Rapid induction of cytotoxic T-cell response against cervical cancer ...

D 2001 Nature Publishing Group 0929-1903/01/$17.00/+0 www.nature.com/cgt

Rapid induction of cytotoxic T-cell response against cervical cancer cells by human papillomavirus type 16 E6 antigen gene delivery into human dendritic cells by an adeno-associated virus vector Yong Liu,1 Maurizio Chiriva-Internati,2 Fabio Grizzi,3 Emanuela Salati,2 Juan J. Roman,1 Seah Lim,2 and Paul L. Hermonat1 1

Departments of Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205; 2Center for Immunology and Microbial Disease, Albany Medical College, Albany, New York 12208; and 3Scientific Direction, Instituto Clinico Humanitas, Rozzano, Milano, Italy.

We have shown that the pulsing of dendritic cells ( DCs ) with human papillomavirus type 16 ( HPV - 16 ) antigen proteins by lipofection stimulates class I – restricted cytotoxic T lymphocyte ( CTL ) response against primary cervical cancer cells. Also, we have shown that adeno - associated virus ( AAV ) was able to effectively deliver a cytokine gene into DCs. It has been our hypothesis that the delivery of antigen genes into DCs, resulting in endogenous and continuous antigen protein expression, may result in an improvement in T - cell priming by DCs. Here, DCs are pulsed ( infected ) with an AAV vector containing the HPV - 16 E6 gene. After infection, transduced E6 gene mRNA expression and vector chromosomal integration could be identified in infected DCs. Furthermore, priming rosettes formed at early times when the AAV / E6 vector was used. Most importantly, AAV / E6 vector pulsing of DCs induced, after only 7 days of priming, a strong CTL response against primary cervical cancer cell lines, compared to bacterial E6 protein lipofection. Killing was significantly blocked by the addition of anti - MHC class I antibodies. Fluorescence - activated cell sorter ( FACS ) analysis of resulting primed cell populations revealed higher levels of CD8 + T cells by AAV - based pulsing, with little evidence of CD56 ( NK ). FACS analysis of the DC populations revealed that AAV / E6 vector – pulsed DCs had higher levels of CD80 and lower levels of CD86 than protein - pulsed DCs. These data suggest that rAAV may be appropriate for antigen pulsing of DCs for immunotherapy protocols. Finally, our protocol represents an advance in regards to the time needed for generating a CTL response compared to other techniques. Cancer Gene Therapy ( 2001 ) 8, 948 – 957 Key words: Dendritic cell; adeno - associated virus; cervical cancer; human papillomavirus; E6; integration; transduction.

O

ne approach toward developing an effective immunotherapeutic regime for certain cancers and infectious diseases may be through the manipulation of antigen presenting cells, such as dendritic cells (DCs ). DCs are potent, professional antigen -presenting cells, which are able to initiate primary immune response to antigens by naive T cells.1 Their manipulation could correct immune defectiveness or tumor tolerance, resulting in effective DC or primed T- cell adoptive immunotherapies. Recently, highly effective tissue culture protocols for generating DCs in vitro from peripheral blood have been developed. This ability to produce significant quantities of DCs allows for the possibility of their in vitro manipulation for clinical protocols.2,3 Many groups are, in fact, developing protocols for DC manipulation, in which specific cytotoxic T lymphocyte ( CTL ) responses against tumor cells ( in vitro ),

Received August 9, 2001. Address correspondence and reprint requests to Dr. Paul L. Hermonat, Departments of Obstetrics and Gynecology, Slot 518, University of Arkansas for Medical Sciences, 4301 West Markham Street, Little Rock, AR 72205. E-mail address: [email protected]

948

or tumor challenge (in vivo ), can be generated by pulsing DCs with tumor fragments, antigen peptides, defined tumor antigens, or with antigen genes by way of retrovirus and adenovirus vectors.4 – 35 There are several potential ways to treat or pulse cells with proteins; however, all proteins degrade. For example, human papillomavirus (HPV ) E7, which can serve as a target antigen for cervical cancer, has a half - life of only 1 hour.36 We and others have hypothesized that a more effective technique for treating DCs might be the internal generation of the antigen protein in situ, within the DC itself. By delivering the tumor antigen gene directly into DCs, a stable and continuous production of the tumor antigen can be accomplished. 8, 9, 11,12,18,24,26,29,30 Adeno -associated virus ( AAV ) has been shown to be an effective gene -delivery vector for both immortalized tissue culture cells as well as primary hematopoietic cells.37 – 48 Previously, we have demonstrated the successful transduction, including chromosomal integration, of the GM - CSF gene into monocytes ( Mos ) and DCs.37 AAV- based transduction of the GM -CSF gene was found to be able to fully replace the need for the standard addition of exogenous GM -CSF in pre - DC

Cancer Gene Therapy, Vol 8, No 12, 2001: pp 948 – 957

LIU, CHIRIVA - INTERNATI, GRIZZI, ET AL: AAV / E6 INDUCES RAPID CYTOTOXIC RESPONSE

cultures. This was the first study to demonstrate AAVmediated gene transduction specifically into DCs. We believe that AAV, with its virion composed of a very limited repertoire of proteins, and its ability to chromosomally integrate, may be useful for antigen gene delivery into DCs. In this study, we demonstrated the successful transduction of the HPV-16 E6 antigen gene into DCs, resulting in significant MHC class I– restricted cervical cancer cell killing activity. Furthermore, it is demonstrated that the length of priming, the time of DC –T cell incubation, with this AAV-transduction technique, requires only 1 week to generate significant killing activity. This is in sharp contrast to antigen protein lipofection of DCs, which usually requires 2 –3 weeks incubation.34,35

