rap1, yet ineffective at deactivating Ras GTPase (Schultess et al., 2005), we anticipate that the novel mRap1gap2 GAP domain exhibits the same regulatory exclusivity to Rap small GTPases. The identification of a RapGAP in developing mouse OSNs therefore alludes to functions specific to Rap signaling pathways in OSN development. Neuro-2a neurite length was reduced with mRap1gap2 overexpression, even when co-expressed with Rap1. In addition to a RapGAP domain identity the mRap1gap2 protein sequence possesses a conserved TKXT motif, which is required for the only reported alternate function of human Rap1GAP2 independent of Rap1 regulation. Through the TKXT motif, human Rap1GAP2 was shown to bind synaptotagmin-like protein 1 (Slp1) and complex with Rab27 to promote granule secretion in platelets (Neumuller et al., 2009). This role in vesicular secretion intrigues contemplation of additional functions for mRap1gap2 in nerve development independent of Rap1 regulation. Overexpression of mRap1gap2 in vitro resulted in shorter OSN axons, while knock-down of mRap1gap2 resulted in OSN axons significantly longer than GFP-infected controls. These results agree with previous studies supporting a model of neuronal outgrowth promoted by RapGEFs/Rap1 activation, and on the counter, growth restriction by RapGAPs/Rap1 deactivation (Chen et al., 2005; He et al., 2006; Jordan et al., 2005; Kiermayer et al., 2005; Ma'ayan et al., 2009; Yamada et al., 2005). OSN axons do generate terminal tufts in culture, but there is no secondary branch growth along the single OSN primary process that would allow us to address mRap1gap2 effects on branching in OSNs. Our in vitro results on axon outgrowth do in any case show that mRap1gap2 inhibits olfactory axon extension. This function is likely balanced by outgrowth signaling within olfactory axons in vivo. Guidance cues, cell adhesion molecules and glycoproteins along the OSN projection pathway help axons grow, guide toward, and innervate OB glomeruli (Anneren et al., 2000; Bertoni et al., 2002; Gong and Shipley, 1996; Kafitz and Greer, 1998; Lipscomb et al., 2002; Treloar et al., 1999). These factors interact directly and indirectly with Rap1 signaling, which together strike a balance and dynamically direct axon growth through developmental


277

Fig. 4. Developmental expression of Rap1gap2 in the olfactory epithelium. A–C) mRap1gap2 expression is detected in the apical layer of the OE at E16. mRap1gap2 expression (red, arrowheads in A–C) does not overlap with OMP expression (green, arrows in B–C) at this early stage. D–F) mRap1gap2 is observed in both the apical and olfactory sensory neuron layer of the OE at P0. Many mRap1gap2-positive cells (red, arrows in D–F) also express OMP (green, arrows in E–F) at this stage. Some mRap1gap2 positive cells are located in the apical cell layer of the OE which do not express OMP (arrowheads in D–F), and are sustentacular cells (downward arrowheads within insert) indicated by Sus-4 immunostaining (green). G–I) mRap1gap2 was not detected in the adult OE (arrows in G–I point to OMP-positive OSNs). Scale bar=20 μm.

time and space. mRap1gap2 function therefore likely has variable and conditional influences on axon outgrowth and sorting, depending on the spatiotemporal context the OSN finds itself in. mRap1gap2 is

nevertheless according to our results a significant regulator of OSN axon growth. It is perhaps additionally the most significant regulator of Rap1 signaling in this system, because knocking down mRap1gap2

Fig. 5. mRap1gap2 is developmentally regulated in OSN axons. mRap1gap2 immunostaining of coronally sectioned OB tissue reveals protein signal in early postnatal OSN axon termini. Glomeruli are delineated with olfactory marker protein (OMP), which co-localizes with all mRap1gap2 signal (mRap1gap2 signal was not detected in other cellular layers of the OB). A–C) All glomeruli (arrowheads) show strong mRap1gap2 signal within the first week after birth (P7). D–F) mRap1gap2 protein signal gradually decreases during early postnatal development (P28), temporarily existing as a random mosaic pattern amongst all OB glomeruli. Arrowhead points to a glomerulus with high mRap1gap2, while the arrow indicates a neighboring glomerulus with low mRap1gap2. G–I) By adulthood (P42), mRap1gap2 immunosignal in the main OB glomeruli is completely depleted. Scale bar=50μm.

