a toothpick from an agar plate, suspended in 200. /xl of distilled water, and boiled for 5 .... In another experiment, the specificity of the. Salmonella-specific probes ...
167
FEMS Microbiology Letters 114 (1993) 167-172 © 1993 Federation of European Microbiological Societies 0378-1097/93/$06.00 Published by Elsevier
FEMSLE 05706
Rapid and sensitive method for detection of Salmonella strains using a combination of polymerase chain reaction and reverse dot-blot hybridization Kazuo Iida a,b, Akio Abe a, Hidenori Matsui a, Hirofumi D a n b a r a and Kazuyoshi K a w a h a r a .,a
a,l
Sachio W a k a y a m a b
~ Department of Bacteriology, The Kitasato Institute, 5-9-1, Shirokane, Minato-ku, Tokyo 108, Japan, and b Department of Research and DeL,elopment, Kibun Foods Inc., 7-14-13, Ginzu, Chuo-ku, Tokyo 104, Japan (Received 8 June 1993; revision received 13 September 1993; accepted 14 September 1993)
Abstract." We have developed a reverse dot-blot hybridization assay for detection of Salmonella using Salmonella-specific oligonucleotide probes designed from the base sequence of the 16S rRNA gene (rDNA). The target fragment of 16S rDNA was amplified, and labelled with biotin by the polymerase chain reaction. The amplified fragment was hybridized with the membraneimmobilized probe and the hybridization was detected by chemiluminescence. Amplified fragments from 24 different serovars of Salmonella hybridized with the probes, whereas those of species of Enterobacteriaceae, Pseudomonas aeruginosa, Bacillus subtilis, and Staphylococcus aureus failed to hybridize. By this assay, it was possible to detect in the order of 104 bacteria in fish meat homogenate in 10 h.
Key words: Salmonella; Polymerase chain reaction; DNA hybridization
Introduction
Salmonella is a causative agent of septicemic infection in humans and animals, and also very often causes food poisoning through contamination of meat, milk, eggs, or frozen seafood [1]. For detection of Salmonella in food samples, sensitive and rapid methods are needed because
* Corresponding author. Tel.: (03) 34446161 (ext. 2128); Fax: (03) 34446637. Present address: School of Pharmaceutical Sciences, Kitasato University, Minato-ku, Tokyo 108, Japan.
conventional microbiological methods do not have sufficient sensitivity, and require a long time for bacterial cultivation [2]. Recently, detection methods using DNA hybridization have been developed, employing Salmonella-specific DNA probes such as random chromosomal fragments [3-5], structural genes for virulence antigen [6], common virulence region on plasmids [7], and a segment of the invasion-associated region [8]. However, further improvement is required for the practical application of these methods. Although no Salmonella-specific sequence in ribosomal RNA (rRNA) has yet been published, species-specific base sequences in rRNA genes
168 (rDNA) could be the best target for DNA amplification by polymerase chain reaction (PCR) and DNA hybridization. In the present study, we searched for a Salmonella-specific sequence in the 16S ribosomal RNA gene (rDNA), synthesized sequence-specific oligonucleotide probes, and developed a sensitive and non-radioisotopic detection system.
