Rapid Molecular Epidemiology of Human Immunodeficiency Virus ...

AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 11, Number 9, 1995 Mary Ann Liebert, Inc.

Rapid Molecular Epidemiology

of Human Virus Transmission

ERIC L.

DELWART,1

Immunodeficiency

MICHAEL P. BUSCH,2 MARCIA L. KALISH,3 JAMES W. and JAMES I. MULLINS5

MOSLEY,4

ABSTRACT Close sequence homology between strains of 111V -1 have been used to corroborate cases of epidemiologically identified transmission. As an alternative to extensive DNA sequence analysis, genetic relateness between pairs of HIV quasispecies was estimated using the reduced electrophoretic mobilities of HTV-1 envelope DNA heteroduplexes through polyacrylamide gels. All six infections acquired in a dental practice in the late 1980s and four of six infections acquired through blood product transfusions and sexual contact in 1984-1985 could be rapidly identified. A rising level of genetic diversity within HTV-1 subtype B facilitated the detection of later transmission events. Transmission linkages could be detected up to 4 years following infection. The simple and rapid technique of DNA heteroduplex tracking can therefore assist epidemiological investigations of HIV transmission and potentially of other genetically variable infectious agents.

INTRODUCTION

Molecular

ants is replaced ants 16,22-24

corroboration of HTV-1 transmission has relied the documentation of close genetic homology between viral strains. Such studies have largely taken the form of DNA sequence analysis of short segments of the env gene, a highly variable region of the HTV genome1-11 as well as of gag and pol genes.10-13 Because of its high mutation rate and strong selection for the emergence of phenotypic variants, the HIV env gene evolves rapidly through nonsynonymous nucleotide substitutions and short in-frame insertions and deletions.14-16 Such mutations can radically alter the properties of the virus and, together with silent, synonymous nucleotide substitutions, provide the genetic variation used for phylogenetic analysis and molecular epidemiological investigations. Soon after primary infection, a typically genetically homogeneous virus population is detected in peripheral blood mononuclear cells (PBMC).7,17-20 At variable times after infection, genetic changes lead to the formation of a diversified viral population often referred to as a quasispecies.5,21 Over time, HIV quasispecies also change, as one set of varion

by other, presumably fitter,

sets of vari-

The study of HIV variation for epidemiological purposes is therefore complicated by the quasispecies nature of HIV, which may necessitate that multiple genomes be sequenced to sample the range of genetic variants found in vivo. Rapidly evolving quasispecies also require that sequence variants be compared as soon as possible after a transmission, before further sequence changes obscure their recent common origin.25,26 Further complicating transmission studies is the level of genetic variation between epidemiologically unrelated HIV-1 strains, which can vary widely within different geographic areas, depending on the number of strains initiating local infection, and the subsequent length of time the virus has been diversifying.27-30 For this reason multiple local controls need to be analyzed to ensure that a high degree of homology between suspected donor and recipient viruses is the likely result of direct virus transmission9,26 rather than simply the reflection of a relatively homogeneous virus pool in the local community.

Heteroduplex tracking analysis (HTA)28,31 using samples

from epidemiologically identified

cases

of HIV-1 transmission

'Aaron Diamond AIDS Research Center, New York University School of Medicine, New York, New York 10016.

2Department of Laboratory Medicine, University of California at San Francisco, and Irwin Memorial Blood Centers, San Francisco, California

94118-4496.

'Division of HIV/AIDS, National Center for Infectious Diseases, Centers for Disease Control

and

Prevention, Atlanta, Georgia 30033.

"•Department of Medicine, School of Medicine, University of Southern California, Los Angeles, California 90032. department of Microbiology and Medicine, University of Washington at Seattle, Seattle, Washington 98195. 1081

1082

DEL WART ET AL.

is evaluated here as a simple, rapid, and inexpensive alternative or complement to DNA sequence analysis for establishing transmission linkage. Envelope gene DNA fragments are generated from proviral genomes in uncultured PBMC by nested polymerase chain reactions (PCR). Tracer amounts of radioactively labeled fragments from possible infection sources are denatured and reannealed with a large excess of complementary DNA from potential HIV recipients to form heteroduplexes. The electrophoretic mobilities of the radioactive heteroduplexes through polyacrylamide gels, being largely proportional to the degree of complementarity between the reannealed DNA strands, provides an estimate of the degree of homology between the HIV-1 quasispecies.

MATERIALS AND METHODS DNA preparation, PCR amplification, and gel electrophoresis conditions

radiolabeling

PBMC were isolated by Ficoll-Hypaque density gradient centrifugation, and the DNA was extracted using the IsoQuick isolation kit (MicroProbe Corp., Garden Grove, CA) or a standard phenol extraction method.9 DNA was also extracted from uncultured, cryopreserved buffy coat PBMC.32 PCR employed a nested series of reactions, with 2 pi of the first reaction product added to a second round of PCR with internally annealing primers. First-round primers were ED3 (5' TTAGGCATCTCCTATGGCAGGAAGAAGCGG corresponding to positions 5956-5985 of the HXB2CG genome, Genbank accession number K03455) and ED 12 (AGTGCTTCCTGCTGCTCCCAAGAACCCAAG corresponding to the complement of positions 7822-7792). Second-round primers were ES7 (5'-TG-

TAAAACGACGGCCAGT-CTGTTAAATGGCAGTCTAGC,

corresponding to the complement of the M13 forward-sequencing primer followed by positions 7001-7020) and ES8 (5'-CAGGAAACAGCTATGACCCACTTCTCCAATTGTCCCTCA, corresponding to the complement of the M13 reversesequencing primer followed by the complement of positions 7667-7647). Primers ES7-ES8 yielded a product of approximately 700 bp, of which about 627 bp were target dependent (the exact size depending on the number of deletions and insertions within the target HIV-1 molecule). Alternative secondround primers ED31 (5'-CCTCAGTCATTACACAGGCCTGTCCAAAG at 6816-6844) and ED33 (5'-TTACAGTAGAAAAATTCCCCTC, corresponding to the complement of positions 7359-7380) amplified a 564-bp fragment spanning the C2-C3 domains, of which about 515 bp were target dependent. Each PCR reaction employed variable amounts of template DNA (0.5 pg when the DNA concentration was determinable by ^260 or 4 pi when the DNA concentration was unknown) in 1.4 mM