278


Fig. 6. mRap1gap2 knock-down efficiency and effects on OSN axon outgrowth in vitro. A) mRap1gap2 immunoblot of COS-7 cell extracts overexpressing the indicated construct. Overexpression of mRap1gap2 provides a strong immunoblotting signal that is not detectable in co-transfection of the GFP vector control cells. Co-transfection of mRap1gap2-myc and mRap1gap2 RNAi plasmid, containing a shRNA design for specific knock-down of mRap1gap2, results over a 90% decrease of mRap1gap2 protein signal detected by immunoblotting. A RNAi control construct, designed with four point mutations in the original shRNA target transcript sequence of mRap1gap2, showed no such decrease. B) Immunoblotting results were quantified by calculating band intensities and averaged for each condition over three trials. Relative band intensities were normalized to the Rap1gap2+GFP co-transfection condition. C) OSNs infected with lentivirus bearing either a Rap1gap2-RNAi construct or the pLB-GFP vector backbone alone. GFP-positive cells indicate successfully infected cells. mRap1gap2 co-immunostaining shows decreased signal in OSNs carrying the Rap1gap2-RNAi construct compared to the GFP vector control. Scale bar=10 μm. D) Dissociated OSNs plated on astrocytes after transduction with lentiviral particles added at plating for in vitro gene manipulation with the indicated construct. Scale bar=50 μm. E) Axon lengths were measured and each normalized relative to the average of GFP-only control axon lengths within their experimental trial. Statistical significance was determined using one-way ANOVA and Tukey post-hoc tests of both treatment vs. GFP vector control and treatment vs. control-RNAi. OSNs infected with mRap1gap2-myc virus showed a significant decrease in OSN axon length (* pb0.05). Knock-down of mRap1gap2 by RNAi on the other hand generated a significant increase in OSN axon lengths (** pb0.01). OSNs expressing the control-RNAi design, with four-point mutations of the original mRap1gap2 target sequence, showed similar axon outgrowth as GFP-only control OSNs.

alone showed a substantial increase in OSN axon length. Additionally, we were unable to detect expression of the nearest mouse gene family member mRap1gap1 in OSNs during any stage of development (data not shown). The developmental regulation of Rap1gap2 expression in OSNs is particularly intriguing, when considering that OSN innervations undergo refinement during early postnatal stages (Kerr and Belluscio, 2006; Marks et al., 2006; Zou et al., 2004). mRap1gap2 protein levels drop toward the end of this very same period (P28), and devolve into a scattered mosaic patterns amongst various OB glomeruli before

finally disappearing by early adulthood. OB glomeruli are functional units for odor representation and processing. Here, OSN axons form synaptic contacts with the dendritic tufts of secondary mitral and tufted cells, which relay odorant information to higher cortical regions (Davison and Katz, 2007; Igarashi et al., 2012; Malun and Brunjes, 1996; Nagayama et al., 2010; Wilson and Sullivan, 2011). Mosaic expression patterns have already been demonstrated amongst OB glomeruli, particularly with genes known to influence neuronal growth, such as cell adhesion molecules (Kaneko-Goto et al., 2008; Lee et al., 2008) and axon guidance molecules (Chen et al., 2005; Serizawa et


al., 2006; Takahashi et al., 2010). The transient mosaic pattern of mRap1gap2 in OSN axons is not regionally consistent, but generally lingers longest in dorsal–medial glomeruli, suggesting a more significant regulatory role against Rap1 activity along the dorso-ventral guidance gradient of the OB (Cho et al., 2007). Considering this in combination with our observed effects on OSN axon outgrowth, mRap1gap2 may influence sorting of OSN axon projections during the early postnatal stage of glomerular refinement. Just as the overexpression of mRap1gap2 resulted in shorter OSN axons, so may the mistargeted OSNs retaining high mRap1gap2 levels be ill-supported to maintain axonal connections at inappropriate synaptic partnerships. The peak of mRap1gap2 expression can also simply reflect the greater quantity of OSNs undergoing growth and connectivity during early postnatal development versus later regenerative stages in adulthood (Gong and Shipley, 1996). In this case, the high level of mRap1gap2 expression needs not be developmentally regulated according to the animal's age; rather, it may be synchronized to each OSN's individual stage of maturation and outgrowth. Interestingly, mRap1gap2 is located on chromosome 11, immediately neighboring one of the 27 odorant receptor (OR) gene clusters in the mouse genome. The monoallelic, and generally monogenic, OR expression in OSNs serve as an irreplaceable conductor of axon projection and terminal target innervation (Chess et al., 1994; Imai and Sakano, 2009; Mombaerts, 2006; Zhang and Firestein, 2002). It may be worth pursuing a temporally regulated element shared by mRap1gap2 and the OR genes with which it is genomically clustered, in order to determine if such a genetic or epigenetic (Magklara et al., 2011) program synchronizes with specific stages of individual OSN development. A likely connection between known OSN guidance pathways and mRap1gap2 is through Rap1 signaling interactions with Eph–Ephrin. Interestingly, ephrinB-induced retraction of DLD-1 cellular extension was found to require deactivation of Rap1 (Riedl et al., 2005), and congruently in a migrating aortic endothelial cell model, ephrin-B1 induced ruffling was not affected by overexpression of the Rap1 regulator Rap1GAP1b (Nagashima et al., 2002). Both studies imply that ephrin-directed cytoskeletal constriction occurs most robustly when Rap1 is inactive. mRap1gap2 may be employed to coordinate a similar effect by regulating Rap1 activity in an analogous OSN pathway. Eph– Ephrin signaling significantly impacts OSN axon guidance and sorting (Cutforth et al., 2003; Mombaerts, 2006; Serizawa et al., 2006). In fact, EphB2 and ephrinB-1 have been shown to localize to the olfactory nerve projection pathway in a manner that is spatio-temporally regulated (St John and Key, 2001), similar to what we have found for mRap1gap2 here. Additionally, Rap1 (but not Ras) is activated by ephrin-family ligand binding and results in MAPK cascade activation toward neuronal morphogenesis (Aoki et al., 2004; Richter et al., 2007). What may prove the most influential feature of Rap1 signaling is how it can be activated by cAMP both through canonical PKA signaling, and independently of PKA via the RapGEF subfamily of Rap activators known as Epacs (Enserink et al., 2002). cAMP signaling is now considered to be an integral regulator of OSN axon guidance behavior (Imai et al., 2006; Zou et al., 2007), and is one of the few signaling mechanisms established in OSN development thus far. The bifurcating paths of cAMP-induced Rap1 activation therefore have a unique potential to modulate OR-GPCR signaling toward a binary modulatory control mechanism. It is currently hypothesized that local OSN axon sorting is achieved through OR-GPCR activity-driven cAMP signaling that results in differential expression profiles of genes influential to neuronal signaling, survival and morphogenesis (Imai et al., 2006; Marks et al., 2006; Miller et al., 2010; Mobley et al., 2010; Oztokatli et al., 2012). Rap signaling has been well-characterized as an activator of CREB and Elk-1 induced gene expression via the MAPK cascade (Stork, 2003; Vossler et al., 1997). Rap signaling may therefore be a vital missing link in the current picture of OSN development. Our results here provide early information on signaling pathways in OSN development. The characterization of mRap1gap2 function here provides a small foothold of insight for further advances across

