Rapid screening method for detecting mutations in the 21-hydroxylase ...

Clinical Chemistry 43:4 557–561 (1997)

Molecular Pathology

Rapid screening method for detecting mutations in the 21-hydroxylase gene Josep Oriola,1* Isabel Plensa,1 Isabel Machuca,1 Carles Pavı´a,2 and Francisca Rivera-Fillat1 procedures are needed that will detect known mutations in the 21-hydroxylase gene to support a rapid diagnosis. We have designed a coordinated strategy to detect nine common 21-hydroxylase mutations, identifying some of them with the amplification-created restriction site (ACRS) method [6]. ACRS, a PCR-based method, can identify previously known allelic mutations in nucleic acid sequences.

Impaired synthesis of adrenal steroid hormones because of steroid 21-hydroxylase deficiency is one of the most common inborn errors of metabolism. To expedite molecular diagnosis in families with 21-hydroxylase deficiency, we have designed a rapid strategy to determine nine of the most common mutations in the 21-hydroxylase gene. According to the mutation to be detected, we apply either of two simple strategies: digestion with adequate restriction enzyme or use of the amplificationcreated restriction site (ACRS) approach and subsequent restriction analysis. Both procedures are rapid and, being nonradioactive, are safer to perform; moreover determination of zygosity in the analyzed mutations requires only one tube per mutation.

Materials and Methods Subjects. Eight CAH families were selected according to mutations that had been identified previously by means of allele-specific oligonucleotide hybridization. Preparation of human DNA. Human DNA was prepared from peripheral white blood cells. 10 mL of heparinized blood was mixed with 40 mL of isotonic saline (9 g/L NaCl) and centrifuged at 1500g. The pellet was resuspended in 30 mL of erythrocytes lysis buffer (5 mmol/L MgCl2 and 20 mmol/L Tris-HCl, pH 7.8) and centrifuged at 3000g. Leukocytes were lysed by adding to 10 mL of lysis buffer (0.2 mol/L NaCl, 1 mmol/L EDTA, and 10 mmol/L Tris-HCl, pH 7.8) containing 10 mg of sodium dodecyl sulfate and 0.4 mg of proteinase K per milliliter (Merck, Darmstadt, Germany). After having shaken this mixture for 2 h at room temperature, we extracted it once with an equal volume of phenol and then twice with chloroform/isoamyl alcohol (24/1 by vol). The DNA was precipitated from the combined extracts by adding 2.5 volumes of isopropanol as described [7]. The two-wavelength absorbance ratio (A260/A280) of the DNA preparations was .1.7. We checked the integrity of the DNA samples by electrophoresis of 2 mg of DNA in a 0.9% agarose gel.

congenital adrenal hyperplasia • heritable disorders • adrenal steroid hormones • amplificationcreated restriction site analysis

INDEXING TERMS:

Congenital adrenal hyperplasia (CAH) is an inherited disorder of cortisol biosynthesis [1]. Although five different enzymes are required to synthesize cortisol in the adrenal cortex-mix, steroid 21-hydroxylase deficiency accounts for .90% of CAH. The steroid 21-hydroxylase gene, located in the HLA class III gene region on chromosome 6, has a complicated structure with a high degree of variability. An active gene, CYP21, and a highly homologous inactive pseudogene, CYP21P, are located 39 from each of the two genes encoding the fourth component of complement C4A and C4B, forming a repeated tandem of the units C4/21OH [2, 3]. Because 21-hydroxylase deficiency is one of the most common inborn errors of metabolism in humans [4, 5],

Methodology. Primers used were synthesized in our hospital in a DNA synthesizer (Model 392; Applied Biosystems, Foster City, CA); subsequent purification by HPLC was not required. The oligonucleotide probes used for allele-specific oligonucleotide hybridization were essentially those described by Owerbach et al. [5]; for the

1 Servei d’Hormonologia, Hospital Clı´nic i Provincial de Barcelona, and Seccio´ d’Endocrinologia, Hospital Universitari de Sant Joan de Deu, Spain. *Address for correspondence: Servei d’Hormonologia, Hospital Clı´nic, Villarroel 170 08036, Barcelona, Spain. Fax 34-3-227.54.54; e-mail labhor@ medicina.ub.es. Received August 28, 1996; revised October 31, 1996; accepted November 15, 1996.