(ED3-ED12, ED31-ED33)

or

1.8 mM

(ES7-ES8)

MgCl2, 20 pmol of each primer in 50 mM KC1, 10 mM TrisHC1 pH 8.3, 200 pM of each dNTP, 2.5 units of Taq DNA polymerase (Perkin-Elmer Cetus, Emeryville, CA), and 10% glycerol in a final volume of 50 pi. PCR products were radiolabeled by the addition of 10 pCi of [32P]TTP (3000 Ci/mmol) in a total of 30 pM of each dNTP in the second round of nested PCR. Amplifications were carried out in a Perkin-Elmer thermocycler for 35 cycles by using 1-sec ramp times between steps

of 94°C for 1 min, 55°C for 45 sec, and 72°C for 1 min. A 5 min 72°C extension step was linked to the last cycle.

Heteroduplex formation (HMA

and

HTA) first analyzed

for DNA Second-round PCR reactions were horizontal 0.8% agarose amplification product by gel electrophoresis in TBE buffer at 100 V for 1 hr followed by ethidium bromide staining for UV illumination and photography. Using a 10X DNA annealing solution stock, the PCR reaction was then adjusted to 0.1 M NaCl, 10 mM Tris-HCl, pH 7.8, and 2 mM EDTA. Heteroduplex formation was maximized by denaturing 5pi of the second round PCR products at 94CC for 2 min before cooling rapidly in wet ice. Heteroduplexes were then resolved in a 5% polyacrylamide gel as described below in a heteroduplex mobility assay (HMA).28,31 For radioactive heteroduplex tracking analysis (HTA),28,31 1 pi of radioactive probe DNA (prepared by diluting a fraction of the radiolabeled PCR reaction 20-fold in 6X annealing buffer) was combined with 5 pi of unlabeled second-round target DNA [for a final 1 to 100 probe (tracer):target (driver) ratio]. DNA mixtures were then denatured and reannealed on wet ice as described above. The ES7-ES8-amplified, 700-bp DNA heteroduplexes were resolved on 5% polyacrylamide gels (30:0.8 acrylamide:bis) in IX Tris-borate-EDTA buffer (TBE) (0.088 M Tris-borate, 0.089 M boric acid, 0.002 M EDTA) in a model V16 vertical gel apparatus (GibcoBRL, Gaithersburg, MD) using 1.5-mmthick spacers at 250 V for 3 hr. The ED31-ED33-amplified, 564-bp DNA heteroduplexes were resolved on a 6% polyacrylamide gel that included 15% urea in 1X TBE, and run at 250 V for 2.5 hr.

Auto radiography Radioactive

heteroduplexes were detected by drying the polyacrylamide gels onto Whattman 3MM paper under vacuum and exposing on a Phosphor screen (Molecular Dynamics, Sunnyvale, CA) for 1-5 days. Signals were visualized by scanning the Phospor screen in a Phosphorlmager (Molecular Dynamics, Sunnyvale, CA). Digitized signal images were then transferred to an Apple Macintosh computer and prepared for display using the Photoshop (Adobe Systems Inc, Mountain View, CA) and Canvas (Deneba Systems Inc, Miami, FL) image processing programs.

Samples

and sequence

analysis

Samples in lanes numbered 1 through 69 in the figures were collected in southern Florida in 1990 and 1991 from persons with CDC individual ID numbers 4429,4993,5047,5049,5051, 5055, 5057, 5061, 5240, 5248, 5252, 5254, 5258, 5262, 5264, 5266, 5270, 5272, 5274, 5280, 5294, 5298, 5302, 5304, 5306, 5358, 5360, 5364, 5366, 5372, 5374, 5382, 5390, 5593, 5607, 5826, 6757, 7227, 7375, 7954, 10516, 10833, 10837, 12424, 12426, 12428, 12430, 12515, 12520, 12522, 12524, 12526, 12528, 12530, 12532, 12534, 12536, 12538, 12540, 12542, 12546, 15791, 15792, 15794, 16635, 5787, 8594, 16561, and 17164 as annotated in Genbank submissions. Only the two dentists' samples were originally identified as potential index cases. HIV sequences in samples collected in the mid-1980s to early 1990s from San Francisco and Amsterdam and from patient B

MOLECULAR EPIDEMIOLOGY OF HIV TRANSMISSION determined by direct sequencing of nested PCR molecuend-point dilution products as previously described.31,33 Samples from San Francisco were collected by the San Francisco Men's Health Study (SFMHS). The sequences submitted to Genbank are labeled with year of collection, place of origin (NE, Amsterdam, the Netherlands; US, San Francisco, USA), and patient and clone number: 86NE537-1, 85NE594-6, were

lar

85NE672-9, 87NE1058-1, 85US074-6, 86US107-6, 84US3066, 84US333-6, 85US349-6, 85US441-6, 84US550, 85US72512, 85US419-4, and 87US552-7. In Figure 5 these samples are labeled 101-114. Similarly acquired sequences were also determined from samples obtained 4.5-6.5 years postinfection from some of the same individuals: 91NE537-3 to 91NE537-

7, 92NE1058-3

to 92NE1058-7, 90US074-1 to 90US074-8, 90US306-1 to 90US306-8, and 90US349-1 to 90US349-8. Samples from infected blood donors, their blood product recipients, and the infected sexual partner were collected by the

Transfusion Safety Study Group (TSSG). HIV sequences from blood product donor (M) and recipients (N and O) were determined from plasmid subclones of PCR products derived by second-round amplification using ES7-ES8 primers modified at the 5' ends to include CAUCAUCAUCAU for use with the