279

the currently disparate fields of OSN development and small GTPase signaling. Experimental methods Molecular cloning and site-directed mutagenesis Full length Rap1gap2 cDNA sequence was attained through mRNA extraction (Qiagen) from postnatal day 6 (P6) mouse neocortex and RT-PCR using Superscript II reverse transcriptase (Invitrogen). The mouse Rap1gap2 open reading frame was amplified utilizing the only currently validated gene sequence annotation NM_001015046.2 for Rap1gap2 in the mouse genome, with a forward primer 5′-GGGGT ACCCCGACCATGCTGGCGGGTCTGAA containing a 5′ Kpn1 site and the ATG Met start codon, and a reverse primer 5′-GCTCTAGAGCGTGAC CCGCACTGGAGCTA containing a 3′ XbaI site and 3′UTR sequence and TAG open reading frame stop codon. This product was subcloned into the pEGFP-C1 vector (Clonetech), generating a GFP fusion construct. For production of Rap1gap2-myc, Rap1gap2 was cloned with forward primer 5′-CGGGATCCCGAAGGATTGACAAGACCATGCTG with a BamHI site, and reverse primer 5′-TCGTTAACTACACATTAGTGACCCGCACTGG with an HpaI site for subcloning insertion into the pCMV-3T(4B) vector (Stratagene) that allowed translation read-through of the full-length Rap1gap2 product including the vector's 3-myc tag at the C-terminus. Full length Rap1 was amplified from mouse neocortex cDNA using forward primer 5′-ATGCGTGAGTACAAGCTAGTG and reverse primer 5′-CTCTAGGAACAGACCTCGCAC and then cloned into pCR-TOPO II (Invitrogen) for excision with EcoRI/SpeI restriction digest and subcloning into the pEGFP-C1 vector. Constitutively active Rap1 was produced by site directed mutagenesis that altered glycine-12 for valine as described elsewhere (Chen et al., 2005). In brief, using forward primer 5′-CTAGTAGTCCTTGGTTCAGTAGGCGTGGGGAAGTCTGC and reverse primer 5′-GCAGACTTCCCCACGCCTACTGAACCAAGGACTACTAG were used to overlap the mutation site. Dominant negative Rap1 was produced in the same fashion using forward primer 5′-GTTCAGGAGG CGTGGGGAAGAATGCTCTGACAGTTCAG and reverse primer 5′-CTGAAC TGTCAGAGCATTCTTCCCCACGCCTCCTGAAC. Gene sequence alignment and phylogenetic tree analysis Mouse Rap1gap2 amino acid sequence comparisons with Rap1GAPs from mouse, human, Drosophila and zebrafish, including other small GTPase GAPs from mice, were aligned using the MAFFT online algorithm to generate a PHYLIP-formatted alignment of all amino acid sequences (Katoh and Toh, 2010). This was then analyzed in the CIPRES portal using a RAxML-VI-HPC algorithm with a bootstrapping bipartition feature (Stamatakis et al., 2008). All output data were formatted into a phylogenetic tree diagram using the FigTree online tool (Institute of Evolutionary Biology, University of Edinburgh). Mouse Rap1gap2 full length amino acid FASTA sequence alignment of human RAP1GAP2 isoforms 1 [NP_055900.4] against mouse Rap1gap2 (formerly Garnl4) [NP_001015046.1] was done using the PRALINE portal protein sequence alignment tool supported by IBIVU Amsterdam as previously established (Heringa, 1999; Pirovano et al., 2008; Simossis and Heringa, 2005). Rap1 activation assay COS-7 cells were transfected with either pEGFP-Rap1gap2 or backbone vector only as control using Lipofectamine2000 (Invitrogen). Rap1 activation levels in COS-7 cells were assayed using a non-radioactive pull-down method (Franke et al., 1997) with a Rap1 activation kit (Thermo-PIERCE). Lysates for positive and negative controls were incubated either with GTPγS or GDP for 30min on ice and then rinsed three times in binding buffer before active Rap1 pull-down. Cell lysate concentrations were normalized for SDS-PAGE. Levels of active Rap1 were