Materials and Methods
Bacterial strains Serovars of Salmonella choleraesuis subsp. choleraesuis used in this study were S. choleraesuis subsp, choleraesuis serovar Paratyphi A (Salmonella Paratyphi A), Salmonella Typhimurium, Salmonella Sandiego, Salmonella Bredeney, Salmonella Choleraesuis, Salmonella Tallahassee, Salmonella Dublin, Salmonella Enteritidis, Salmonella Typhi, Salmonella Moscow, Salmonella Strasbourg, Salmonella Anatum, Salmonella London, Salmonella Rubislaw, Salmonella Poona, Salmonella Kirkee, Salmonella Wayne, Salmonella Champaign, Salmonella Mara, Salmonella Riogrande, Salmonella Waycross, Salmonella Weslaco, and Salmonella Quinhon. Salmonella choleraesuis subsp, arizonae (S. arizonae) was also used. All of the Salmonella strains were obtained from the collection of The Kitasato Institute. As reference strains, Pseudomonas aeruginosa PAO1 (from the late Prof. Y. Homma of the Kitasato Institute), Bacillus subtilis IAM 12118, Staphylococcus aureus WOOD46 (from the collection of the Kitasato Institute), Escherichia coli C600 [9], Enterobacter cloacae IFO 13535, Klebsiella pneumoniae IFO 14940, and K. oxytoca (laboratory isolate of Kibun Foods Inc.) were used. Preparation of PCR primers Five pairs of PCR primers corresponding to the conserved region of 16S rRNA were designed according to sequence data for 16S rRNA from E. coli [10,11], B. subtilis [12], and Halobacterium t~olcanii [13]. The oligonucleotides were synthesized by an automated DNA synthesizer (Model 391, Applied Biosystems, Foster City, CA), and
purified by 16% polyacrylamide gel electrophoresis. Base sequence determination of the 16S rDNA fragment Fragments of 16S rDNA were amplified by PCR using the method described below. After PCR, the products were purified by 3.5% polyacrylamide gel electrophoresis, and sequenced by an automatic DNA sequencer (Model 373A, Applied Biosystems) using a Taq dye-deoxy terminator cycle sequencing kit (Applied Biosystems). The sequence data were analyzed with DNA software, GENETYX-MAC version 5.0 (Software Development Co., Ltd., Tokyo, Japan). PCR amplification and recerse dot-blot hybridization Bacterial cells (102-103 cells) were taken with a toothpick from an agar plate, suspended in 200 /xl of distilled water, and boiled for 5 rain. The supernatant after centrifugation (30000 ×g, 5 min) was used for PCR amplification. The reaction mixture (50 /zl) contained 20 mM Tris • HC1 (pH 8.0), 1.5 mM MgC12, 25 mM KC1, 0.05% Tween 20, 50 /zM dATP, dGTP, dCTP, and 30 /xM dTTP, 12.5 /zM biotin-21-dUTP, 0.2 /xM 2F and 2R primers (Table 1), 0.04 units /zl i Vent DNA polymerase (New England Biolabs, Beverly, MA), and 5 /xl of the bacterial DNA. A DNA thermal cycler (Perkin-Elmer/Cetus, Emeryville, CA) was used for all amplification reactions. An aliquot of the products was analyzed by 1.5% agarose gel electrophoresis. Hybridization was carried out as described previously [14]. The amplified DNA was hybridized with the immobilized probes on the nylon membrane and detected by chemiluminescence using a Southern light kit (TROPIX, Inc., Bedford, MA) and Hyperfilm ECL (Amersham International plc, Buckinghamshire, UK). Preparation of bacterial DNA from a mixture of bacteria and fish meat Fish meat (10 g) was homogenized with 9(1 ml of distilled water using a food blender, and an aliquot (1 ml) was mixed with the bacterial suspension (100 tzl) in M9 minimal medium (80 mM
169
Na2HPO 4, 22 mM KH2PO4, 8.6 mM NaC1, 18.7 mM NH4C1, and 0.4% glucose). The mixed solution (200 txl) was boiled for 5 min, centrifuged at 30000 × g for 5 min, and the supernatant was used for PCR amplification.
Results
Preparation of Salmonella-specific DNA probes The entire 16S rDNA was divided into five fragments, and each fragment was amplified by PCR using the primers shown in Table 1. The nucleotide sequences of amplified 16S rDNA fragments from six different serovars of Salmonella (Choleraesuis, Dublin, Enteritidis, Paratyphi A, Typhi, and Typhimurium) were analyzed. As shown in Fig. 1, the 16S rDNA sequences of the six serovars were completely identical from positions 401 to 550. In contrast, E. coli had several sequence differences in this region. We synthesized two different oligonucleotide probes from the sequence of this region, and designated them pl6S1 and p16S2 (Fig. 1). A
Nucleotide sequence accession numbers The nucleotide sequences of 16S rDNA obtained in this study have been submitted to the DDBJ, EMBL and GenBank Data Libraries under the accession numbers D12809, D12810, D12811, D12812, D12813 and D12814, for Salmonella Choleraesuis, Salmonella Dublin, Salmonella Enteritidis, Salmonella Paratyphi A, Salmonella Typhi, and Salmonella Typhimurium, respectively.