MATERIALS AND METHODS

Construction of the AAV /E6 / Neo genome, generation of virus stocks, and titering of virus stocks. The AAV /E6 /Neo genome was constructed as a plasmid, in a similar manner to the construction of the AAV /GM - CSF /Neo viral genome previously described.37 However, instead of the GM - CSF gene, the HPV-16 E6 open reading frame was cloned by PCR amplification using Pfu polymerase and ligated into the vector. High -titer rough ( nonpurified ) rAAV virus stocks were generated in a two -step process, using the complementor plasmid ins96 -0.8, and titered as described previously.37,49 To generate purified rAAV virus the technique described by Auricchio et al50 was used. Briefly, the virus solution treated by DNase I ( Promega Co., Madison, WI ) was incubated with 0.5% deoxycholic acid ( Sigma, St. Louis, MO ) for 30 minutes at 378C. After filtration the solution was applied on a heparin– agarose column ( Sigma ). The matrix was washed twice with 25 mL of 0.254 M NaCl – phosphate - buffered saline (PBS ), pH 7.4, and then eluted with 15 mL of 0.554 M NaCl – PBS, pH 7.4. The eluate was then concentrated to about 1 mL using a Millipore Biomax 100 K NMWL filter device and centrifugation.50 Purity of the viral preparation ( 100 L ) was assessed on 4 – 20% SDS –polyacrylamide gel run. The proteins were detected by Coomassie staining. The titer of purified virus was calculated by dot blot and determined to be 11011 encapsidated genomes per milliliter. Cells used in this study. The primary cervical cancer cell lines, CA1 (patient 1 ) and CA2 ( patient 2 ), have been described previously, both containing HPV- 16 DNA, and were approximately 10 passages from initial isolation.34 These cells were grown in keratinocyte- SFM supplemented with epidermal growth factor and bovine pituitary extract ( Gibco BRL /Life Technologies, Rockville, MD ). Human leukocyte antigen (HLA ) typing of these cells gave haplotypes of HLA A1 for both CA1 and CA2, respectively. Mos and DCs were derived from peripheral blood mononuclear cells ( PBMCs). PBMCs were separated by routine Ficoll gradient method from fresh blood drawn from healthy persons. The normal donor had a haplotype of HLA A1, compatible with the target cancer cells. The PBMCs were inoculated into six -well culture plates and incubated with

Cancer Gene Therapy, Vol 8, No 12, 2001

949

2 mL of AIM - V medium for 2 hours at 378C and 5% CO2. At that time, nonadherent cells were removed by carefully washing the monolayer three times with PBS, pH 7.0. Infection of Mo /DCs with AAV virus and treatment with cytokines. Immediately after the removal of the nonadherent cells, the adherent Mos were infected (pulsed) with 0.5 mL of virus stock (51010 encapsidated genomes) when using the nonpurified virus, or 107 encapsidated genomes when using the purified virus. After 2 hours incubation the medium /virus solution was removed, the cells were washed with AIM -V, and finally fed with AIM - V medium. The infection protocol is outlined in Figure 1D. The Mo /DC precursors were infected with 0.5 mL of virus stock or lysate at days 0, 3, and 5. Throughout this time, the Mo /DC culture was treated with human GM - CSF ( LEUKINE1, Immunex, Seattle, WA, 1.4106 IU /250 g) at a final concentration of 800 IU /mL. At day 3, to induce the maturation of Mos into DCs, human interleukin ( IL ) 4 (IL -4, R&D Systems, Minneapolis, MN ) at 1000 IU /mL was added to the medium. Finally, at day 5, recombinant human IL - 2 ( R&D Systems) at 10 U /mL was added. Generation of bacterial E6 protein and lipofection of Mo /DCs. GST-E6 protein was generated in a similar manner to previous generation of GST-E7.34 The Mo /DCs were lipofected ( pulsed ) with 50 g of GST- E6 on day 5 as previously described.34 The treatment of the protein pulsed Mo /DCs with cytokines was the same as that of the virus infected DCs. mRNA isolation and RT-PCR analysis for E6 expression. E6 mRNA expression was measured by RT-PCR amplification along with a cellular mRNA control. Total RNA was isolated from mock ( lysate )- infected and AAV / E6 / Neo -infected Mo /DCs using Trizol reagent ( Gibco BRL /Life Technologies ), according to the manufacturer’s protocol, and treated with 5 U / g of RNase - free DNase I ( Promega) at 378C for 1 hour. Messenger RNA was then separated using the Oligotex mRNA Mini Kit (Qiagen, Valencia, CA ) according to the supplier’s instruction. The first-strand cDNA synthesis was performed at 378C for 1 hour in a final volume of 25 L reaction buffer [ 1 g mRNA; 50 mM Tris – HCl, pH 8.3; 75 mM KCl; 3 mM MgCl2; 10 mM DTT; 0.5 g oligo( dT )15 ( Promega); 0.5 mM each of the four dNTPs; 30 U of RNasin ( Promega ) and 200 U of M -MLV reverse transcriptase RNase H Minus ( Promega)] . PCR amplification of the cDNA was performed in 100 L reaction volume, which contained 2.5 U Taq DNA polymerase ( Fisher Scientific, Pittsburgh, PA ); 10 mM Tris – HCl, pH 8.3; 50 mM KCl; 2 mM MgCl2; 0.2 mM each of the four dNTPs; 1 M of each upstream and downstream primer specific for the cDNA template and 10 L cDNA template. The E6 primer set used was 50 -ACCACAGTTATGCACAGAGC -30 and 5- AGGACACAGTGGCTTTTGAC - 30, which targeted amplification of the HPV- 16 sequences from nt 139 to 420. A control RT- PCR analysis of expression of the housekeeping gene TFIIB was also undertaken with the primer set 50 - GTGAAGATGGCGTCTACCAG -30 and 50 -GCCTCAATTTATAGCTGTGG -30, which amplified nt 356 –1314 of that mRNA. To ensure that DNA was not contributing to the results, a direct PCR