CloneAmp system (GibcoBRL, Gaithersburg, MD). Sequence alignments were performed using the MASE program.34 Alignments were stripped of regions containing unaligned bases due to nucleotide insertions and deletions (including unalignable flanking nucleotide positions) in the V4 and V5 domains. The PHYLIP 3.5 package was used for phylogenetic analysis.35 A distance matrix was generated using the generalized maximum-likelihood method in the DNADIST program.36

Neighbor-joining using the NEIGHBOR program37 was then used to construct a phylogenetic tree from the distance matrix. The program SEQBOOT was used to generate 100 bootstrapped dataseis. The 270-bp V3 region used to determine percentage DNA differences using the program DOTS38 included nucleotide positions 7049 to 7320. The local controls from the Florida sample set used to determine percentage sequence differences over the 270-bp V3 region were from individuals with CDC ID numbers 5240, 5298, 5294, 5302, 5382, 5047, 5049,

5051, 5390, 5057, 5061, 5248, 5252, 5254, 5258, 5262, 5264, 5266, 5270, 5272, 5274, 5280, 5306, 5358, 5360, 5364, 5366, 5372, 5374, and 5304 corresponding to local controls (LC) 1, 4, 6-14, 17-27, 29-35, and 37 in Ou et al.9 Genbank accession numbers

are

U23651-U23708 and U22826-U22828.

RESULTS

Analysis of possible HIV transmission dental practices

in two

DNA fragments (700 bp) spanning the V3 through V5 domains of the HIV-1 envelope gene were PCR amplified from proviruses in two dentists and infected individuals from their clinical practices and local communities. A nested PCR DNA protocol yielded correct size amplification products as determined by agarose gel electrophoresis in 69 out of 74 coded, uncultured PBMC DNA samples collected in Florida in 1990 and 1991 (patient I sample was collected in 1993) (data not shown). The extent of genetic variability within these amplified quasi-

1083

species was first estimated by DNA heteroduplex mobility analysis (HMA). The PCR products were separated by electrophoresis on 5% polyacrylamide gels and then stained with ethidium bromide (Fig. 1A). As previously reported28,31 the presence of bands with reduced electrophoretic mobility (e.g., samples 5 and 6) indicated the simultaneous amplification of multiple sequence variants. The detection of a single ethidium bromide-stained DNA band on the polyacrylamide gel (e.g., samples 8 and 10) indicated either that only a single molecule of proviral DNA was amplified or that multiple but highly related HIV variants (less than 1-2% substitutions without any nucleotide insertions or deletions) were coamplified.28,31 The amplification of multiple variants from a sample of proviruses allows their simultaneous comparisons to the variants amplified from the dentists' samples. Amplified HIV env DNA from dentist 1, consisting of a least two variant populations (Fig. 1A, sample 2), was radiolabeled and used as probe (tracer) when reannealed with a 100-fold excess of HTV target DNA (driver) from dentist 1, 10 infected patients from his dental practice, and 57 other HIV-positive individuals from the same geographic region (Southern Florida). The electrophoretic mobility of the resulting heteroduplexes was then determined by polyacrylamide gel electrophoresis followed by autoradiography in a heteroduplex tracking assay (HTA) (Fig. IB).28,31 Five target samples formed heteroduplexes whose electrophoretic mobilities approached that of the homoduplex seen when viral sequences from dentist 1 was used as target (Fig. IB, lane 2). When the sample code was broken, the viruses in these five samples (A, C, E, G, and I) were found to be from indivduals previously shown by DNA sequence analysis to have viruses closely related to that of their dentist.9,25,39-41 Samples from four other patients of dentist 1 (D, F, H, and J), all of which had histories of high-risk behavior and HIV-1 strains not closely linked to the dentist's strain,9,25,40,41 also did not appear to be linked to dentist 1 by the current assay. Similarly, none of the viruses from 31 previously analyzed local controls (samples 3-33),9,25,39"41 24 HIV-positive patients of dentist 2, a sexual partner of one of these patients, or from dentist 2 (samples 41-65), formed rapidly migrating heteroduplexes with viral DNA from dentist 1. When the same sample set was similarly probed with DNA sequences from dentist 2 (sample 40) none of the resulting heteroduplexes migrated near the homoduplex (Fig. 1C, lane 40). The absence of close homologies between sequences in dentist 2 and any of his infected patients (samples 41-65) was also documented by DNA sequence analysis.42 To further establish the frequency of false-positive linkages by HTA, the V3-V5 fragments from two epidemiologically unrelated virus isolates (SF2 and MN) and two of the local controls (samples 21, 22) were used as probes. As with the dentist 2 probe, none of the more than 200 pair-wise strain comparisons performed showed evidence of close genetic linkage through the formation of rapidly migrating heteroduplexes (data not shown). The extent of the DNA heteroduplex mobility retardation observed also indicated, as previously shown by DNA sequence analysis, that the Southern Florida samples analyzed all belonged to HIV-1 envelope sequence subtype b.9,28,42-44 Linkage of viral sequences from dentist 1 and patient B, clearly demonstrated by DNA sequence analysis,9,25,40,41 was

1084

DELWART ET AL. BCDEFG» 7 8 9 10111213141516171819202122

23 24 25 26 27 28 29 30 3132 33 3135 36 37 38 39 40 4112 43 44

iilJi.li^.i

i 2

•«

>>zzz

CM CM M *"

agents.50-53 Non-DNA semethods to evaluate epidemiohave also been used quencing logical linkages of infections.54-60 Here a simple and rapid method for evaluating possible linkages based on DNA heteroduplex mobilities was evaluated using HIV strains from well-documented cases of virus transmission. Using coded samples from potential recipients, HTA identified all six epidemiologically linked, and DNA sequence analysis confirmed,9,25,40,41 cases of HIV-1 transmission that occurred in a dental practice. When virus samples from another dental practice were similarly analyzed, no evidence for virus transmission was detected from that dentist to any his 24 HIV1-infected patients analyzed. Similar results were obtained by DNA sequencing and phylogenetic analysis.42 HTA also confirmed two of four transfusion-associated infections that occurred in 1984-1985 and the one sexually transmitted infection tested. In some cases HIV-1-infected samples from linked individuals separated by as much as 70 months of divergent evolution could also be linked by this analysis (Fig. 6, X-22 to P48 transmission). To corroborate HTV transmission by genetic analysis it is helpful to document a significantly higher level of sequence homology among a suspected transmission pair/cluster than with HIV-11,2,4-13,49 and other infectious

