Journal of Plant Pathology (2014), 96 (2), 407-409
Edizioni ETS Pisa, 2014
Zhao et al.
407
Short Communication
RAPID DETECTION OF APPLE STEM GROOVING VIRUS BY REVERSE TRANSCRIPTION LOOP-MEDIATED ISOTHERMAL AMPLIFICATION L. Zhao1*, C.-H. Feng2*, B.-Q. Li2, X.-A. Hao1, H. Liu1, Y.-F. Wu1 and Q.-C. Wang2 1College
of Plant Protection and 2College of Horticulture, State Key Laboratory of Crop Stress Biology or Arid Areas, Key Laboratory of Crop Pest Integrated Pest Management on Crop in Northwestern Loess Plateau, Ministry of Agriculture, Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, Northwest A&F University, Yangling, 712100, P.R. China *These two authors contributed equally to the present study
SUMMARY
Apple stem grooving virus (ASGV) is one of the relevant apple viruses worldwide. In this study, a simple, sensitive one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the rapid detection of ASGV, using primers designed in the coat protein gene. The RT-LAMP assay identified 53 infected apple leaf samples while RT-PCR identified only 49 infected samples. To the best of our knowledge, this is the first report on detection of ASGV by RT-LAMP. Key words: Apple stem grooving virus, LAMP, detection, diagnosis. Apple (Malus × domestica) is one of the most economically important fruit crops globally. Viruses are a great threat for sustainable production of apple (Hadidi and Barba, 2011). Apple stem grooving virus (ASGV), a member of the genus Capillovirus, family Betaflexiviridae (Adams et al., 2012), is one of the major viruses causing severe damage to apple. This virus can infected about 20 species of Malus and Pyrus (Massart et al., 2011). Infection of ASGV is associated with tree decline and graft union necrosis in sensitive combinations of scion and rootstock (Massart et al., 2011). Availability of simple and sensitive detection methods is necessary for disease management, several of which, such as ELISA (Mowat and Dawson, 1987), immuno-tissue printing (Knapp et al., 1995) and RT-PCR (Menzel et al., 2002) heve been applied. Although ELISA has been widely used to detect AGSV in apple trees, low sensitivity, and very low titer of ASGV limit its application (Massart et al., 2011). RT-PCR requires production of high quality RNA, which can be problematic because of the inhibitory effects of polysaccharides and phenolic compounds in apple tissues (Asif et al., 2006). Corresponding author: Y.-F Wu Fax: +86.029.87092716 E-mail:
[email protected]
Reverse transcription loop-mediated isothermal amplification (RT-LAMP) has been developed as a simple, sensitive method for virus detection (Notomi et al., 2000). With two or three primer pairs, target RNA is amplified to produce stem-loop DNA structures with several inverted repeats of the target fragment and cauliflowerlike structures with multiple loops (Notomi et al., 2000). The amplifications can be directly observed by the naked eye or by gel-electrophoresis (Nagamine et al., 2002). RTLAMP exhibits high specificity and selectivity, and can be completed within about 1 h under isothermal conditions without specialized equipment (Nagamine et al., 2002). A number of plant pathogens, such as Cucumber mosaic virus (Jun et al., 2012a), Tobacco mosaic virus (Liu et al., 2010), Banana bunchy top virus (Jun et al., 2012b) Plum pox virus (Varga and James, 2006), Peach latent mosaic viroid (Boubourakas et al., 2009) and Barley yellow dwarf virus (Zhao et al., 2010), have successfully been detected by LAMP. The objective of this study was to develop a simple and sensitive method for the rapid detection of ASGV using a one-step RT-LAMP assay. Eight samples of 8- to 10-year-old Fuji apple trees grafted on M26 were used in the present study. Fresh leaves were collected from trees grown at the Experimental Station of Northwest A&F University in Yangling, China. Total RNA was extracted from leaf tissue using Trizol reagent (Invitrogen, USA) following the manufacturer’s recommendations. Samples were tested for their sanitary status by RT-PCR using previously described primers (Fan et al., 2009). Samples that responded positively only for single infection by ASGV were selected and stored at -80°C for use as templates for RT-LAMP. To design the primers for the RT-LAMP assay, sequences of various ASGV isolates from apple, citrus, lily, kumquat, cherry and pear were examined to identify conserved regions of the virus genome. The coat protein gene sequence of ASGV (GenBank accession Nos. JQ308181, NC001749, FJ355920, AB004063, D16681, AY646511, AY596172, EU553489) was selected as reference sequence for primer design, using a Primer Explorer software version 4.0 [http://primerexplorer.jp/e/v4_manual/index.html