E. c o l i C 6 0 0 S. C h o l e r a e s u i s S. D u b l i n S. E n t e r i t i d i s S. T y p h i m u r i u m S. T y p h i S. P a r a t y p h i - A Probe PI6SI Probe P16S2
401
E. c o l i C600 S. C h o l e r a e s u i s S. D u b l i n S. E n t e r i t i d i s S. T y p h i m u r i u m S. T y p h i S. P a r a t y p h i - A Probe P16SI Probe P16S2
451
E. c o l i C 6 0 0 S. C h o l e r a e s u i s S. D u b l i n S. E n t e r i t i d i s S. T y p h i m u r i u m S. T y p h i S. P a r a t y p h i - A Control probe
501
GCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGA
450
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
(3')CCT
AGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGC ---TGT-GTG ....... A-CGCAGCA ........................ ---TGT-GTG ....... A-CGCAGCA ........................ ---TGT-GTG ....... A-CGCAGCA ........................ ---TGT-GTG ....... A-CGCAGCA ........................ ---TGT-GTG ....... A-CGCAGCA ........................ ---TGT-GTG ....... A-CGCAGCA ........................ TCCACAACACCAATT(5')
500
(3')TTATTGGCGTCGTTAACT(5'}
ACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGT .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
550 .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
( 3 ' )G T C G T C G G C G C C A T T A T G (
5 ')
Fig. 1. Nucleotide sequences of the conserved region found in r D N A of Salmonella. Nucleotide sequences of the bacterial 16S r D N A were analyzed as described in Materials and Methods. T h e sequence difference between E. coli C600 and Salmonella, and the positions of the synthesized oligonucleotide probes are indicated in the figure.
170
1
2
3
1
2
S. Paratyphi-A ~lt O (~ S. Strasbourg ~ S. TyphimuriumO ~ ~ S. Sandiego
OO
S. Anatum
I
~O S. Poona
S. Tallahassee ~ O
s. Dub,in
•
• •
S. Enteritidis
s.
I I 000
S. Moscow
0 0 0
0
0 0 ~
S. Kirkee S. Wayne
0 0 0
S. Cha=paign S. Mara
S. Waycross
O S. Weslaco
S. Rubislaw O O O
S. Choleraesuis
'
2
3
S. Riogrande
O S. London
S. Bredeney
1
3
~
S. Quinhon
0 O0 OOI 000
S. arizonae
0
E. coil
0
P"
aeruginosa 0
S.
0
B. subtilis
Fig. 2. Detection of Salmonella strains by reverse dot-blot hybridization using immobilized oligonucleotide probes. PCR and hybridization were performed as described in Materials and Methods. The probes are shown at the top of each photograph (1, control; 2, pl6S1; 3, p16S2).
positive-control probe designed from the homologous region of Salmonella and E. coli was also synthesized (Fig. 1).