950


p5

A

AAV/E6 /Neo

B C

SV40

E6

Neo

a

b

c

d

e

g

h

i

j

k

f

l

107

108

109

1 µl

10 µl

100 µl

standards virus stock

D

DC pulsing techniques:

T cell addition

1) GST-E6/DOTAP 2)AAV/E6/Neo infection

priming

3) mock (lysate) infection

day

01 2 3 4

5

6 7 8 9 10 11 12

GM-CSF IL-4 IL-2

Chromium release assay Figure 1. AAV / E6 / Neo vector, producer cell lines, and experimental scheme. A: Shows a structural map of the AAV / E6 / Neo ( aka dl6 95 / E6p5 / NeoSV40 ) virus with the names of the components at the top. TR ( black box ) refers to the AAV terminal repeats. P5 ( bent arrow ) refers to the AAV p5 promoter. The open box is the E6 open reading frame. SV40 ( bent arrow ) refers to the simian virus 40 early enhancer / promoter. The right box is the Neo open reading frame. B: Shows the analysis of various 293 / vector producer cell lines. C: Shows a titering analysis of the AAV / E6 / Neo virus stock used in this study. D: Shows a graphic description of the experimental protocol. Briefly, two basic types of DC pulsing were undertaken. One type was infection with AAV / E6 / Neo virus or mock infection with cell lysate, on days 0, 3, and 5. The other was lipofection of protein on day 5.

was also undertaken. The products were then analyzed on an agarose gel, stained with ethidium bromide, and visualized by ultraviolet light.

Intracellular staining for E6. This protocol is adapted from that described by Pala et al51 The Mo /DCs were infected with virus or lipofected with protein as described above. Cells were then treated with IL - 4 and GM -CSF under standard conditions. Seven days after infection /lipofection the cells were harvested, washed, and fixed with 2% paraformaldehyde in PBS for 20 minutes at room temperature. The cells were washed and permeabilized with PBS / 1% BSA /0.5% saponin ( S- 7900, Sigma) for 10 minutes at room temperature. Cells were stained with anti –HPV- 16 /18 E6 (Chemicon, Temecula, CA; cat. no. MAB874) plus FITC –anti – mouse- Ig ( Becton Dickinson, cat. no. 554001 ) and analyzed by flow cytometry. Detection of viral integration by PCR /Southern blot analysis. Chromosomal integration of the AAV /E6 /Neo genome was undertaken by vector – chromosome junction PCR amplification and Southern blot analysis as previously described.37 Chromium release assay of CTL activity. Nonadherent PBMCs ( T cells and B cells ) were washed and resuspended in AIM -V at ( 10– 20 )106 cells /well in six -well culture plates ( Costar, Cambridge, MA ) with rAAV- or GST-E6 – pulsed DCs ( ratios from 20:1, responders:dendritic ). The cultures were supplemented with recombinant human GM CSF (800 U /mL ) and recombinant human IL -2 (10 U /mL ). At 7 days post addition of the PBMCs, the cells were assayed for tumor cell killing activity in a 6- hour chromium - 51 release assay as previously described.34 One of two HLA class I A1 – compatible primary cervical tumor cells was 51Cr- labeled and used as targets as previously described.34 To determine the structures on the target cells involved in lysis, anti –class I monoclonal antibodies ( mAbs ) were used to block cytotoxicity. The 51Cr-labeled tumor targets were preincubated with mAbs specific for monomorphic HLA class I W6/ 32 (50 g /mL ) (hybridoma obtained from the ATCC, Rockville, MD ). The effector cells and 51Cr- labeled targets were then incubated in a final volume of 200 L for 6 hours at 378C with 5% CO2. Cell surface marker analysis of T cells and DCs by fluorescent antibody cell sorting (FACS ). For the analysis of T cells, at day 12 of the experiment the primed T-cell populations were analyzed for surface markers. A panel of mAbs recognizing the following antigens was used: antiCD4, anti - CD8, anti -CD56 (Pharmingen, San Diego, CA ). Control irrelevant isotype -matched FITC - or PE -conjugated mAbs were obtained from Becton Dickinson. These cells were greater than 95% viable as assessed by trypan blue exclusion. Cell suspensions were counted and distributed into 1275- mm tubes. Mouse mAbs were diluted in cold assay buffer and the final pellet was resuspended in 500 -L volume. Tubes were incubated for 30 minutes followed by two washes with assay buffer and the final cell pellet was resuspended in 500 L of assay buffer for subsequent analysis. Cells were analyzed with a fluorescence - activated cell sorter (FACS; Becton Dickinson ) with a 15 -mW argon laser with an excitation of 488 nm. Fluorescent signals were gated on the basis of cell dimension (i.e., forward and right angle light scattering typical of PBL activated. Gated signals ( 5,000 –10,000 ) were detected at 585 BP filter and analyzed