^w

spl f**

^^ ^^ ÜW

N.23

N.66

V.55

Ws •*• — ro ro vO lA * N n * (O

Ws •*" — ro fO sO WS *• CM (M $• »o

Ws •*•

> > > Z Z Z

>>>zzz

> > > Z Z Z

•ffWt

r) ro iß in* N n t ^ -

'If"'

Tracking viral quasispecies changes over time in infected blood donors and their blood products recipients. HTA of proviral sequences in serially acquired PBMC samples using the 700-bp V3-V5 fragment. Numbers next to each letter indicates the number of months posttransfusion that the sample was collected. The arrow indicates the direction of transmission. See legends to Figures 1 and 2 for explanations of common bands and symbols. FIG. 6.

MOLECULAR EPIDEMIOLOGY OF HIV TRANSMISSION unlinked local viral strains.27-29,61,62 Because HTA can rapidly evaluate the extent of local HIV genetic diversity through analysis of large numbers of samples, it can expedite molecular investigations of HTV transmission. It does remain possible that epidemiologically unlinked HTV vari-

epidemiologically

found in a local community that are genetically to linked transmission variants as a result of rerelated closely cent common ancestry through indirect sexual or parenteral contacts. This possibility emphasizes the need for phylogenetic ants can be

analysis to be evaluated in the context of strong classic epidemiological investigations for establishing transmission link-

ages. DNA

fragments spanning different regions of the env gene linkage analysis by HTA. While no particular env region was consistently better at detecting all transmission linkages tested, a few general rules could nonetheless be gleaned. When a longer fragment (V3-V5) was used, most related strains could be easily identified without false positives. No case of unsuspected linkage was seen using the V3-V5 fragment in more than 320 pairwise comparisons; thus while this fragment may occasionally miss a transmission event such as that from dentist 1 to patient B and from donor W to recipients M and O (low sensitivity), false positives are likely to be rare (high specificity). The problem of high mobility retardation caused by large or numerous insertions or deletions between otherwise highly related sequences could be circumvented by using a smaller region (C2-C3) that is relatively free of length variation and thus has a higher level of sensitivity. However, because of the low specificity of the C2-C3 fragment it was not informative within a community with a low level of HIV-1 genetic divergence such as was present in the United States in the mid 1980s (Figs. 4 and 5). Its utility is likely to grow as the virus population diversifies further with time. Even in a highly differentiated viral sequence background, local controls are still required for HTA to ensure that a consensus like variant (e.g., Fig. 5B, sample 19) is not being analyzed when the C2-C3 fragment is used as probe. Genetic linkage could not be detected by HTA between a sequence variant from donor W and proviral sequences from two recipients (M and O) of his infected blood products. Sequence analysis of the amplified variants confirmed the epidemiological linkage between these strains and, as for the dentist 1/patient B pairs, indicated the presence of substantial length variation between the aligned nucleotide sequences. Previous DNA heteroduplex analyses28,31 have shown that estimated genetic distances between the most divergent sequence variants within long-term infected individuals can reach those seen between

can

be used for

virus from unlinked infections. Similar conclusions can also be reached from DNA sequence analysis63 and demonstrate the continuum of sequence divergence within an HTV subtype. Because of low PBMC DNA yield, only a single variant was amplified from the donor W quasispecies collected more than 2 years after transmission; it is therefore possible that variants only distantly related to the one amplified W variant were transmitted to M and O. This is possible if donor W harbored a highly genetically differentiated quasispecies. Under the conditions used HTA can detect particular variants present at 1-2% levels in reconstituted DNA mixtures (data

1089

not shown), therefore allowing multiple sequences in target quasispecies to be simultaneously probed. For this high level of detection to be reached in practice it is necessary to document an

input number of approximately 100 proviruses into the first round of the nested PCR reaction. If only samples with low proviral load are available it is possible to pool the DNA from multiple independent nested PCR reactions prior to HTA probing.31 In this study the proviral DNA copy number amplified from each sample was not determined and, as can be seen by HMA, a single major variant was amplified from many samples (Fig. 1A). Thus, although it is preferable to probe a large number of different sequence variants when analyzing quasispecies by HTA, limited sample availability may prevent this. Nevertheless, the absence of false-positive linkage using a large panel of local controls and the detection of the expected epidemiological linkages validate the utility of comparing only a subset of all the variants likely present within individuals years following infection. Sampling error resulting from the PCR amplifications of a low proviral copy number may become more important when monitoring changes in complex quasispecies over time. Clearance of a particular variant highly related to an HTA probe can only be confidently stated as a drop in frequency to below the current detection limit of the assay (1-2%). For this reason, the apparent clearance of the N-23-like variant in the N-66 sample may simply reflect amplification of a low provirus copy number and the failure to sample a N-23-like variant 66 month postinfection. Therefore, it is possible that had more N-66 proviruses been amplified, linkage with donor V may have been detected beyond 43 months. Proviral DNA rather than viral RNA sequence divergence was estimated in this study. Multiple reports have documented the delayed appearance of variants in PBMC DNA relative to the viral RNA population.15,64-66 Since quasispecies diversification in vivo can eventually obscur the common origin of viruses in donor-recipient pairs (Fig. 6),25 comparing DNA sequences may allow epidemiological linkages to be established over longer periods of time than would be possible analyzing the more dynamic virion RNA populations. The distribution of proviral sequence variants present in semen67 or vaginal fluids can differ from that found in the blood, and therefore viruses may be transmitted that are rare in PBMC. Epidemiological linkage may therefore be clearer using HIV variants derived from genital secretions. An increase in genetic diversity within the US/European subtype B virus population was seen by both heteroduplex and DNA sequence analyses. A similar rise in genetic diversity over time was also reported using the V3 loop sequences of samples collected throughout the 1980s from 74 sero-converters in Amsterdam.68 The earliest HIV-seropositive serum samples in San Francisco were collected in 1978, and the peak years of seroconversion there have been retrospectively determined to be 1981-1983.69,70 Therefore it is possible that in the mid-1980s, most HIV-1 strains in the United States and Europe had been diverging in a limited number of sources for only 3-7 years, resulting from a founder effect situation similar to that currently seen with the high level of sequence homology of subtypes B and E in Thailand, C in India, and F in Romania.27-30,61 As was observed with the C2-C3 fragment (Fig. 4), a low level of vi-