280


determined by immunoblotting with Rabbit-anti-Rap1 (Santa Cruz Biotech) quantified in comparison to total Rap1 from cell extracts.

transfection, cells were lysed for immunoblotting of Rap1gap2 using our custom antibody. Immunoblotting signal was quantified with molecular imaging software (Kodak).

Neuro-2a neurite outgrowth assay Lentivirus production Neuro-2a cells were plated on poly-L-lysine coated glass coverslips at a density of 1×10 5 cells/cm 2 and allowed to recover overnight. Cells were transfected with Rap1 or Rap1gap2 constructs using FuGeneHD (Roche) and incubated for 36 h. Cells were then induced to extend neurites with 0.2% FBS serum-starvation and fixed 8 h later for immunocytochemistry. Neuro-2a cells with neurites extended twice their cell diameter were considered differentiated and were measured. Total neurite length and branching numbers were measured using ImageJ software and plotted with GraphPad Pro. Data were compared with a paired Student's t-test (pb0.001).

293T cells were grown to 90% confluence in three 10 cm dishes. Each dish was transfected with 15 μg pLB-GFP control vector or the same vector backbone expressing Rap1gap2-myc, Rap1gap2 shRNA or control shRNA. Viral packaging plasmids, 10μg Gag-Pol expressing pΔ8.2 and 7.5 μg the envelope protein expressing pVSV-G, were co-transfected. Four hours after transfection, plates were rinsed twice with PBS. Media were refreshed with DMEM+10%FBS and incubated at 37°C in 5% CO2 for 72h. Media were collected then centrifuged at 100,000×g at 4 °C for 1.5h. Viral particle pellets were suspended in 100 μL PBS.

Rap1gap2 antibody production Olfactory sensory neuron culture and axon outgrowth assay The C-term sequence RSNLKFRFDKLSHASSSAGH of Rap1gap2 was selected as the antigen for peptide antibody production in chicken (Aves Labs). Custom antibody was purified by IgY fractionation and confirmed by immunoblotting and immunocytochemistry of COS-7 cells overexpressing the mouse Rap1gap2-GFP construct. Immunoblotting Mouse tissue was dissected and homogenized on ice using a Teflon pestle, lysed with lysis buffer (50 mM Tris-Cl, 100 μM EDTA, 1 mM MgCl2, 1% Triton X-100, and Complete Mini protease inhibitor cocktail [Roche]). Tissue lysates were clarified by centrifugation for 10min with 12,000×g at 4 °C and protein concentrations were normalized using BSA protein assay. Lysates were boiled in Laemmli buffer at 95°C for 5 min before loading into a 12% polyacrylimide gel for electrophoretic separation. Immunoblot membrane was blocked with 5% nonfat dry milk reconstituted in Tris buffered saline (TBS). Membranes were then incubated for 1 h at room temperature with 25ng of our custom Rap1gap2 antibody in 10mL TBS-T, followed by 3× washing with TBS-T. One ng HRP-conjugated anti-chicken IgY secondary antibody in 10mL TBS with Tween-20 was incubated for 1 h at room temperature before washing and addition of ECL substrate (Amersham) for signal exposure onto biofilm (ISC Express). Immunohistochemistry Neonatal mice underwent hypothermic sedation before sacrifice, where older mice were sedated by intraperitonial injection with 2.5% Avertin solution. Mice were perfused intracardially with phosphate buffered saline (PBS), followed by 4% paraformaldehyde for fixation. Olfactory tissue was cryoprotected with 30% sucrose in PBS overnight, embedded in O.C.T. (Tissue Tek), and cryo-sectioned at 20μm thickness and collected on FrostPlus glass sides. Tissue sections were blocked with 5% horse serum in PBS with 0.3% TritonX-100 (PBS-Tx) then submerged and incubated in custom chicken-anti-Rap1gap2 antibody along with goat-anti-OMP diluted in PBS-Tx overnight at 4°C. Cy3-conjugated donkey-anti-chicken and Cy2-conjugated donkey-antigoat secondary antibodies (Jackson ImmunoResearch) were incubated with coverslips for 1h at room temperature in the dark. Slides were mounted using Fluoromount-G (SouthernBiotech) with DAPI. Rap1gap2RNAi design and cloning: shRNA designs specific to Rap1gap2 cDNA sequence (OriGene) were chosen for subcloning into the pLB-GFP viral transmission vector (Addgene) by NotI/HpaI digest and ligation with T4 DNA ligase (New England Biolabs). Four designs were tested for Rap1gap2 knock-down efficiency by co-transfection with a Rap1gap2-myc construct in COS-7 cells. Forty-eight hours after