951


using Cell Quest software (Becton Dickinson, Bedford, MA ). For the analysis of DCs, a panel of mAbs recognizing the following antigens was used: anti -CD40 (Immunotech, Marseille, France ); anti -CD14, anti -DR, anti - CD80 (Becton Dickinson ), anti -CD86 (Pharmingen, San Diego, CA ), anti - CD83 (Coulter, Miami, FL ). Control irrelevant isotype -matched FITC - or PE -conjugated mAbs were obtained from Becton Dickinson. Briefly, nonadherent cells were harvested by washing the plates with PBS, pH 7.2 ( Gibco ). Adherent cells were recovered by incubating the plates at room temperature for 15– 20 minutes in the presence of Ca + and Mg + -free PBS, followed by gentle scraping. These cells were > 95% viable as assessed by trypan blue exclusion. Cell suspensions were counted and distributed into 1275 mm tubes. Mouse mAbs were diluted in cold assay buffer (PBS, pH 7.2, supplemented with 0.I% FBS ) and added in a 50- L volume. For direct fluorescence, tubes were incubated for 30 minutes followed by two washes with assay buffer and the final cell pellet was resuspended in 500 L assay buffer for subsequent analysis. RESULTS

pos ctrl PCR only mock infected AAV/E6/Neo

1.3>

Figure 4. Chromosomal integration by AAV / E6 / Neo in DCs. Mo / DCs were treated as in Figure 3, and sorted for CD83 expression and analyzed for chromosomally integrated AAV / E6 / Neo viral genomes on day 5 as described in Materials and Methods. Briefly, total cellular DNA from the infected, CD83 + selected cells and uninfected cells served as template in PCR amplification assays using primers targeting the SV40 early promoter of the vector and the cellular repetitive AluI element. The products were Southern blotted and probed with 32 P - Neo DNA. The positive control lane contained 100 ng of EcoRV digested AAV / E6 / Neo plasmid ( 6.7 and 1.3 kb ). The negative control lane contained products from a PCR reaction with DNA mock - infected cells. Note that multiple Neo - positive bands result from the infected DC population indicating chromosomal integration by the vector, and that multiple vector - positive cell clones are present in the population.


953



AAV/E6/Neo MM target + W632

AAV/E6/Neo + W632 AAV/E6/Neo

B

AAV/E6/Neo

GST-E6

70 60 50 40 30 20 10 0

AAV/E6/Neo

Higher CD8 / CD4 and lower CD56 / CD8 cell ratios result with AAV-mediated pulsing / priming. Next, the makeup of the T-cell populations, which resulted from AAV transduction or protein lipofection, was observed. An effective CTL response, while requiring CD8 + T cells as an effector of lysis, also requires CD4 + helper T cells.52 We used flow cytometric analysis to determine the phenotype of the population of the lysate, GST- E6 -pulsed, and AAV /E6 / Neo - pulsed T- cell populations. As shown in Figure 7A, in the mock case, we see a normal ratio of CD8 to CD4 positive cells ( 1.21:1 ). In the GST-E6 pulsing case, the CD8 / CD4 ratio remains the same ( 1.23:1 ). In sharp contrast, in the AAV / E6 /Neo -pulsed case, the ratio of CD8 /CD4 changes dramatically to 7.0:1. Normally, one would not expect this

A

70 60 50 40 30 20 10 0

GST-E6

cells resulted in much higher killing activity than the protein primed and lysate controls. These same AAV /E6 / Neo - primed cells were unable to lysis an unrelated multiple myeloma target. Finally, the addition of the anti – class I antibody W632 significantly blocked killing, indicating class I restriction of killing. We next assayed for class I– restricted killing of a second HLA A1 – matched, previously characterized primary cervical cancer cell line CA -2.34 The resulting killing was very similar to that against CA -1 (Fig 6). Again, the addition of the anti – class I antibody W632 significantly blocked killing, indicating class I restriction of killing. Finally, because we had utilized nonpurified virus in these experiments, which contained lysed cellular components, we repeated the CTL experiment using a heparin column –purified virus stock. DCs were pulsed with 107 purified encapsidated genomes of AAV /E6 /Neo (approximately 10 3 virus used in the Fig 6 experiments ). A CTL assay was then carried out on the CA1 cervical cancer primary target as described in Figure 6. The resulting killing for AAV / E6 /Neo, AAV /E6 /Neo plus anti – class I antibodies, GSTE6, and lysate control pulsing of DCs were 36.1 ± 1.4%, 0.4 ± 0.3%, 3.1 ± 1.4%, and 2.0 ± 0.5%, respectively. These data indicate that the CTL activity in all of these experiments was in fact due to AAV / E6 /Neo viral transduction /pulsing of DCs.

lysate

Figure 5. Early appearance of priming rosettes during AAV -mediated priming. Adherent Mos were mock, GST - E6, or AAV / E6 / Neo virus pulsed. Each of these cultures were then treated with GM - CSF and IL - 4 as prescribed by Sallusto and Lanzavecchia2 and Romani et al3 for generating DCs. At day 5, the resulting DCs were then incubated with nonadherent peripheral blood lymphocytes. At day two, representative pictures were taken of the cultures at low and high power. Note that the virus - treated DC – T cell cultures exhibited much higher levels of rosetted cell clusters, suggesting stronger DC – T cell interaction.