1090

DELWART ET AL.

ral diversity early in an epidemic complicated the use of genetic analysis for epidemiological purposes; however, the inexorable rise of HIV genetic diversity over time should increase the reliability of different methods of genetic analysis to cor-

roborate cases of HIV transmission.26 HTA was also used here to compare the degree of divergence of selected HIV-1 strains to a large panel of unrelated variants. Heteroduplexes between HIV DNA from dentist 1 and epidemiologically unrelated individuals generally showed less mobility retardation than those between dentist 2 and the same local controls (compare heteroduplex bands in Figure IB and C) indicating that viral sequences from dentist 2 were gener-

ally more divergent from the local controls than were those from dentist 1. This conclusion was also supported by DNA sequences available over a smaller env region. Using HTA to estimate genetic distances between epidemiologically unlinked strains may therefore assist in determining whether strains to be used in candidate vaccine formulations are consensus-like 5B sample 19) or genetic outliers (i.e., Fig. 5B dentist 2 and sample 13) in their degree of genetic relatedness to large numbers of strains likely to be encountered by vaccinées. Identification of the HIV-1 subtypes predominant in various countries is underway using DNA heteroduplex mobility analysis.27,28,43,71-73 The level of genetic diversity found within these subtypes could be determined by HTA analyses similar to those described here. Although the major means of HIV transmission are well documented, there may be instances in which a potential source or mode of infection needs to be confirmed or excluded. While extensive DNA sequence analysis remains the gold standard for

(i.e., Fig.

epidemiological investigations, heteroduplex tracking analysis, ability to detect individual variants within a quaas sispecies31 well as its simplicity, speed, and low cost, may also assist in investigations of possible HIV-1 superinfection, dual infections,74 contaminated blood-product transfusions,75,76 or laboratory contaminations.49,77,78 Different tissues,79,80 components of genital secretions,81,82 or cell types may also be used to derive HIV sequence variants for comparison to the transmitted variants in studies of perinatal and sexual transmission. Similar methodologies should be readily applicable for molecular epidemiological investigations of other highly variable infectious agents such as SIV, human papillomaviruses, and hepbecause of its

Molecular and Genetic Medicine. E.L.D. was supported by NRSA fellowship AI07328 and by a grant from the Stanford Center for AIDS Research (NOl AI82515). Collection of blood product donor and recipient samples was supported by Grants NO1-HB-37002, 37003, and 97074.

REFERENCES 1. CDC: HIV infection in two brothers receiving intravenous therapy for hemophilia. Morbid Mortal Weekly Rep 1992;41:228-231. 2. CDC: HIV transmission between two adolescent brothers with hemophilia. Morbid Mortal Weekly Rep 1993;42:948-951. 3. Holmes EC, Zhang LQ, Simmonds P, Rogers AS, and Leigh Brown AJ: Molecular investigation of human immunodeficiency virus (HTV) infection in a patient of an HIV-infected surgeon. J Infect Dis 1993;167:1411-1414. 4. Zhang LQ, Simmonds P, Ludlam CA, and Leigh Brown AJ: Detection, quantification and sequencing of HIV-1 from the plasma of seropositive individuals and from factor VIII concentrates. AIDS

1991;5:675-681. 5. Balfe P, Simmonds P, Ludlam CA, Bishop JO, and Leigh Brown AJ: Concurrent evolution of human immunodeficiency virus type 1 in patients infected from the same source: Rate of sequence change and low frequency of inactivating mutations. J Virol

1990;64:6221-6233. 6.

and Dubin DT: Transmission from one child to another of human immunodeficiency virus type 1 with a zidovudine-resistance mutation. N Engl J Med 1993;329:1835-1841. 7. Wolfs TF, Zwart G, Bakker M, and Goudsmit J: HTV-1 genomic RNA diversification following sexual and parenteral virus transmission. Virology 1992;189:103-110. 8. Burger H, Weiser B, Flaherty K, Gulla J, Nguyen PN, and Gibbs RA: Evolution of human immunodeficiency virus type 1 nucleotide sequence diversity among close contacts. Proc Nati Acad Sei USA

1991;88:11236-11240. C-Y, Ciesielski CA, Myers G, Bandea CI, Luo C-C, Korber BTM, Mullins JI, Schochetman G, Berkelman R, Economou AN, Witte JJ, Furman LJ, Satten GA, Maclnnes KA, Curran JW, Jaffe

9. Ou

HW, and Laboratory Investigation Group: Molecular epidemiol10.

atitis C viruses. 11.

ACKNOWLEDGMENTS We thank Dr. Allen Mayer and Mr. Michael Gallo and Luke Romero for performing some of the DNA sequencing; Drs. Eugene Shpaer and Allen Rodrigo for assistance with computer analyses; Drs. Haynes Sheppard and Jaap Goudsmit for providing some of the samples used in this study; Dr. Andrew J. Leigh-Brown for pointing out the large deletion in the V4 domain of virus present in patient B; and Drs. James Arthos, Betty Korber, Donald L. Sodora, and Colombe Chappey for useful discussions. This work was supported by Public Health Service Awards AI32885 and HL48367 and the Stanford Program in

Fitzgibbon JE, Gaur S, Frenkel LD, Laraque F, Edlin BR,

12.

13.