OSN culture was performed as described previously (Chen et al., 2008). Briefly, OE tissue was dissected from the newborn mouse nasal cavity and treated with 2 mg/mL dispase for 40 min at room temperature. The olfactory neuroepithelium was separated from the underlining stroma and dissociated with 0.05% trypsin and 0.5 mM EDTA for 10min at 37°C. To ensure complete dissociation, gentle trituration through a flame-polished Pasteur pipette was applied. OSNs were plated directly onto a bed of mouse cortical astrocytes in Waymouth's media plus N2 supplement and Gentamycin. Cultures were treated with virus for transduction immediately following plating. Half of the culture media was refreshed after 48 h. After 96 h total OSNs were washed twice with PBS then fixed with 4% paraformaldehyde. Cells were stained with either goat-anti-GFP (Sigma) or mouse-anti-Myc (CalBiochem) antibody. Fluorescent micrographs of OSN axons were measured with ImageJ and statistically compared with a one-way ANOVA followed by Student's t-test.

Acknowledgments We would like to thank Dr. Huaiyung Chen for assisting with the OSN culture and its immunostaining, Dr. Albert Smolenski for providing the human RAP1GAP2 control plasmid, Dr. Johannes Bos for providing the RalGDS plasmid for active Rap1 pulldown, Dr. James Schwob for providing Sus-4 antibody, and Dr. Richard Tucker for his critical reading of the manuscript and valuable input toward its completion. This study was supported by NIH DC052256 and DC006015, and NSF 0324769 to Q.G. and T32-NIH DC008072 to B.A.S.

References Anneren, C., Reedquist, K.A., Bos, J.L., Welsh, M., 2000. GTK, a Src-related tyrosine kinase, induces nerve growth factor-independent neurite outgrowth in PC12 cells through activation of the Rap1 pathway. Relationship to Shb tyrosine phosphorylation and elevated levels of focal adhesion kinase. J. Biol. Chem. 275, 29153–29161. Aoki, M., Yamashita, T., Tohyama, M., 2004. EphA receptors direct the differentiation of mammalian neural precursor cells through a mitogen-activated protein kinasedependent pathway. J. Biol. Chem. 279, 32643–32650. Arevalo, J.C., Yano, H., Teng, K.K., Chao, M.V., 2004. A unique pathway for sustained neurotrophin signaling through an ankyrin-rich membrane-spanning protein. EMBO J. 23, 2358–2368. Bertoni, A., Tadokoro, S., Eto, K., Pampori, N., Parise, L.V., White, G.C., Shattil, S.J., 2002. Relationships between Rap1b, affinity modulation of integrin alpha IIbbeta 3, and the actin cytoskeleton. J. Biol. Chem. 277, 25715–25721. Bilasy, S., Satoh, T., Terashima, T., Kataoka, T., 2011a. RA-GEF-1 (Rapgef2) is essential for proper development of the midline commissures. Neurosci. Res. 71, 10. Bilasy, S.E., Satoh, T., Terashima, T., Kataoka, T., 2011b. RA-GEF-1 (Rapgef2) is essential for proper development of the midline commissures. Neurosci. Res. 71, 200–209.