2

557

558

Oriola et al.: Rapid screening for mutations in 21-hydroxylase gene

R356W mutation, we used oligonucleotides described by Speiser et al. [8]. PCR-amplified DNA was blotted onto Hybond-N Nylon membranes and hybridized to specific oligonucleotides with use of Rapid-hyb buffer (both from Johnson & Johnson, Amersham, UK). Deletion/conversion analysis was performed by Southern blot with restriction enzymes BglII and TaqI [8]. Diagnosis of CAH was based on clinical and hormonal criteria [9, 10]. PCR analysis. Nine 21-hydroxylase gene mutations were analyzed by means of the following strategy: Genomic DNA was amplified in two segments by PCR with primers that selectively amplify CYP21. Fragment 1 (Fig. 1, upper left scheme) represents a 1339-bp segment extending from exon 1 to exon 6. Fragment 2 (Fig. 1, lower right scheme) is a 2.22-kb fragment extending from the 8-bp deletion in exon 3 to beyond exon 10. These two primary PCR reactions were performed as follows: After a hot start of 2 min at 96 °C, we used 35 cycles, each consisting of denaturation for 30 s at 94 °C, annealing for 30 s at 60 °C, and extension for 2 min (P1/P2) or 10 min (P3/P4) at 72 °C. For the second PCR round we used a 100-fold dilution from each first amplification—with the adequate primers listed in Table 1 and under similar conditions to the primary PCR, except that the extension time was only 1 min. Using fragment 1 as template, we performed a second PCR with the appropriate primers (Fig. 1, upper left) to detect P30L, intron 2 (A,C3 G), and exon 3 (8-bp deletion) mutations. Fragment 2 was digested to detect both V281L and R339H mutations at the same time. Fragment 2 was also used as template to perform a second PCR with the appropriate primers (Fig. 1, lower right) to detect I172N, Q318X, R356W, and P453S mutations.

Table 1. Sequences of oligonucleotide primers used for PCR amplifications and analysis of the CYP21 gene mutations. Primer

P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 P16 P17

Sequence

59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59

TGGAACTGGTGGAAGCTCCGG 39 GCATCTCCACGATGTGA 39 TTGTCCTTGGGAGACTACTCC 39 ACCTCTCGCACCCCAGTATGACT 39 GCTCCGGAGCCTCCACCTCG 39 TTGGAGTTCAGCACCAC 39 GTGGTGCTGAACTCCAA 39 ACACCAGCTTGTCTGCAGGAGGCG 39 AGCCCCCAACTCCTCCTGCA 39 TGTGGGCTTTCCAGAGC 39 TCTCTCTCCTCACCTGCAGCATCG 39 ACCGGCCACTCAGGCTCACTGGG 39 GCCCAGTTCGTGGTCTAGC 39 CAGCGACTGCAGGAGGAGCTA 39 GCTCGGGCTTTCCTCACTCAT 39 TGTGGTGGAGGCTGGTCCCCG 39 AGGGCAGGGCGTCCCCGGAGC 39

Modified nucleotides are underlined.

The method used to detect point mutations in some of these secondary amplifications involves the gain or loss of at least a single restriction site in the PCR product (R356W, Q318X). Other secondary amplifications were performed with the ACRS method, which enables the detection of any new restriction sites generated by a single-base mutation and of a second mutation generated in vitro by the use of a modified oligonucleotide as a primer (P30L, intron 2, I172N, and P453S). After the secondary PCR reaction, products were of

Fig. 1. Approximate location of the PCR primers used to detect the following sets of mutations: (upper left scheme) P30L (P5/P6), intron 2 (A,C3 G)(P7/P8), and exon 3 (8-bp deletion)(P9/P10); (lower right scheme) V281 and R339H (P3/P4), I172N (P11/P2), Q318X (P12/P13), R356W (P14/P15), and P453S (P16/P17).

559

Clinical Chemistry 43, No. 4, 1997

sufficient quality for restriction analysis. PCR products were digested with the appropriate restriction enzyme and subjected to electrophoresis through an agarose gel (1%), agarose/Nu-Sieve gel (0.5%/2.5%) (FMC Bioproducts, Rockland, ME), or polyacrylamide gel (10%), according to the expected length of bands (Table 2). All reactions were set up and analyzed in separate areas to prevent contamination from previously amplified material and taking special care during the second PCR reaction. Pipettes with aerosol barrier tips were used, and controls with no genomic DNA template were included in the analyses at all times.