high ratio to arise until 3 weeks of DC / T-cell priming,34 suggesting that the AAV – Ag pulsing of DCs results in not only quicker activation, but also higher killing activity, HLA class I restricted, on a per CD8 + T-cell basis. The high killing is consistent with a Type 1 (Th 1 ) response. This is important because recent studies have suggested that progression to cervical cancer from precursor lesions may be associated with a preferential Type 2 ( Th 2) T-cell response, along with significant dysfunction of Type 1 T-cell response in patients with high - grade cervical intraepithelial lesions and invasive cervical cancer.53 The expression of CD56 was also observed. Some consider this marker as being specific for natural killer T cells.54 However, others have reported that some CD8 + T cells do express CD56 and do exhibit HLA class I –restricted killing.55 Despite this confusion, all of our T- cell populations exhibited low CD56 expression. However, what is noteworthy in this analysis is the very high level of CD8 + T cells in the case of AAV / E6 /Neo pulsing, confirming the CD8 /CD4 analysis ( Fig 7A ). Taken together, these data

lysate

AAV/E6/Neo pulsed

Cytotoxicity, % killing

GST-E6 pulsed

Cytotoxicity, % killing

lysate-pulsed

Figure 6. Cytotoxic response resulting from AAV vector and DOTAP – protein lipofection after 7 days of priming. A: Shows a representative experiment of cytotoxic response resulting from the indicated pulsing techniques, Mo / DCs, and T cells from a normal individual against HLA A1 – matched primary cervical cancer cells ( CA1 ) and a primary multiple myeloma ( MM ). Note that the addition of the class I blocking antibody W632 greatly inhibits killing. Also note lack of killing activity against the primary MM. B: Shows a representative experiment of cytotoxic response against a second HLA A1 – matched primary cervical cancer ( CA2 ). Again, note that the addition of the class I blocking antibody W632 greatly inhibits killing.

954


A

FL1-H

FL2-H

B

FL1-H

FL2-H

AAV/ E6 vector pulsing resulted in DCs with higher CD80, and lower CD86 expression. Finally, we characterized the DCs resulting from the various pulsing techniques to observe if significant differences were discernable. We used flow cytometric analysis to determine the phenotype of untreated, lysate -pulsed, GST-E6 – pulsed, and AAV /E6 /Neo -pulsed DC populations. The results, shown in Figures 8 and 9, demonstrate that the DCs generated from all four techniques

DC lysate

DC DC GST-E6 AAV/E6/Neo

CD14

-/-

-/-

HLA-DR

++/-

+++/-

+++/-

-/-

+++/-

-/-

CD40

++/-

++/-

++/-

++/-

CD80

++/-

++/-

++/-

+++/-

CD83

++/-

++/-

++/-

++/-

CD86

++/-

++/-

+++/-

++/-

Figure 8. Characterization of DCs at day 7 under different conditions. Mos were treated as indicated, treated with GM - CSF and IL - 4 and analyzed by FACS for mean fluorescent intensity ( MFI ) on day 7. ( ) No detectable MFI staining, ( + ) MFI 101 to 102, ( + + ) MFI 102 to 103, ( + + + ) MFI 103 to 104. Representative of three experiments. Note AAV - pulsing results in higher CD80 and lower CD86 levels compared to protein pulsing.

53%

38%

CD56:

7%

GST-E6

11%

CD8 :

49%

43%

mock

AAV/E6/Neo

3%

32%

ctrl

indicate a very different resulting primed T-cell population when AAV –antigen pulsing was used, and suggests that the increased killing activity may be a result of these changes in the T- cell population These data also indicate that CD8 is a specific lineage marker in HLA class I restriction in our system.

DC

46%

CD4 :

ctrl

Figure 7. Two - color flow cytometric characterization of primed cell populations. A: Shows the CD8 and CD4 prevalence within the primed population resulting from three different techniques as indicated ( right ), as well as an FL1 - H, FL2 - H control ( left ). B: Shows the CD56 and CD8 ratios in the same experimental situations as ( A ).

Mabs

CD8:

mock

4%

16%

GST-E6

63%

AAV/E6/Neo

share all of the common DC markers. However, AAV / E6 / Neo -pulsed DCs did express significantly higher levels of CD80 and lower levels of CD86 than the GST- E6 –pulsed DCs.

A

B DC only

lysate-DC GST- E6 lipof -DC AAV/E6//Neo -DC Figure 9. Characterization of CD80 in pulsed DCs. Histograms of CD80 expression compiled in Figure 7. A: Size analysis of general DC populations. B: DC CD80 expression under different conditions.