B. Sadrian et al. / Molecular and Cellular Neuroscience 50 (2012) 272–282 Birukova, A.A., Zagranichnaya, T., Fu, P., Alekseeva, E., Chen, W., Jacobson, J.R., Birukov, K.G., 2007. Prostaglandins PGE(2) and PGI(2) promote endothelial barrier enhancement via PKA- and Epac1/Rap1-dependent Rac activation. Exp. Cell Res. 313, 2504–2520. Bos, J.L., Rehmann, H., Wittinghofer, A., 2007. GEFs and GAPs: critical elements in the control of small G proteins. Cell 129, 865–877. Buck, L., Axel, R., 1991. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175–187. Chen, Y., Wang, P.Y., Ghosh, A., 2005. Regulation of cortical dendrite development by Rap1 signaling. Mol. Cell. Neurosci. 28, 215–228. Chen, H., Dadsetan, S., Fomina, A.F., Gong, Q., 2008. Expressing exogenous functional odorant receptors in cultured olfactory sensory neurons. Neural development 3, 22. Chess, A., Simon, I., Cedar, H., Axel, R., 1994. Allelic inactivation regulates olfactory receptor gene expression. Cell 78, 823–834. Cho, J.H., Lepine, M., Andrews, W., Parnavelas, J., Cloutier, J.F., 2007. Requirement for Slit-1 and Robo-2 in zonal segregation of olfactory sensory neuron axons in the main olfactory bulb. J. Neurosci 27, 9094–9104. Cutforth, T., Moring, L., Mendelsohn, M., Nemes, A., Shah, N.M., Kim, M.M., Frisen, J., Axel, R., 2003. Axonal ephrin-As and odorant receptors: coordinate determination of the olfactory sensory map. Cell 114, 311–322. Daumke, O., Weyand, M., Chakrabarti, P.P., Vetter, I.R., Wittinghofer, A., 2004. The GTPaseactivating protein Rap1GAP uses a catalytic asparagine. Nature 429, 197–201. Davison, I.G., Katz, L.C., 2007. Sparse and selective odor coding by mitral/tufted neurons in the main olfactory bulb. J. Neurosci. 27, 2091–2101. Enserink, J.M., Christensen, A.E., de Rooij, J., van Triest, M., Schwede, F., Genieser, H.G., Doskeland, S.O., Blank, J.L., Bos, J.L., 2002. A novel Epac-specific cAMP analogue demonstrates independent regulation of Rap1 and ERK. Nat. Cell Biol. 4, 901–906. Franke, B., Akkerman, J.W., Bos, J.L., 1997. Rapid Ca2+-mediated activation of Rap1 in human platelets. EMBO J. 16, 252–259. Gong, Q., Shipley, M.T., 1996. Expression of extracellular matrix molecules and cell surface molecules in the olfactory nerve pathway during early development. J. Comp. Neurol. 366, 1–14. Goshima, Y., Ohsako, S., Yamauchi, T., 1993. Overexpression of Ca2+/calmodulin-dependent protein kinase II in Neuro2a and NG108-15 neuroblastoma cell lines promotes neurite outgrowth and growth cone motility. J. Neurosci. 13, 559–567. He, J.C., Neves, S.R., Jordan, J.D., Iyengar, R., 2006. Role of the Go/i signaling network in the regulation of neurite outgrowth. Can. J. Physiol. Pharmacol. 84, 687–694. Heringa, J., 1999. Two strategies for sequence comparison: profile-preprocessed and secondary structure-induced multiple alignment. Comput. Chem. 23, 341–364. Hisata, S., Sakisaka, T., Baba, T., Yamada, T., Aoki, K., Matsuda, M., Takai, Y., 2007. Rap1-PDZ-GEF1 interacts with a neurotrophin receptor at late endosomes, leading to sustained activation of Rap1 and ERK and neurite outgrowth. J. Cell Biol. 178, 843–860. Igarashi, K.M., Ieki, N., An, M., Yamaguchi, Y., Nagayama, S., Kobayakawa, K., Kobayakawa, R., Tanifuji, M., Sakano, H., Chen, W.R., Mori, K., 2012. Parallel mitral and tufted cell pathways route distinct odor information to different targets in the olfactory cortex. J. Neurosci. 32, 16. Imai, T., Sakano, H., 2009. Odorant receptor gene choice and axonal projection in the mouse olfactory system. Results Probl. Cell Differ. 47, 57–75. Imai, T., Suzuki, M., Sakano, H., 2006. Odorant receptor-derived cAMP signals direct axonal targeting. Science 314, 657–661. Jordan, J.D., He, J.C., Eungdamrong, N.J., Gomes, I., Ali, W., Nguyen, T., Bivona, T.G., Philips, M.R., Devi, L.A., Iyengar, R., 2005. Cannabinoid receptor-induced neurite outgrowth is mediated by Rap1 activation through G(alpha)o/i-triggered proteasomal degradation of Rap1GAPII. J. Biol. Chem. 280, 11413–11421. Jossin, Y., Cooper, J.A., 2011. Reelin, Rap1 and N-cadherin orient the migration of multipolar neurons in the developing neocortex. Nat. Neurosci. 14, 697–703. Kafitz, K.W., Greer, C.A., 1998. Differential expression of extracellular matrix and cell adhesion molecules in the olfactory nerve and glomerular layers of adult rats. J. Neurobiol. 34, 271–282. Kaneko-Goto, T., Yoshihara, S., Miyazaki, H., Yoshihara, Y., 2008. BIG-2 mediates olfactory axon convergence to target glomeruli. Neuron 57, 834–846. Katoh, K., Toh, H., 2010. Parallelization of the MAFFT multiple sequence alignment program. Bioinformatics 26, 1899–1900. Kerr, M.A., Belluscio, L., 2006. Olfactory experience accelerates glomerular refinement in the mammalian olfactory bulb. Nat. Neurosci. 9, 484–486. Kiermayer, S., Biondi, R.M., Imig, J., Plotz, G., Haupenthal, J., Zeuzem, S., Piiper, A., 2005. Epac activation converts cAMP from a proliferative into a differentiation signal in PC12 cells. Mol. Biol. Cell 16, 5639–5648. Kooistra, M.R., Dube, N., Bos, J.L., 2007. Rap1: a key regulator in cell-cell junction formation. J. Cell Sci. 120, 17–22. Lee, W., Cheng, T.W., Gong, Q., 2008. Olfactory sensory neuron-specific and sexually dimorphic expression of protocadherin 20. J. Comp. Neurol. 507, 1076–1086. Lipscomb, B.W., Treloar, H.B., Greer, C.A., 2002. Cell surface carbohydrates reveal heterogeneity in olfactory receptor cell axons in the mouse. Cell Tissue Res. 308, 7–17. Lu, L., Anneren, C., Reedquist, K.A., Bos, J.L., Welsh, M., 2000. NGF-Dependent neurite outgrowth in PC12 cells overexpressing the Src homology 2-domain protein shb requires activation of the Rap1 pathway. Exp. Cell Res. 259, 370–377. Ma'ayan, A., Jenkins, S.L., Barash, A., Iyengar, R., 2009. Neuro2A differentiation by Galphai/o pathway. Sci. Signal. 2 (cm1). Magklara, A., Yen, A., Colquitt, B.M., Clowney, E.J., Allen, W., MarkenscoffPapadimitriou, E., Evans, Z.A., Kheradpour, P., Mountoufaris, G., Carey, C., Barnea,