Results and Discussion We performed this genetic analysis in eight CAH families studied previously by allele-specific oligonucleotide hybridization (Table 3). Families pictured in Fig. 2e, g, and h were diagnosed as nonclassical CAH; those in Fig. 2a, d, and f as simple virilizing; and those in Fig. 2b and c as salt-wasting forms.

Table 3. Mutational analysis in CAH families by allelespecific oligonucleotide hybridization with PCR-amplified DNA from P1/P2 and P3/P4. Family 2a F A M Family 2c F A M Family 2e F A M

P30L 2,2 1,2 1,2 E3 (8bp del) 1,2 1,1 1,2 V281L 1,2 1,1 1,2

V281L 1,2 1,2 2,2

Family 2g F A M

V281L 1,2 1,2 2,2

R356W 2,2 1,2 1,2

Family 2b F A M Family 2d F A M Family 2f F A B M Family 2h F A M

Intron 2 1,2 1,1 1,2 I172N 1,2 1,1 1,2 Intron 2 1,2 1,2 2,2 2,2 V281L 1,2 1,2 2,2

Q318X 2,2 1,2 2,2 1,2 P453S 2,2 1,2 1,2

See Fig. 2 for explanation of abbreviations.

experimental design for pcr amplification and mutation detection P30L mutation [11] was detected by performing the second PCR with P5 and P6 primers. P5 primer is modified from its original sequence to give rise to an HhaI restriction site when no P30L mutation is present (Fig. 2a). The P30L mutation also destroys an AcyI restriction site but this restriction enzyme often yielded partial digestions in our hands, leading to wrong results (data not shown). Intron 2 mutation was detected by using a second PCR with P7 and P8 primers. The intron 2 site has three possible nucleotide substitutions, two neutral, A or C, and one mutated G, which causes an alternative splice site to be used [12]. P8 primer is modified to give rise to an HhaI restriction site only when the G nucleotide is present (Fig. 2b). With this methodology, only one reaction is required, whereas allele-specific PCR, in contrast, requires the use of three different reactions. Exon 3 (8-bp deletion) was detected by means of a second PCR with P9 and P10 primers. The amplified product of a nonmutated gene is a 89-bp fragment, whereas exon 3 (8-bp deletion) gives an 81-bp fragment

(Fig. 2c). I172N mutation [13] was detected by means of a second PCR with P11 and P2 primers. P11 primer is modified to generate a TaqI restriction site when this mutation is present (Fig. 2d). V281L [14] mutation was detected by means of digestion with Alw 44I restriction enzyme from the P3/P4specific CYP21-amplified product (Fig. 2e), but the R339H mutation [15] was not detected in any of our CAH families. Although we do not include a positive control in our assay, our approach should still detect any R339H mutation present because both V281L and R339H mutations produce a loss of the Alw 44I restriction site. Q318X mutation [16], which produces a codon stop, was detected by means of a second PCR with P12 and P13 primers (neither of them is modified). When the Q318X mutation is present, a PstI restriction site is lost (Fig. 2f). R356W mutation [17] was detected by means of a second PCR with P14 and P15 primers (neither of them is modified) and subsequent digestion with BsofI restriction enzyme (this mutation produces a loss of a BsofI restriction

Table 2. Characteristics of mutational analyses in the CYP21 gene. Fragment sizes, bp Mutation

Pro-30-Leu Intron 2 (A,C3G) Exon 3 (8-bp deletion) IIe-172-Asn Val-281-Leu 1 Arg-339-His Gln-318-Stop Arg-356-Trp Pro-453-Ser