Specificity of the method The region between positions 341 and 702 in 16S rDNA was amplified by PCR using 2F and 2R primers (Table 1), and subjected to hybridization. When the amplified fragments were hybridized to the control probe, all bacteria showed
positive signals (Fig. 2, lane 1). In contrast, hybridization with p16S1 and p16S2 produced positive signals for all serovars of Salmonella, but not for E. coli, P. aeruginosa, B. subtilis, or S. aureus (Fig. 2, lanes 2 and 3). In another experiment, the specificity of the Salmonella-specific probes was examined using Salmonella Typhimurium and several species of Enterobacteriaceae, which often contaminate seafood. As shown in Fig. 3, positive signals were
1
Table ! Nucleotide sequences of the PCR primers Sequences
Position a
1F 1R 2F 2R 3F 3R 4F 4R 5F 5R
AGTTTGATCATGGCTCAG
10- 27 358- 341 341- 358 702 685 685- 702 908- 891 891- 908 1224-1209 1209-1224 1459-1477
"
CCTACGGGAGGCAGCAGT TACGCATTTCACCGCTAC GTAGCGGTGAAATGCGTA CGTCAATTCATTTGAGTT AACTCAAATGAATTGACG CATTGTAGCACGTGTG CACACGTGCTACAATG GGTTACCTTGTTACGACTT
In referring to the nucleotide positions, the numbering for
E. coli 16S r D N A [15] is used.
3
S. Typhimurium O O O
Primer
ACTGCTGCCTCCCGTAGG
2
E. coli C600
O
E. cloacae
0
K. oxytoca K. pneumoniae Fig. 3. Specific detection of Salmonella among species of Enterobacteria. Probes and conditions of P C R and hybridization as in Fig. 2.
171
1
2
3
106 105 104 ~ 0 0 103 102 101 100
1
2
3
106 105 104 103 102 101 100
S. Enteritidis E. coli C 6 0 0 Fig. 4. Sensitivity of detection of Salmonella in fish meat. Fish meat containing 10° to 106 bacterial cells was used as the starting material. PCR and hybridization were carried out as described in Fig. 2. d e t e c t e d only for Salmonella T y p h i m u r i u m , a n d no o t h e r b a c t e r i a s h o w e d positive signals.
Detection of Salmonella in food homogenate F i s h m e a t h o m o g e n a t e c o n t a i n i n g 10 6 to 10 ° cells p e r 2 0 0 / z l of b a c t e r i a was p r e p a r e d , a n d the t a r g e t D N A f r a g m e n t was a m p l i f i e d by P C R . A s shown in Fig. 4, positive signals w e r e d e t e c t a b l e by t h e Salmonella-specific p r o b e s w h e n 10 4 ceils o f Salmonella E n t e r i t i d i s w e r e p r e s e n t , w h e r e a s only very faint signals w e r e shown by t h e s a m e p r o b e s w h e n a similar n u m b e r o f E. coli cells w e r e m i x e d with fish m e a t .
Discussion R i b o s o m a l R N A g e n e s [15] a r e p o t e n t i a l l y useful as t a r g e t s for D N A p r o b e s , a l t h o u g h t h e c o m p l e t e b a s e s e q u e n c e o f the 16S r R N A o f Salmonella has n o t b e e n r e p o r t e d . T h e r e f o r e , 16S r D N A was first s e q u e n c e d , a n d p r o b e s w e r e designed to give strict specificity. T h e a d v a n t a g e s of o u r m e t h o d b e s i d e s its specificity a r e r a p i d preparation of target DNA fragments from a small n u m b e r o f b a c t e r i a by P C R , a n d a s i m p l e p r o c e d u r e o f h y b r i d i z a t i o n using r e a d y - m a d e nylon m e m b r a n e s with i m m o b i l i z e d o l i g o n u c l e o t i d e p r o b e s . U s i n g this m e t h o d , we w e r e able to ob-
tain results in 10 h w i t h o u t any s p e c i a l i z e d techniques. W h e n a p u r e c u l t u r e was used, the m i n i m u m d e t e c t a b l e cell c o n c e n t r a t i o n of Salmonella was 10 2 cells p e r 2 0 0 / x l , b u t t h e sensitivity was lower w h e n the b a c t e r i u m was m i x e d with m e a t hom o g e n a t e (Fig. 4). M o r e o v e r , t h e d e t e c t i o n of Salmonella was not easy w h e n a 10-fold n u m b e r of o t h e r b a c t e r i a l cells w e r e p r e s e n t with Salmonella ( d a t a n o t shown). T h e s e results indic a t e that t h e u n i v e r s a l p r i m e r s w e r e c o n s u m e d by D N A in the m e a t itself o r in t h e co-existing bacteria, and therefore Salmonella-specific p r i m e r s w o u l d b e r e q u i r e d for the p r a c t i c a l applic a t i o n of this m e t h o d to f o o d samples. T h e construction of such specific p r i m e r s is now u n d e r investigation in o u r l a b o r a t o r y .