14.

ogy of HIV transmission in a dental practice. Science 1992;256: 1165-1171. Holmes EC, Zhang LQ, Robertson P, Cleland A, Harvey E, Simmonds P, and Leigh Brown AJ: The molecular epidemiology of human immunodeficiency virus type 1 in Edinburgh. J Infect Dis 1995;171:45-53. Cornelissen M, Mulder-Kampinga G, Veenstra J, Zorgdrager F, Kuiken C, Hartman S, Dekker J," van der Hoek L, Sol C, Coutinho R, and Goudsmit J: Syncytium-inducing (SI) phenotype suppression at seroconversion after intramuscular inoculation of a non-syncytium/SI phenotypically mixed human immunodeficiency virus population. J Virol 1995;69:1810-1818. Albert J, Wahlberg J, Leitner T, Escanilla D, and Uhlen M: Analysis of a rape case by direct sequencing of the human immunodeficiency virus type 1 pol and gag genes. J Virol 1994; 68:5918-5924. Salminen M, Nykanen A, Brummer-Korvenkontio H, Kantanen ML, Liitsola K, and Leinikki P: Molecular epidemiology of HIV1 based on phylogenetic analysis of in vivo gag p7/p9 direct sequences. Virology 1993;195:185-194. Groenink M, Fouchier R, Broersen S, Baker C, Koot M, Van't

1091

MOLECULAR EPIDEMIOLOGY OF HIV TRANSMISSION

15.

16.

17.

18.

19.

20.

21.

22.

Wout A, Huisman H, Miedema F, Tersmette M, and Schuitemaker H: Relation of phenotype evolution of HTV-1 to envelope V2 configuration. Science 1993;260:1513-1516. Simmonds P, Zhang LQ, McOmish F, Balfe P, Ludlam CA, and Leigh Brown AJ: Discontinuous sequence change of human immunodeficiency virus (HIV) type 1 env sequences in plasma viral and lymphocyte-associated proviral populations in vivo: Implications for models of HTV pathogenesis. J Virol 1991 ;65: 6266-6276. Leigh Brown AJ and Monaghan P: Evolution of the structural proteins of human immunodeficiency virus: Selective constraints on nucleotide substitution. AIDS Res Hum Retroviruses 1988;4:399407. Pang S, Shlesinger Y, Daar ES, Moudgil T, Ho DD, and Chen ISY: Rapid generation of sequence variation during primary HTV-1 infection. AIDS 1992;6:453^I60. Zhu T, Mo H, Wang N, Nam DS, Cao Y, Koup RA, and Ho DD: Genotypic and phenotypic characterization of HIV-1 in patients with primary infection. Science 1993;261:1179-1181. McNearney T, Homickova Z, Markham R, Birdwell A, Arens M, Saah A, and Ratner L: Relationship of human immunodeficiency virus type 1 sequence heterogeneity to stage of disease. Proc Nati Acad Sei USA 1992;89:10247-10251. Zhang LQ, MacKenzie P, Cleland A, Holmes EC, Leigh Brown AJ, and Simmonds P: Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. J Virol 1993;67:3345-3356. Meyerhans A, Cheynier R, Albert J, Seth M, Kwok S, Sninsky J, Morfeldt-Mânson L, Asjö B, and Wain-Hobson S: Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HTV isolations. Cell 1989;58:901-910. Wain-Hobson S: Viral burden and AIDS. Nature (London)

1993,366:22. 23. Coffin JM: Genetic diversity and evolution of retroviruses. Curr TopMicrobiol Immunol 1992;176:143-164. 24. Wain-Hobson S: The fastest genome evolution ever described: HIV variation in situ. Curr Biol 1993;3:878-883. 25. Hillis D, Huelsenbeck JP, and Cunningham CW: Application and accuracy of molecular phytogenies. Science 1994;264:671-677. 26. Myers G: Molecular investigations of HTV transmission. Ann Intern Med 1994;121:889-890. 27. Grez M, Dietrich U, Balfe P, von Bliesen H, Maniar JK, Mahambre G, Delwart EL, Mullins JI, and Rübsamen-Waigmann H: Genetic analysis of human immunodeficiency virus type 1 and 2 (HTV-1 and HTV-2) mixed infections in India reveals a recent spread of HTV-1 and HTV-2 from a single ancestor for each of these viruses. J Virol 1994;68:2161-2168. 28. Delwart EL, Shpaer EG, McCutchan FE, Louwagie J, Grez M, Rübsamen-Waigmann H, and Mullins JI: Genetic relationships determined by a heteroduplex mobility assay: Analysis of HIV env genes. Science 1993;262:1257-1261. 29. McCutchan FE, Hegerich PA, Brennan TP, Phanuphak P, Singharaj P, Jugsudee A, Berman PW, Gray AM, Fowler AK, and Burke DS: Genetic variants of HIV-1 in Thailand. AIDS Res Hum Retroviruses 1992;8:1887-1895. 30. Ou CY, Takebe Y, Weniger BG, Luo CC, Kalish ML, Auwanit W, Yamazaki S, Gayle HD, Young NL, and Schochetman G: Independent introduction of two major HTV-1 genotypes into distinct high-risk populations in Thailand. Lancet 1993;341:1171— 1174. 31. Delwart EL, Sheppard HW, Walker BD, Goudsmit J, and Mullins JI: Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays. J Virol 1994;68:6672-6683. 32. Adams M, Lee TH, Busch MP, Heitman J, Marshall GJ, Gjerset