Primers

PCR product, bp

Restriction enzyme

Normal

Mutated

P6 P8 P10 P2 P4

249 378 89 416 2219

HhaI HhaI — TaqI Alw 44I

21, 228 378 89 416 376, 853, 990

P12 P13 P14 P15 P16 P17

136 213 223

PstI BsofI HhaI

25, 111 9, 33, 81, 90 2, 23, 51, 147

249 24, 354 81 22, 394 853, 1366 990, 1229 136 33, 81, 99 2, 74, 147

P5 P7 P9 P11 P3

560

Oriola et al.: Rapid screening for mutations in 21-hydroxylase gene

Fig. 2. Mutational analysis in eight CAH families. (a) P30L mutation, simple virilizing: father (F), noncarrier (2,2); affected child (A), heterozygous (1,2); mother (M), (1,2). (b) Intron 2 (A,C3 G), salt wasting: F (1,2); A, homozygous for the mutation (1,1); M (1, 2); control (C) (2,2). (c) Exon 3 (8-bp deletion), salt wasting: F (1,2); A (1,1); M (1,2); C (2,2). (d) I172N, simple virilizing: F (1,2); A (1,1); M (1,2); C (2,2). (e) V281L, nonclassical form: F (1,2); A (1,1); M (1,2); C (2,2). (f) Q318X, simple virilizing: F (2,2); A (1,2); brother (B) (2,2); M (1,2). (g) R356W, nonclassical form: F (2,2); A (1,2); M (1,2). (h) P453S, nonclassical form: F(2,2); A (1,2); M (1,2). All panels: m, DNA marker V (Boehringer Mannheim, Mannheim, Germany); d, 100-bp DNA ladder (Gibco-BRL Life Technologies, Gaithersburg, MD).

site) (Fig. 2 g). P453S mutation [15] was detected also by with a second PCR using P16 and P17 primers. P17 primer was modified to give rise to an HhaI restriction site when P453S mutation is not present (Fig. 2h).

considerations for the pcr strategy The number of common mutations and the presence of a highly homologous pseudogene complicate the routine use of molecular techniques for diagnosis of 21-hydroxylase deficiency. Nonetheless, we have developed a simple strategy to determine nine of the most common mutations in the CYP21 gene. Amplification at two independent sites of this gene allows an accurate genotyping of subjects. In contrast to previous methods, e.g., dot-blot analysis (with radioactive probes) or allele-specific PCR (which amplifies normal and mutant alleles in different tubes), this strategy can characterize nine CYP21 gene mutations by using ethidium bromide-stained agarose or polyacrylamide gel electrophoresis and five common restriction

enzymes. Moreover, normal and mutant alleles are both amplified in the same reaction tube, thus allowing determination of the zygosity of the mutations. The ligase chain reaction has also been described as an alternative to dot-blot analysis and allele-specific PCR [18]. Although robust, however, the ligase chain reaction is more complex (fluorescently labeled oligonucleotides, asymmetric PCR, and automated sequencing) than our ACRS method. Moreover, the ACRS strategy can be applied to other CYP21 gene mutations in the initial amplified products, leading a more accurate mutational screening of this disease. In theory, this strategy can also be used to detect CYP21 deletions/conversions. If homozygous deletions/ conversions extend to exons 3, 4, or 5, then P30L, intron 2, and exon 3 (8-bp deletion) mutations would appear in the same allele in a homozygous state and fragment 2 would fail to be amplified. If homozygous deletions/conversions extend to exon 6 or further, neither of the fragments

561

Clinical Chemistry 43, No. 4, 1997

Table 4. Polymorphisms detected in the coding sequence of 21-hydroxylase gene. Size of alleles, bp

Polymorphism

K103R S269T R426P

Primers

Restriction site changed

Restriction site present

Restriction site absent

P9/P10 P3/P4 P16/P17

DdeI NcoI MspI

33 1 56 83 1 872 1 1260 17 1 84 1 122

89 83 1 2132 17 1 206

would be amplified. If heterozygous deletions/conversions extend to exons 3, 4, or 5, then P30L, intron 2, and exon 3 (8-bp deletion) mutations would appear in the same allele in a heterozygous state. If, in these last cases, the other allele also carried a P30L, intron 2 or exon 3 (8-bp deletion) mutation, the subject tested would incorrectly be considered a homozygote. Therefore, this methodology does not replace the Southern transfer assay with BglII and TaqI, but it can help to show how far the deletion/conversion extends. Genotyping of parents could also be used to infer the existence of a chromosome so affected. We have used the described strategy to study three of our families having one deleted allele detected by Southern transfer, but found none of the mutations (data not shown). We suggest that in these three cases, the deletions extend beyond exon 6. Exon 6 (33 cluster) mutation cannot be detected in this strategy because of P2 primer matches at this point. “Back-conversions” of CYP21 into CYP21P have been described [18]. In our strategy, a back-mutation around the primer sites for P2 or P3 could be amplified, so in these cases we would find several CYP21P mutations in the same allele, suggesting a conversion. Nevertheless, the most common back-conversions are not at either of these two sites. As a way to take advantage of this strategy, one can use the same PCR amplification products to detect polymorphic sites in the CYP21 gene (Table 4) so as to perform a linkage analysis when one or both mutations are not found.

3.

4.