Acknowledgement P a r t o f this w o r k was s u p p o r t e d by a g r a n t f r o m the J a p a n K e i r i n A s s o c i a t i o n .
References 1 Chalker, R.B. and Blaser, M.J. (1988) A review of human salmonellosis: III. Magnitude of Salmonella infection in the United States. Rev. Infect. Dis. 10, 111-124. 2 Andrews, W.H., Poelma, P.L. and Wilson, C.R. (1984) Isolation and identification of Salmonella species. In: Bacteriological Analytical Manual, 6th edn. (U.S. Food and Drug Administration, Ed.), pp. 7.01-7.18. Association of Analytical Chemists, Arlington, VA. 3 Fitts, R. (1985) Development of a DNA-DNA hybridization test for presence of Salmonella in foods. Food Technol. 39, 95-102. 4 Tsen, H.Y., Chen, M.H., Shieh, J.S., Wang, S.J. and Hu, N.T. (1989) Possible use of a 1.8-kb DNA fragment for the specific detection of Salmonella in foods. J. Ferment. Bioeng. 68, 1-6. 50lsen, J.E., Aabo, S., Nielsen, E.O. and Nielsen, B.B. (1991) Isolation of a Salmonella-specific DNA hybridization probe. APMIS 99, 114-120. 6 Rubin, F.A., Kopecko, D.J., Noon, K.F. and Baron, LS. (1985) Development of a DNA probe to detect Salmonella Typhi. J. Clin. Microbiol. 22, 600-605. 7 Poppe, C., Curtiss III, R., Gulig, P.A. and Gyles, C.L. (1989) Hybridization studies with a DNA probe derived from the virulence region of the 60 Mdal plasmid of Salmonella Typhimurium. Can. J. Vet. Res. 53, 378-384. 8 Elsinghorst, E.A., Baron, L.S. and Kopecko, D.J. (1989)
172 Penetration of human intestinal epithelial cells by Salmonella: Molecular cloning and expression of Salmonella typhi invasion determinants in Escherichia coli. Proc. Natl. Acad. Sci. USA. 86, 5173-5177. 9 Appleyard, R.K. (1954) Segregation of new lysogenic types during growth of a doubly lysogenic strain derived from Escherichia coli K12. Genetics 39, 440-452. 10 Brosis, J., Palmer, M.L., Kennedy, P.J. and Noller, H.F. (1978) Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. Proc. Natl. Acad. Sci. USA 75, 4801-4805. 11 Woese, C.R., Gutell, R., Gupta, R. and Noller, H.F. (1983) Detailed analysis of the higher-order structure of 16S-like ribosomal ribonucleic acids. Microbiol. Rev. 47, 621-669.
12 Green, C.J., Stewart, G.C., Hollis, M.A., Void, B.S. and Bott, K.F. (1985) Nucleotide sequence of the Bacillus subtilis ribosomal RNA operon, rrnB. Gene 37, 261-266. 13 Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L. and Pace, N.R. (1985) Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. USA 82, 6955-6959. 14 Abe, A., Kitagawa, M., Ikuta, Y., Miyakoshi, S., Danbara, H., Kashiwagi, N. and Obata, F. (1992) Rapid DNA typing utilizing immobilized oligonucleotide probe and a nonradioactive detection system. J. Immunol. Methods 154, 205-210. 15 Woese, C.R. (1987) Bacterial evolution. Microbiol. Rev. 51,221-271.