GF, and Mosley JW: Rapid freezing of whole blood

or

buffy coat

for

polymerase chain reaction and cell culture analysis: samples Application to detection of human immunodeficiency virus in blood donor and recipient repositories. Transfusion 1993;33: 504-508. 33. Simmonds P, Balfe P, Peutherer JF, Ludlam CA, Bishop JO, and Leigh Brown AJ: Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells and at low copy numbers. J Virol 1990;64:864-872. 34. Faulkner DV and Jurka J: Multiple aligned sequence editor (MASE). Trends Biochem Sei 1988;13:321-322. 35. Felsenstein J: PHYLIP-Phylogeny inference package. Cladistics 1989;5:164-166. 36. Kishino H and Hasegawa M: Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order of the Hominoidea. J Mol Evol 1989;29:170-179. 37. Saitou N and Nei M: The neighbour-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4: 406-425. 38. Kusumi K, Conway B, Cunningham S, Berson A, Evans C, Iversen AKN, Colvin D, Gallo MV, Coutre S, Shpaer EG, Faulkner DV, DeRonde A, Volkman S, Williams C, Hirsch MS, and Mullins JI: HIV-1 envelope gene structure and diversity in vivo and following co-cultivation in vitro. J Virol 1992;66:875-885. 39. CDC: Update: Investigations of persons treated by HIV-infected health-care workers. Morbid Mortal Weekly Rep 1993;42: 329-331. 40. Hillis DM and Huelsenbeck JP: Support for dental HIV transmission. Nature (London) 1994;369:24-25. 41. Crandall KA: Intraspecific phylogenetics: Support for dental transmission of human immunodeficiency virus. J Virol 1995;69:23512356. 42. Jaffe HW, McCurdy JM, Kalish ML, Liberti T, Metellus G, Bowman BH, Neasman AR, and Witte JJ: Lack of transmission of human immunodeficiency virus in the practice of a dentist with AIDS. Ann Intern Med 1994;121:855-859. 43. Bachmann MH, Delwart EL, Shpaer EG, Lingenfelter P, Singal R, Mullins JI, and WHO-Network on HIV-Isolation and Characterization: Rapid genetic characterization of HTV-1 from four WHO-sponsored vaccine evaluation sites using a heteroduplex mobility assay. AIDS Res Hum Retroviruses 1994;10:1345-1353. 44. Delwart EL, Herring BL, Rodrigo AG, and Mullins JI: Genetic subtyping of human immunodeficiency virus using a heteroduplex mobility assay. PCR Methods Appl 1995;4:S202-S216. 45. Wang Y-H and Griffith J: Effects of bulge composition and flanking sequence on the kinking of DNA by bulged bases. Biochemistry 46.

47.

48.

1991;30:1358-1363. Myers G, Korber B, Wain-Hobson S, Smith RF, and Pavlakis GN: Human Retroviruses and AIDS 1993. A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences. 1993. Los Alamos National Laboratory, Los Alamos, NM. Zhang Y, Dawson SC, Landsman D, Lane HC, and Salzman NP: Persistence of four related human immunodeficiency virus subtypes during the course of zidovudine therapy: Relationship between virions RNA and proviral DNA. J Virol 1994;68:425-432. Holmes EC, Zhang LQ, Simmonds P, Ludlam CA, and Leigh Brown AJ: Convergent and divergent sequence evolution in the surface envelope glycoprotein of human immunodeficiency virus type 1 within a single infected patient. Proc Nati Acad Sei USA 1992;89:4835^I839.

49.

Chang SY, Bowman BH, Weiss JB, Garcia RE, and White TJ: The origin of HIV-1 isolate HTLV-fflB. Nature (London) 1993;363: 466-469.

1092 50.

51.

52.

53.

54.

55.

Jenison S, Torrez-Martinez N, Yamada T, Nolte K, Zumwalt R, Maclnnes K, and Myers G: A novel hantavirus associated with an outbreak of fatal respiratory disease in the Southwestern United States: Evolutionary relationship to known hantaviruses. J Virol 1994;68:592-596. Weaver SC, Bellew LA, and Rico-Hesse R: Phylogenetic analysis of alphaviruses in the Venezuelan equine encephalitis complex and identification of the source of epizootic viruses. Virology 1992; 191:282-290. Kawaoka Y, Krauss S, and Webster RG: Avian-to-human transmission of the PB1 gene of influenza A viruses in the 1957 and 1968 pandemics. J Virol 1989;63:4603^1608. Farci P, Alter HJ, Govindarajan S, Wong DC, Engle R, Lesniewski RR, Mushahwar IK, Desai SM, Miller RH, and Ogata N: Lack of protective immunity against reinfection with hepatitis C virus. Science 1992;258:135-140. Small PM, Hopewell PC, Singh SP, Paz A, Parsonnet J, Ruston DC, Schecter GF, Daley CL, and Schoolnick GK: The epidemiology of tuberculosis in San Francisco. N Engl J Med 1994; 330:1703-1709. Sokol DM, Demmler GJ, and Buffone GJ: Rapid epidemiologic analysis of cytomegalovirus by using polymerase chain reaction amplification of the L-S junction region. J Clin Microbiol

Hjelle B,

DEL WART ET AL. 66.

RNA and of cell-associated viral DNA reflects active viral replication in human immunodeficiency virus type 1-infected individuals. J Virol 1995;69:2637-2639. 67. Delwart EL, Holodniy M, Gallo M, and Mullins JI: Manuscript in preparation. 1995. 68. Kuiken C, Zwart G, Baan E, Coutinho R, van den Hoek J, and Goudsmit J: Increasing antigenic and genetic diversity of the HTV1 V3 domain in the course of the AIDS epidemic. Proc Nati Acad Sei USA 1993;90:9061-9065. 69. van Griensven GJ, Hessol NA, Koblin BA, Byers RH, O'Malley PM, Albercht-van Lent N, Buchbinder SP, Taylor PE, Stevens CE, and Coutinho RA: Epidemiology of human immunodeficiency virus type 1 infection among homosexual men participating in hepatitis B vaccine trials in Amsterdam, New York City, and San Francisco, 1978-1990. Am J Epidemiol 1993

;137:909-915. 70.

57.

58.