281

G., Kellis, M., Lomvardas, S., 2011. An epigenetic signature for monoallelic olfactory receptor expression. Cell 145, 555–570. Malnic, B., Hirono, J., Sato, T., Buck, L.B., 1999. Combinatorial receptor codes for odors. Cell 96, 713–723. Malun, D., Brunjes, P.C., 1996. Development of olfactory glomeruli: temporal and spatial interactions between olfactory receptor axons and mitral cells in opossums and rats. J. Comp. Neurol. 368, 1–16. Marks, C.A., Cheng, K., Cummings, D.M., Belluscio, L., 2006. Activity-dependent plasticity in the olfactory intrabulbar map. J. Neurosci. 26, 11257–11266. McAvoy, T., Zhou, M.M., Greengard, P., Nairn, A.C., 2009. Phosphorylation of Rap1GAP, a striatally enriched protein, by protein kinase A controls Rap1 activity and dendritic spine morphology. Proc. Natl. Acad. Sci. U. S. A. 106, 3531–3536. Miller, A.M., Maurer, L.R., Zou, D.J., Firestein, S., Greer, C.A., 2010. Axon fasciculation in the developing olfactory nerve. Neural Dev. 5, 20. Mobley, A.S., Miller, A.M., Araneda, R.C., Maurer, L.R., Muller, F., Greer, C.A., 2010. Hyperpolarization-activated cyclic nucleotide-gated channels in olfactory sensory neurons regulate axon extension and glomerular formation. J. Neurosci. 30, 16498–16508. Mombaerts, P., 2006. Axonal wiring in the mouse olfactory system. Annu. Rev. Cell Dev. Biol. 22, 713–737. Mombaerts, P., Wang, F., Dulac, C., Chao, S.K., Nemes, A., Mendelsohn, M., Edmondson, J., Axel, R., 1996. Visualizing an olfactory sensory map. Cell 87, 675–686. Nagashima, K., Endo, A., Ogita, H., Kawana, A., Yamagishi, A., Kitabatake, A., Matsuda, M., Mochizuki, N., 2002. Adaptor protein Crk is required for ephrin-B1-induced membrane ruffling and focal complex assembly of human aortic endothelial cells. Mol. Biol. Cell 13, 4231–4242. Nagayama, S., Enerva, A., Fletcher, M.L., Masurkar, A.V., Igarashi, K.M., Mori, K., Chen, W.R., 2010. Differential axonal projection of mitral and tufted cells in the mouse main olfactory system. Front Neural Circ. 4. Neumuller, O., Hoffmeister, M., Babica, J., Prelle, C., Gegenbauer, K., Smolenski, A.P., 2009. Synaptotagmin-like protein 1 interacts with the GTPase-activating protein Rap1GAP2 and regulates dense granule secretion in platelets. Blood 114, 1396–1404. Oztokatli, H., Hornberg, M., Berghard, A., Bohm, S., 2012. Retinoic acid receptor and CNGA2 channel signaling are part of a regulatory feedback loop controlling axonal convergence and survival of olfactory sensory neurons. FASEB J. 26 (2), 617–627. Pak, D.T., Yang, S., Rudolph-Correia, S., Kim, E., Sheng, M., 2001. Regulation of dendritic spine morphology by SPAR, a PSD-95-associated RapGAP. Neuron 31, 289–303. Pirovano, W., Feenstra, K.A., Heringa, J., 2008. PRALINETM: a strategy for improved multiple alignment of transmembrane proteins. Bioinformatics 24, 492–497. Ressler, K.J., Sullivan, S.L., Buck, L.B., 1994. Information coding in the olfactory system: evidence for a stereotyped and highly organized epitope map in the olfactory bulb. Cell 79, 1245–1255. Richter, M., Murai, K.K., Bourgin, C., Pak, D.T., Pasquale, E.B., 2007. The EphA4 receptor regulates neuronal morphology through SPAR-mediated inactivation of Rap GTPases. J. Neurosci. 27, 14205–14215. Riedl, J.A., Brandt, D.T., Batlle, E., Price, L.S., Clevers, H., Bos, J.L., 2005. Down-regulation of Rap1 activity is involved in ephrinB1-induced cell contraction. Biochem. J. 389, 465–469. Schultess, J., Danielewski, O., Smolenski, A.P., 2005. Rap1GAP2 is a new GTPaseactivating protein of Rap1 expressed in human platelets. Blood 105, 3185–3192. Scrima, A., Thomas, C., Deaconescu, D., Wittinghofer, A., 2008. The Rap–RapGAP complex: GTP hydrolysis without catalytic glutamine and arginine residues. EMBO J. 27, 1145–1153. Serizawa, S., Miyamichi, K., Takeuchi, H., Yamagishi, Y., Suzuki, M., Sakano, H., 2006. A neuronal identity code for the odorant receptor-specific and activity-dependent axon sorting. Cell 127, 1057–1069. Simossis, V.A., Heringa, J., 2005. PRALINE: a multiple sequence alignment toolbox that integrates homology-extended and secondary structure information. Nucleic Acids Res. 33, W289–W294. Sot, B., Kotting, C., Deaconescu, D., Suveyzdis, Y., Gerwert, K., Wittinghofer, A., 2010. Unravelling the mechanism of dual-specificity GAPs. EMBO J. 29, 1205–1214. Spilker, C., Kreutz, M.R., 2010. RapGAPs in brain: multipurpose players in neuronal Rap signalling. Eur. J. Neurosci. 32, 1–9. St John, J.A., Key, B., 2001. EphB2 and two of its ligands have dynamic protein expression patterns in the developing olfactory system. Brain Res. Dev. Brain Res. 126, 43–56. Stamatakis, A., Hoover, P., Rougemont, J., 2008. A rapid bootstrap algorithm for the RAxML Web servers. Syst. Biol. 57, 758–771. Stork, P.J., 2003. Does Rap1 deserve a bad Rap? Trends Biochem. Sci. 28, 267–275. Stork, P.J., 2005. Directing NGF's actions: it's a Rap. Nat. Cell Biol. 7, 338–339. Takahashi, H., Yoshihara, S., Nishizumi, H., Tsuboi, A., 2010. Neuropilin-2 is required for the proper targeting of ventral glomeruli in the mouse olfactory bulb. Mol. Cell. Neurosci. 44, 233–245. Taniguchi, M., Nagao, H., Takahashi, Y.K., Yamaguchi, M., Mitsui, S., Yagi, T., Mori, K., Shimizu, T., 2003. Distorted odor maps in the olfactory bulb of semaphorin 3Adeficient mice. J. Neurosci. 23, 1390–1397. Treloar, H.B., Purcell, A.L., Greer, C.A., 1999. Glomerular formation in the developing rat olfactory bulb. J. Comp. Neurol. 413, 289–304. Vossler, M.R., Yao, H., York, R.D., Pan, M.G., Rim, C.S., Stork, P.J., 1997. cAMP activates MAP kinase and Elk-1 through a B-Raf- and Rap1-dependent pathway. Cell 89, 73–82. Wang, F., Nemes, A., Mendelsohn, M., Axel, R., 1998. Odorant receptors govern the formation of a precise topographic map. Cell 93, 47–60. Wilson, D.A., Sullivan, R.M., 2011. Cortical processing of odor objects. Neuron 72, 506–519.