408
Journal of Plant Pathology (2014), 96 (2), 407-409
ASGV detection by RT-LAMP
Table 1. Names and nucleotide sequence of the primers used for RT-PCR and RT-LAMP assays. Primer name
Type
Sequence 5’ → 3’
F3
forward outer
GCTTTGTGAGCCATTTGC
B3
reverse outer
TTTTGGTCATCCTATCAATCAC
FIP
forward inner
CGAAAGCTTTGGGCCATTTCTTTTCATGAAAGGTGGTCAAGA
BIP
reverse inner
CCGTGGGTGGCATTTGACTTTTCATCAGGTGTTAGACGATT
(Eiken Chemical, Japan)]. Two outer (B3 and F3) and two inner (FIP and BIP) primers were used (Table 1). Total RNA was isolated from leaf tissue, as described by Fan et al. (2009), and used as the template for RT-LAMP in a 25 μl reaction mixture containing 1.6 μM of each inner primer (FIP and BIP), 0.4 μM of each outer primer (F3 and B3), 5 mM MgSO4, 1.0 M betaine (Sigma-Aldrich, USA), 1.0 mM of dNTP mix (Promega, USA), 1× ThermoPol buffer (20 mM Tris-HCl, 10 mM KCl, 2 mM MgSO4,10 mM (NH4)2SO4, 0.1% Triton X-100), 4 U of RNasin, 10 U of Moloney murine leukemia virus reverse transcriptase (MMLV RT, Promega, USA), 10 U of Bst DNA polymerase (large fragment; New England Biolabs, USA) and 1 μl target RNA. The mixture was incubated at 60°C for 60 min, followed by 5 min at 80°C with the help of a Loopamp real-time turbidimeter (LA-230; Eiken Chemical, Japan). The RT-LAMP products were analyzed by real-time monitoring through the spectrophotometric analysis and gel electrophoresis.
The specificity of the primers used in the RT-LAMP was determined by testing cross-reactivity with other two apple-infecting viruses: Apple chlorotic leaf spot virus (ACLSV) and Apple stem pitting virus (ASPV). The sensitivity of the RT-LAMP was assessed by amplifying the PCR-products of a plasmid containing the ASGV target gene. The plasmid was serially diluted tenfold (1 ng/µl to 1 fg/µl) and amplified using the two amplifications which were sequentially set up. With the designed primers, RT-LAMP-amplified bands were observed in the samples infected with ASGV, but not in those infected with either ACLSV or ASPV, thus indicating a high specificity of the assay (data not shown). ASGV could be detected by RT-LAMP in the plasmid that was diluted to 100 fg/μl. Compared to RT-LAMP, the detection limit of PCR was found to be 1 pg/μl (Fig. 1) showing that RT-LAMP is 10-fold more sensitive than conventional PCR. To evaluate the usefulness of this one-step RT-LAMP for the detection of ASGV in the field, a total of 80 samples were comparatively tested by RT-LAMP and RT-PCR. RT-PCR detected 49 samples that were infected by ASGV and 31 that were not. By contrast RT-LAMP found 53 positive samples, indicating that the assay is more sensitive than RT-PCR. In summary, we developed a one-step RT-LAMP assay for the rapid detection of ASGV. To the best of our knowledge, this is the first report on the detection of ASGV by RT-LAMP. This method is specific and highly sensitive, and can be used for the rapid detection of ASGV. ACKNOWLEDGEMENTS
The authors acknowledge financial supports provided by Northwest A&F University (Z222020904), Department of Fruit Industry of Shaanxi Province (K336021105), the National High-tech R&D Program of China (No.2012AA101504) and the 111 Project from the Education Ministry of China (No.B07049). Fig. 1. Sensitivity of LAMP and PCR assays for ASGV detection. Serial 10-fold dilutions of plasmid ranging from 1 ng/μl to 1 fg/μl were tested. The samples in tubes 1-8 (Fig. 1A) and lanes 1-8 (Fig. 1C) are the same as serial dilutions in Fig. 1A, beginning with 1 ng/μl in tube 1 and lane 1, respectively. (A) RT-LAMP analysis of virus by reaction mixture turbidity. (B) RT-LAMP analysis of virus by agarose gel electrophoresis. (C) RT-PCR analysis of virus by agarose gel electrophoresis.