Daley CL, Small PM, Schecter GF, Schoolnik GK, McAdam RA, Jacobs W Jr, and Hopewell PC: An outbreak of tuberculosis with accelerated progression among persons infected with the human immunodeficiency virus. An analysis using restriction-fragmentlength polymorphisms. N Engl J Med 1992;326:231-235. Lopez-Galindez C, Rojas JM, Najera R, Richman DD, and Perucho M: Characterization of genetic variation and 3'-azido-3'-deoxythymidine-resistance mutations of human immunodeficiency virus by the RNase A mismatch cleavage method. Proc Nati Acad

Sei USA 1991;88:4280-4284. 59. Simmonds P, Balfe P, Ludlam CA, Bishop JO, and Leigh Brown AJ: Analysis of sequence diversity in hypervariable regions of the external glycoprotein of human immunodeficiency virus type 1. J Virol 1990;64:5840-5850. 60. McCutchan FE, Sanders-Buell E, Oster CW, Redfield RR, Hira SK, Perine PL, Ungar BL, and Burke DS: Genetic comparison of human immunodeficiency virus (HTV-1) isolates by polymerase chain reaction. J AIDS 1991;4:1241-1250. 61. Dumitrescu O, Kalish ML, Kliks SC, Bandea CI, and Levy JA: Characterization of human immunodeficiency virus type 1 isolates from children in Romania: Identification of a new envelope subtype. J Infect Dis 1994;169:281-288. 62. Louwagie J, McCutchan FE, Peeters M, Brennan TP, Sanders-Buell E, Eddy GA, van der Groen G, Fransen K, Gershy-Damet G-M, Deleys R, and Burke DS: Phylogenetic analysis of gag genes from seventy international HTV-1 isolates provides evidence for multiple genotypes. AIDS 1993;7:769-780. 63. Smith TF and Waterman MS: The continuing case of the Florida dentist. Science 1992;256:1155-1156. 64. Wei X, Ghosh SK, Taylor ME, Johnson VA, Emini EA, Deutsch P, Lifson JD, Bonhoeffer S, Novak MA, Hahn BH, Saag MS, and Shaw GM: Viral dynamics in human immunodeficiency virus type 1 infection. Nature (London) 1995;373:117-126. 65. Kozal MJ, Shafer RW, Winters MA, Katzenstein DA, and Merigan TC: A mutation in human immunodeficiency virus reverse transcriptase and decline in CD4 lymphocyte numbers in long-term zidovudine recipients. J Infect Dis 1993;167:526-532.

Jacquez JA, Koopman JS, Simon CP, and Longini IM: Role of primary infection in epidemics of HTV infection in gay cohorts. J AIDS

71.

1992;30:839-844. 56. Smith JS, Fishbein DB, Rupprecht CE, and Clark K: Unexplained rabies in three immigrants in the United States. A virologie investigation. N Engl J Med 1991;324:205-211.

Kessler JA, Waterbury JA, Byrnes VW, Massari F, Staszewski S, and Emini EA: Turnover of circulating virion

Lineberger DW,

72.

73.

74.

75.

1994;7:1169-1184.

Louwagie J, Delwart EL, Mullins JI, McCutchan FE, Eddy G, and Burke DS: Genetic analysis of HTV-1 isolates from Brazil reveals

the presence of two distinct genotypes. AIDS Res Hum Retroviruses 1994;10:561-567. Osmanov S, Belsey L, Heyward W, Esparza J, Bradac J, GalvaoCastro B, Van de Perre P, Karita E, Sempala S, Tugume B, Biryanwaho B, Wasi C, Rübsamen-Waigmann H, von Bliesen H, Esser U, Grez M, Holmes H, McCutchan FE, Louwagie J, and Hegerich P: HTV-1 variation in WHO-sponsored vaccine evaluation sites: Genetic screening, sequence analyses and preliminary biological characterization of representative viral strains. AIDS Res Hum Retroviruses 1994;10:1327-1343. Wasi C, Herring B, Vanichseni S, Mastro TD, Young NL, Rubsamen-Waigmann H, von Bliesen H, Kalish M, Luo C-C, Baldwin A, Mullins JI, Delwart E, Esparza J, Heyward L, and Osmanov S: Molecular epidemiology of HIV-1 subtypes in injecting drug users in Bangkok, Thailand: An evaluation of peptide binding EIA and heteroduplex mobility assay as screening methods for HTV-1 env subtype determination. AIDS Res Hum Retroviruses (in press). Zhu T, Wang N, Carr A, Wolinsky S, and Ho DD: Evidence for coinfection by multiple strains of human immunodeficiency virus type 1 subtype B in an acute seroconverter. J Virol 1995;69: 1324-1327. Cumming PD, Wallace EL, Schorr JB, and Dodd RY: Exposure of patients to human immunodeficiency virus through the transfusion of blood components that test antibody-negative. N Engl J Med

1989;321:941-946. 76. Irani MS, Dudley A Jr, and Lucco LJ: Case of HTV-1 transmission by antigen-positive, antibody-negative blood. N Engl J Med

1991;325:1174-1175. 77. Sabino EC, Delwart EL, Lee T-H, Mayer A, Mullins JI, and Busch MP: Identification of low-level contamination of blood as basis for detection of HIV DNA in an anti-HTV-negative specimens. J AIDS

1994;7:853-859. 78. Wain-Hobson S, Vartanian J-P, Henry M, Chenciner N, Cheynier R, Delassus S, Martins LP, Sala M, Nugeyre M-T, Guétard D, Klatzmann D, Gluckman JC, Rozenbaum W, Barré-Sinoussi F, and Montagnier L: LAV revisited: Origins of the early HIV-1 isolates from Institut Pasteur Science 1991;252:961-965. 79. Tan X, Pearce-Pratt R, and Phillips DM: Productive infection of a cervical epithelial cell line with human immunodeficiency virus: Implications for sexual transmission. J Virol 1993;67:6447-6452.

1093

MOLECULAR EPIDEMIOLOGY OF HIV TRANSMISSION 80.

Contag C and Mullins JI: (Stanford University). Personal commu-

nication. 81. Zhu T and Ho DD: (Aaron Diamond AIDS Research Center, New York University). Personal communication. 82. Hamed KA, Winters MA, Holodniy M, Katzenstein DA, and Merigan TC: Detection of human immunodeficiency virus type 1 in semen: Effects of disease stage and nucleoside therapy. J Infect Dis 1993;167:798-802.

Address

reprint requests

to:

Eric L. Delwart Aaron Diamond AIDS Research Center New York University 455 First Ave. New York, New York 10016 Tel: 212-725-0018