DISCUSSION

Cervical cancer is an ideal model system for investigating adoptive immunotherapy protocols as >90% of cervical cancers contain HPV DNA and the E6 and E7 oncoproteins are always expressed. We have hypothesized that antigen gene pulsing of DCs should be more effective than protein pulsing of DCs for several reasons. First, the continuous production of the antigen protein, by gene transfer, should result in higher cytotoxicity, as a result of preventing the loss antigenicity due to protein degradation, and of MHC class I and II protein cycling as happens with protein pulsing of DCs. Second, viral delivery of the antigen results in greater efficiency in DC pulsing as virus infection is usually more effective in delivery than the lipofection of proteins ( Fig 3 ). Third, viral delivery of the antigen should result in higher epitope presentation in the context of class I molecules, which should result in more efficient activation of the CD8 + cytotoxic T cells than when antigen proteins are delivered via lipofection.56 Fourth, the epitopes produced and expressed endogenously in DCs should be more representative and, thus, more immunoreactive, than epitopes of proteins produced in bacteria, as bacteria lack many of the posttranslational modifications seen in mammals. These rationales form the overall logic for this study. For this purpose, wild -type AAV is known to latently infect cells at high frequency,57 – 59 and recombinant AAV has been shown to be a versatile virus vector, being able to transduce a wide variety of cell types.38 – 49 This study demonstrates that AAV is able to transduce freshly adherent Mo /DC precursors, and that the transduction of E6 gene into DCs results in functionally active E6 - epitope –presenting DCs. Other viruses, including retroviruses, adenoviruses, and pox viruses, have previously been shown to transduce DCs. 9,11,24,29,30 However, to our knowledge, this is the first report of antigen gene transduction into human DCs by AAV. AAV can transduce by chromosomal integration and we have found that this is also possible for AAV transduction of DCs. The strength of priming found in this study suggests that AAV-transduced DCs do have a higher immunologic profile than the AAVtransduced cells of other studies. We believe that the increased DC –T cell rosetting when using the AAV vector is consistent with this hypothesis. However, this is not surprising due to the effective nature of DCs as professional antigen- presenting cells. It was surprising that the AAV – antigen pulsing technique resulted in the extremely fast priming of T cells with only 1 week of DC –T cell incubation. FACS analysis of the resulting T-cell populations suggests that the difference is likely due to an increase in proliferation of antigen -specific CD8 + T cells ( Fig 6A ). Little evidence of CD56 expression, and therefore, NK activity, was found. Furthermore, the AAV / E6 /Neo -pulsed DCs did express higher levels of CD80, and lower levels of CD86, than the protein -pulsed DCs. As CD80 is believed to be a more independent costimulatory molecule than CD86, this may explain the improve capabilities of the vector-transduced DCs.60 Overall, these data suggest that the efficiency of AAV-mediated antigen gene delivery into Mo /DCs is quite good. Our


955

protocol represents a breakthrough compared to other DC pulsing protocols in which the priming step requires 2 or 3 weeks, or more, of incubation. Even if the observed fast priming by AAV /E6 / Neo is mechanistically unclear, our data suggest that rAAV may be a highly effective vector for delivering antigen genes into DCs and eliciting immune response.

ACKNOWLEDGMENTS

Drs. Yong Liu and Maurizio Chiriva -Internati contributed equally to this work. We acknowledge the excellent assistance provided by Teri Fields and Rena Sheffer.

REFERENCES 1. Steinman RA. The dendritic cell system and its role in immunogenicity. Annu Rev Immunol. 1991;9:271 – 296. 2. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte / macrophage colony - stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med. 1994;179:1109 – 1118. 3. Romani N, Gruner S, Brang D, et al. Proliferating dendritic cell progenitors in human blood. J Exp Med. 1994;180:83 – 93. 4. Young JW, Inaba K. Dendritic cells as adjuvants for class I major histocompatibility complex – restricted antitumor immunity. J Exp Med. 1996;183:7 – 11. 5. Zivotgel L, Mayordomo JI, Tjandrawan T, et al. Therapy of murine tumors with tumor peptide - pulsed dendritic cells: dependence on T cells, B7 costimulation and T helper cell I – associated cytokines. J Exp Med. 1996;183:87 – 97. 6. Paglia P, Chiodoni C, Rhodolfo M, Colombo MP. Murine dendritic cells loaded in vitro with soluble protein prime cytotoxic T lymphocytes against tumor antigen in vivo. J Exp Med. 1996;183:317 – 322. 7. Alexander M, Salgaller M, Leseban C, Barnes WA, Rosenberg SA, Steller MA. Generation of tumor - specific cytotoxic T lymphocytes from peripheral blood of cervical cancer patients by in vitro stimulation with a synthetic human papillomavirus type 16 E7 epitope. Am J Obstet Gynecol. 1996;175:1586 – 1593. 8. Philip R, Brunette E, Ashton J, et al. Transgene expression in dendritic cells to induce antigen - specific cytotoxic T cells in healthy donors. Cancer Gene Ther. 1998;5:236 – 246. 9. McArthur JG, Mulligan RC. Induction of protective anti - tumor immunity by gene - modified dendritic cells. J Immunother. 1998;21:41 – 47. 10. Fields RC, Shimizu K, Mule JJ. Murine dendritic cells pulsed with whole tumor lysates mediate potent antitumor immune responses in vitro and in vivo. Proc Natl Acad Sci USA. 1998; 95:9482 – 9487. 11. Sonderbye L, Feng S, Yacoubian S, et al. In vivo and in vitro modulation of immune stimulatory capacity of primary dendritic cells by adenovirus - mediated gene transduction. Exp Clin Immunogenet. 1998;15:100 – 111. 12. Kim CJ, Prevette T, Cormier J, et al. Dendritic cells infected with poxviruses encoding mart - 1 / melan a sensitize T lymphocytes in vitro. J Immunother. 1997;20:276 – 286. 13. Peshwa MV, Shi JD, Ruegg C, Laus R, Van Schooten WC. Induction of prostate tumor - specific CD8 + cytotoxic