REFERENCES Adams, M.J., Candresse, T., Hammond, J., Kreuze, J.F., Martelli, G.P., Namba, S., Pearson, M.N., Ryu, K.H., Saldarelli, P., Yoshikawa, N., 2012. Family Betaflexiviridae. In: King A.M.Q., Adams M.J., Carstens E.B., Lefkowitz E.J. (eds). Virus Taxonomy. Ninth Report of the International
Journal of Plant Pathology (2014), 96 (2), 407-409 Committee on the Taxonomy of Viruses, pp. 920-941. Elsevier-Academic Press, Amsterdam, The Netherlands. Asif M., Trivedi P., Solomos T., Tucker M., 2006. Isolation of high quality RNA from apple (Malus domestica) fruits. Journal of Agriculture and Food Chemistry 54: 5227-5229. Boubourakas I.N., Fukutab S., Kyriakopoulou P.E., 2009. Sensitive and rapid detection of Peach latent mosaic viroid by the reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods 160: 63-68. Fan X., Dong Y., Zhang Z., Li L., Pei G., 2009. Multiplex RTPCR assay for simultaneous detection of three latent apple viruses. Acta Horticulturae Sinica 36: 1821-1826. Hadidi A., Barba M., 2011. Economic impact of pome and stone fruit viruses and viroids. In: Hadidi A., Barba M., Candresse T., Jelkmann W. (eds).Virus and Virus-like Diseases of Pome and Stone Fruits, pp.1-7. APS Press, St. Paul, MN, USA. Jun P., Shi M., Xia Z., Huang J., Fan Z., 2012a. Detection of Cucumber mosaic virus isolates from banana by one-step reverse transcription loop-mediated isothermal amplification. Archives of Virology 157: 2213-2217. Jun P., Zhang J., Xia Z., Li Y., Huang J., Fan Z., 2012b. Rapid and sensitive detection of Banana bunchy top virus by loopmediated isothermal amplification. Journal of Virological Methods 185: 254-258. Knapp E., da Càmara Machado A., Pühringer H., Wang Q.C., Hanzer V., Weiss B., Katinger H., Laimer da Càmara Machado M., 1995. Localization of fruit tree viruses by immunotissue printing in infected shoots of Malus sp. and Prunus sp. Journal of Virological Methods 55: 157-173.
Received November 18, 2013 Accepted December 18, 2013
Zhao et al.
409
Liu Y., Wang Z., Qian Y., Mu J., Shen L., Wang F., Yang J., 2010. Rapid detection of Tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method. Archives of Virology 155: 1681-1685. Massart S., Jijakli M.H., Kummer J., 2011. Apple stem grooving virus. In: Hadidi A., Barba M., Candresse T., Jelkmann W. (eds). Virus and Virus-like Diseases of Pome and Stone Fruits, pp. 29-33. APS Press, St. Paul, MN, USA. Menzel W., Jelkmann W., Maiss E., 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods 99: 81-92. Mowat W.P., Dawson S., 1987. Detection and identification of plant viruses by ELISA using crude sap extracts and unfractionated antisera. Journal of Virological Methods 15: 233-247. Nagamine K., Hase T., Notomi T., 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Molecular and Cellular Probes 16: 223-229. Notomi T., Okayama H., Masubuchi H., Yonekawa T., Watanabe K., Amino N., Hase T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Research 28, e63. Varga A., James D., 2006. Use of reverse transcription loopmediated isothermal amplification for the detection of Plum pox virus. Journal of Virological Methods 138:184–190. Zhao K., Liu Y., Wang X.F., 2010. Reverse transcription loopmediated isothermal amplification of DNA for detection of Barley yellow dwarf viruses in China. Journal of Virological Methods 169: 211-214.