5.

6.

7. 8.

9. 10. 11.

12.

13.

In conclusion, our PCR strategy has a complete concordance with allele-specific oligonucleotide hybridization, requires simple diagnostic tools, avoids the use of radioactivity, and can determine CYP21 mutations rapidly and accurately. In addition, other CYP21 mutations can be enclosed through use of this strategy.

We thank Marga Ferrer and Lluisa Boque´ for their expert technical assistance.

14.

15.

16.

17.

References 1. Miller WL, Levine LS. Molecular and clinical advances in congenital adrenal hyperplasia [Review]. J Pediatr 1987;111:1–17. 2. Carroll MC, Campbell RD, Porter RR. Mapping of steroid 21hydroxylase genes adjacent to complement component C4 genes

18.

in HLA, the major histocompatibility complex in man. Proc Natl Acad Sci U S A 1985;82:521–5. White PC, Grossberger D, Onufer BJ, Chaplin DD, New MI, Dupont B, Strominger JL. Two genes encoding steroid 21-hydroxylase are located near the genes encoding the fourth component of complement in man. Proc Natl Acad Sci U S A 1985;82:1089 –93. Speiser PW, Dupont B, Rubinstein P, Piazza A, Kastelan A, New MI. High frequency of nonclassical steroid 21-hydroxylase deficiency. Am J Hum Genet 1985;37:650 – 67. Owerbach D, Sherman L, Ballard AL, Azziz R. Pro-453 to Ser mutation in CYP21 is associated with nonclassical steroid 21hydroxylase deficiency. Mol Endocrinol 1992;6:1211–5. Haliassos A, Chomel JC, Tesson L, Baudis M, Kruh J, Kaplan JC, Kitzis A. Modification of enzymatically amplified DNA for the detection of point mutations. Nucleic Acids Res 1989;17:3606. Wyman AR, White R. A highly polymorphic locus in human DNA. Proc Natl Acad Sci U S A 1980;77:6754 – 8. Speiser PW, Dupont J, Zhu D, Serrat J, Buegeleisen M, Tusie-Luna MT, et al. Disease expression and molecular genotype in congenital adrenal hyperplasia due to 21-hydroxylase deficiency. J Clin Invest 1992;90:584 –95. Miller WL. Genetics, diagnosis, management of 21-hydroxylase deficiency. J Clin Endocrinol Metab 1994;78:241– 6. Azziz R, Dewailly D, Owerbach D. Nonclassical adrenal hyperplasia: current concepts. J Clin Endocrinol Metab 1994;78:810 –5. Tusie-Luna MT, Speiser PW, Dumic M, New MI, White PC. A mutation (Pro-30 to Leu) in CYP21 represents a potential nonclassic steroid 21-hydroxylase deficiency allele. Mol Endocrinol 1991; 5:685–92. Higashi Y, Tanae A, Inoue H, Hiromasa T, Fujii-Kuriyama Y. Aberrant splicing and missense mutations cause steroid 21hydroxylase [P-450(C21)] deficiency in humans: possible gene conversion products. Proc Natl Acad Sci U S A 1988;85:7486 – 90. Amor M, Parker KL, Globerman H, New MI, White PC. Mutation in the CYP21B gene (Ile-172-Asn) causes steroid 21-hydroxylase deficiency. Proc Natl Acad Sci U S A 1988;85:1600 –7. Speiser PW, New MI, White PC. Molecular genetic analysis of nonclassical steroid 21-hydroxylase deficiency associated with HLA-B14,DR1. N Engl J Med 1988;319:19 –23. Helmberg A, Tusie-Luna MT, Tabarelli M, Kofler R, White PC. R339H, P453S. CYP21 mutations associated with nonclassic steroid 21-hydroxylase deficiency that are not apparent gene conversions. Mol Endocrinol 1992;6:1318 –22. Globerman H, Amor M, Parker KL, New MI, White PC. Nonsense mutation causing steroid 21-hydroxylase deficiency. J Clin Invest 1988;82:139 – 44. Chiou S-H, Hu M-C, Chung B-C. A missense mutation at Ile172-Asn or Arg356-Trp causes steroid 21-hydroxylase deficiency. J Biol Chem 1990;265:3549 –52. Day DJ, Speiser PW, White PC, Barany F. Detection of steroid 21-hydroxylase alleles using gene-specific PCR and a multiplex ligation detection reaction. Genomics 1995;29:152– 62.