956


T- lymphocytes in vitro using antigen - presenting cells pulsed with prostatic acid phosphatase peptide. Prostate. 1998;36: 129 – 138. 14. Dematos P, Abdel - Wahab Z, Vervaert C, Hester D, Seigler H. Pulsing of dendritic cells with cell lysates from either B16 melanoma or MCA - 106 fibrosarcoma yields equally effective vaccines against b16 tumors in mice. J Surg Oncol. 1998;74:79 – 91. 15. Nair SK, Boczkowski D, Morse M, Cumming RI, Lyerly HK, Gilboa E. Induction of primary carcinoembryonic antigen ( CEA )- specific cytotoxic T lymphocytes in vitro using human dendritic cells transfected with RNA. Nature Biotechnology. 1998;16:364 – 369. 16. Tjandrawan T, Martin DM, Maeurer MJ, et al. Autologous human dendriphages pulsed with synthetic or natural tumor peptides elicit tumor - specific CTLs in vitro. J Immunother. 1998;21:149 – 157. 17. Barratt - Boyes SM, Kao H, Finn OJ. Chimpanzee dendritic cells derived in vitro from blood monocytes and pulsed with antigen elicit specific immune responses in vivo. J Immunother. 1998;21:142 – 148. 18. Tuting T, Wilson CC, Martin DM, et al. Autologous human monocyte – derived dendritic cells genetically modified to express melanoma antigens elicit primary cytotoxic T cell responses in vitro: enhancement by cotransfection of genes encoding the Th1 - biasing cytokines IL - 12 and TFN - alpha. J Imm. 1998;160:1139 – 1147. 19. De Bruijn ML, Schuurhuis DH, Vierboom MP, et al. Immunization with human papillomavirus type 16 ( HPV16 ) oncoprotein - loaded dendritic cells as well as protein in adjuvant induces MHC class I – restricted protection to HPV16 - induced tumor cells. Can Res. 1998;58:724 – 731. 20. Tsai V, Kawashima I, Keogh E, Daly K, Sette A, Celis E. In vitro immunization and expansion of antigen - specific cytotoxic T lymphocytes for adoptive immunotherapy using peptide - pulsed dendritic cells. Crit Rev Immunol. 1998;18: 65 – 75. 21. Wong C, Morse M, Nair SK. Induction of primary, human antigen - specific cytotoxic T lymphocytes in vitro using dendritic cells pulsed with peptides. J Immunol. 1998;21: 32 – 40. 22. Alters SE, Gadea JR, Sorich M, O’Donoghue G, Talib S, Philip R. Dendritic cells pulsed with CEA peptide induce CEA specific CTL with restricted TCR repertoire. J Immunol. 1998;21:17 – 26. 23. Navabi H, Jasani B, Adams M, et al. Generation of in vitro autologous human cytotoxic T- cell response to E7 and her - 2 / neu oncogene products using ex - vivo peptide loaded dendritic cells. Adv Exp Med Biol. 1997;417:583 – 589. 24. Specht JM, Wang G, Do MT, et al. Dendritic cells retrovirally transduced with a model antigen gene are therapeutically effective against established pulmonary metastases. J Exp Med. 1997;186:1213 – 1221. 25. Toujas L, Delcros JG, Diez E, et al. Human monocyte - derived macrophages and dendritic cells are comparably effective in vitro in presenting HLA Class I – restricted exogenous peptides. Immunology. 1997;91:635 – 642. 26. Brossart P, Goldrath AW, Butz EA, Martin S, Bevan MJ. Virus - mediated delivery of antigenic epitopes into dendritic cells as a means to induce CTL. J Immunol. 1997;158: 3270 – 3276. 27. Tsai V, Southwood S, Sidney J, et al. Identification of subdominant CTL epitopes of the gp100 melanoma associated tumor antigen by primary in vitro immunization with peptide -pulsed dendritic cells. J Immunol. 1997; 158:1796 – 1802.

28. Hermans IF, Daish A, Moroni - Rawson P, Ronchese F. Tumor peptide – pulsed dendritic cells isolated from spleen or cultured in vitro from bone marrow precursors can provide protection against tumor challenge. Can Immunol, Immunother. 1997; 44:341 – 347. 29. Reeves ME, Royal RE, Lam JS, Rosenberg SA, Hwu P. Retroviral transduction of human dendritic cells with a tumor associated antigen gene. Can J Res. 1996;56:5672 – 5677. 30. Smith CA, Woodruff LS, Kitchingman GR, Rooney CM Adenovirus - pulsed dendritic cells stimulate human virus specific T- cell responses in vitro. J Virol. 1996;70:6733 – 6740. 31. Van Elsas A, Van der Burg SH, van der Minne CE, et al. Peptide - pulsed dendritic cells induce tumoricidal cytotoxic T lymphocytes from healthy donors against stably HLA A0201 – binding peptides from the melan - a / mart - 1 self antigen. Eur J Immunol. 1996;26:1683 – 1689. 32. Bianchi R, Grohmann U, Belladonna ML, et al. IL - 12 is both required and sufficient for initiating T cell reactivity to a class I – restricted tumor peptide ( p815ab ) following transfer of p815ab - pulsed dendritic cells. J Immunol. 1996;157:1589 – 1597. 33. Mjaaland S, Fossum S. Dendritic leucocytes pulsed with monoclonal antibody – hapten conjugates elicit vigorous primary humoral responses in vivo. Scand J Immunol. 1995; 41:305 – 308. 34. Santin AD, Hermonat PL, Ravaggi A, et al. Generation of an MHC class I restricted cytotoxic T cell response against autologous cervical cancer tumor cells by lipofection of synthetic human papillomavirus types 16 and 18 E7 protein into primary dendritic cells. J Virol. 1999;73:5402 – 5410. 35. Santin AD, Hermonat PL, Ravaggi A, et al. Development, characterization, and distribution of adoptively transferred peripheral blood lymphocytes primed by human papillomavirus E7. Eur J Gynaecol Oncol. 2000;21:17 – 23. 36. Smotkin D, Wettstein FO. The major human papillomavirus protein in cervical cancers is a cytoplasmic phosphoprotein. J Virol. 1987;61:1686 – 1689. 37. Liu Y, Santin AD, Mane M, et al. Transduction and utility of the granulocyte macrophage – colony stimulating factor gene into monocytes and dendritic cells by adeno - associated virus. J Interferon Cytokine Res. 2000;20:21 – 30. 38. Hermonat PL, Muzyczka N. Use of adeno - associated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells. Proc Natl Acad Sci USA. 1984;81:6466 – 6470. 39. Laface D, Hermonat PL, Wakeland EK, Peck AB. Gene transfer into hematopoietic progenitor cells mediated by an adeno - associated virus vector. Virology. 1988;162:483 – 486. 40. Zhou SZ, Broxmeyer HE, Cooper S, Harrington MA, Srivastava A. Adeno - associated virus 2 – mediated gene transfer in murine hematopoietic progenitor cells. Exp Hematol. 1993;21:928 – 933. 41. Zhou SZ, Cooper S, Kang LY, et al. Adeno - associated virus 2 – mediated high efficiency gene transfer into immature and mature subsets of hematopoietic progenitor cells in human umbilical cord blood. J Exp Med. 1994;179:1867 – 1875. 42. Goodman S, Xiao X, Donahue RE, et al. Recombinant adeno associated virus – mediated gene transfer into hematopoietic progenitor cells. Blood. 1994;84:1492 – 1500. 43. Podsakoff G, Wong KK Jr, Chatterjee S. Efficient gene transfer into nondividing cells by adeno - associated virus – based vectors. J Virol. 1994;74:5656 – 5666. 44. Chiorini JA, Wendtner CM, Urcelay E, Safer B, Hallek M, Kotin RM. High - efficiency transfer of the T cell co stimulatory molecule B7 - 2 to lymphoid cells using high - titer