282


Xie, Z., Huganir, R.L., Penzes, P., 2005. Activity-dependent dendritic spine structural plasticity is regulated by small GTPase Rap1 and its target AF-6. Neuron 48, 605–618. Yamada, T., Sakisaka, T., Hisata, S., Baba, T., Takai, Y., 2005. RA–RhoGAP, Rap-activated Rho GTPase-activating protein implicated in neurite outgrowth through Rho. J. Biol. Chem. 280, 33026–33034. York, R.D., Yao, H., Dillon, T., Ellig, C.L., Eckert, S.P., McCleskey, E.W., Stork, P.J., 1998. Rap1 mediates sustained MAP kinase activation induced by nerve growth factor. Nature 392, 622–626.

Zhang, X., Firestein, S., 2002. The olfactory receptor gene superfamily of the mouse. Nat. Neurosci. 5, 124–133. Zou, D.J., Feinstein, P., Rivers, A.L., Mathews, G.A., Kim, A., Greer, C.A., Mombaerts, P., Firestein, S., 2004. Postnatal refinement of peripheral olfactory projections. Science 304, 1976–1979. Zou, D.J., Chesler, A.T., Le Pichon, C.E., Kuznetsov, A., Pei, X., Hwang, E.L., Firestein, S., 2007. Absence of adenylyl cyclase 3 perturbs peripheral olfactory projections in mice. J. Neurosci. 27, 6675–6683.