recombinant adeno - associated virus vectors. Hum Gene Ther. 1995;6:1531 – 1541. 45. Lubovy M, McCune S, Dong JY, Prchal JF, Townes TM, Prchal JT. Stable transduction of recombinant adeno - associated virus into hematopoietic stem cells from normal and sickle cell patients. Biol Blood Marrow Transplant. 1996; 2:24 – 30. 46. Fisher - Adams G, Wong KK Jr, Podsakoff G, Forman SJ, Chatterjee S. Integration of adeno - associated virus vectors in CD34 + human hematopoietic progenitor cells after transduction. Blood. 1996;88:492 – 504. 47. Ponnazhagan S, Mukherjee P, Wang XS, et al. Adeno associated virus type 2 – mediated transduction in primary human bone marrow – derived Cd34 + hematopoietic progenitor cells: donor variation and correlation of transgene expression with cellular differentiation. J Virol. 1997;71: 8262 – 8267. 48. Ponnazhagan S, Yoder MC, Srivastava A. Adeno - associated virus type 2 – mediated transduction of murine hematopoietic cells with long - term repopulating ability and sustained expression of a human globin gene in vivo. J Virol. 1997;71:3098 – 3104. 49. Hermonat PL, Quirk JG, Bishop BM, Han L. Packaging capacity of adeno - associated virus and the potential for wild type - plus AAV gene therapy vectors. FEBS Lett. 1997;407: 78 – 84. 50. Auricchio A, Hildinger M, O’Connor E, Gao G - P, Wilson JM. Isolation of highly infectious and pure adeno - associated virus type 2 vectors with a single - step gravity - flow column. Hum Gene Ther. 2001;12:71 – 76. 51. Pala P, Verhoef A, Lamb JR, Openshaw PJ. Single cell analysis of cytokine expression kinetics by human CD4 + T- cell clones during activation or tolerance induction. Immunology. 2000;100:209 – 216. 52. Bennet SRM, Carbone FR, Karamalis F, Miller JFAP, Health


957

WR. Induction of CD8 + cytotoxic T lymphocyte response by cross - priming requires cognate CD4 + T cell help. J Exp Med. 1997;186:65 – 70. 53. Clerici M, Shearer GM, Clerici E. Cytokine dysregulation in invasive cervical carcinoma and other human neoplasias: time to consider the Th1 / Th2 paradigm. J Natl Can Inst. 1997;90:261 – 263. 54. Nitta T, Yagita H, Sato K, Okumura K. Involvement of CD56 ( NKh - 1 / leu - 19 antigen ) as an adhesion molecule in natural killer – target cell interaction. J Exp Med. 1989; 170:1757 – 1761. 55. Hilders CGJM, Ras L, van Eendenburg JDH, Nooyen Y, Fleuoren GJ. Isolation and characterization of tumor - infiltrating lymphocytes from cervical cancer. Int J Cancer. 1994;57:805 – 813. 56. Nonacs R, Humborg C, Tam JP, Steiman RM. Mechanisms of mouse spleen dendritic cell function in the generation of influenza - specific cytolytic T lymphocytes. J Exp Med. 1992;176:519 – 529. 57. Hoggan MD, Thomas G, Johnson FB. Continuous carriage of adenovirus associated virus genome in cell culture in the absence of helper adenovirus. In Proceedings of the Fourth Lepetite Colloquium, Cocoyac, Mexico. Amsterdam: North Holland; 1972, pp. 243 – 249. 58. Cheung AKM, Hoggan MD, Hauswirth WW, Berns KI. Integration of the adeno - associated virus genome into cellular DNA in latently infected human Detroit 6 cells. J Virol. 1980;33;739 – 746. 59. Laughlin CA, Cardellichio CB, Coon HC. Latent infection of kb cells with adeno - associated virus type 2. J Virol. 1986;60: 515 – 522. 60. Masten BJ, Yates JL, Pollard Koga AM, Lipscomb ME Characterization of accessory molecules in murine lung dendritic cell function: roles of CD80, CD86, CD54, and CD40L. Am J Respir Cell Mol Biol. 1997;16:335 – 342.