ORIGINAL RESEARCH REPORTS
STEM CELLS AND DEVELOPMENT Volume 23, Number 10, 2014 Mary Ann Liebert, Inc. DOI: 10.1089/scd.2014.0010
Redox Regulation of Canonical Wnt Signaling Affects Extraembryonic Endoderm Formation Leanne Sandieson,*,{ Jason T.K. Hwang,* and Gregory M. Kelly
Retinoic acid (RA) induces mouse F9 cells to form primitive endoderm (PrE) and increased levels of reactive oxygen species (ROS) accompany differentiation. ROS are obligatory for differentiation and while H2O2 alone induces PrE, antioxidants attenuate the response to RA. Evidence shows that ROS can modulate the Wnt/b-catenin pathway and in this study, we show that extraembryonic endoderm formation is dependent on the redox state of nucleoredoxin (NRX). In undifferentiated F9 cells, NRX interacted with dishevelled 2 (Dvl2) and while this association was enhanced under reduced conditions, it decreased following H2O2 treatment. Depleting NRX levels caused morphological changes like those induced by RA, while increasing protein kinase A activity further induced these PrE cells to parietal endoderm. Reduced NRX levels also correlated to an increase in T-cell-factors-lymphoid enhancer factors-mediated transcription, indicative of canonical Wnt signaling. Together these results indicate that a mechanism exists whereby NRX maintains canonical Wnt signaling in the off state in F9 cells, while increased ROS levels lift these constraints. Dvl2 no longer bound to NRX is now positioned to prime the Wnt pathway(s) required for PrE formation.
Introduction
D
uring early mouse development the trophectoderm arises from the outer cells of the blastocyst and is responsible for the development of the embryonic placenta, while the inner cells form the inner cell mass (ICM), which further differentiates into the epiblast or the primitive endoderm (PrE) [1,2]. PrE further differentiates to parietal and visceral endoderm (PE and VE), which form the parietal and visceral yolk sacs, respectively. The cells of the PrE, PE, and VE, collectively known as extraembryonic endoderm, are important for embryonic patterning and for providing nutrients and signaling molecules to the developing embryo [1,3]. This differentiation of the ICM, first to PrE and then to PE and VE is one of the earliest epithelial-to-mesenchymal transitions (EMT) in the developing mouse embryo [4,5]. Studying this EMT in vivo is technically very challenging and for that reason we have turned to the mouse F9 teratocarcinoma stem cell line as an in vitro model [6–8]. Under normal growth conditions, F9 cells remain mainly undifferentiated, but when treated with retinoic acid (RA) they are induced to form PrE [9]. These cells remain competent and can be further induced to differentiate into PE to complete the EMT by subsequent treatment with dibutyryl cyclic adenosine monophosphate (db-cAMP) to increase protein kinase A
activity [5]. RA induces wide scale changes in gene expression and the proteins they encode in turn alter cell adhesion, polarity, morphology, and migration leading to PrE differentiation [10]. One of the key regulatory programs that govern these processes is the canonical Wnt/b-catenin signaling pathway [6,8,11,12]. Wnts are secreted glycoproteins that play numerous roles in vertebrate development including cell proliferation, apoptosis, cell fate determination, and stem cell renewal. In addition to their role in embryogenesis Wnt pathways are also involved in cancers, neurodegenerative diseases, regulation of bone density, and osteoarthritis [13]. There are 19 vertebrate Wnt genes encoding proteins that signal through at least three well-known pathways: canonical Wnt/b-catenin and two non-canonical pathways, Wnt/JNK-planar cell polarity (PCP), and Wnt/Ca2 + . We have focused on Wnt6, which is expressed in response to RA and Gata6 in F9 cells [6,8]. Although both canonical and non-canonical Wnt signaling is required for extraembryonic endoderm formation [6,14,15] we have shown that Wnt6 signals via the canonical pathway. In this manner, dishevelled (Dvl) is recruited to the plasma membrane where it acts to inhibit a destruction complex composed of casein kinase 1, glycogen synthase kinase 3b (GSK3b), axin, and the adenomatous polyposis coli tumor suppressor protein. Disrupting this complex
Molecular Genetics Unit, Department of Biology, Child Health Research Institute, Western University, London, Canada. *These authors contributed equally to this work. {Current affiliation: Sciencetech, Inc., London, Canada.
1037
1038
allows b-catenin to accumulate in the cytosol, followed by its subsequent translocation into the nucleus where it binds to T-cell-factors-lymphoid enhancer factors (Tcfs-Lefs) to induce the transcription of Wnt target genes that promote EMT [6–8,11]. In the absence of the Wnt ligand, the constitutively activated destruction complex targets b-catenin for proteasomal degradation, thus ensuring F9 cells remain in the undifferentiated state. Dvl plays a key role in both canonical and non-canonical signaling and in mammals there are three Dvl isoforms. In mouse all isoforms are expressed during embryonic development and all show a similar broad expression pattern, suggesting that they act in a functionally redundant manner [16]. Partial functional redundancy is evident by the fact that the individual knockouts remain viable, but display defects including, but not limited to social, vertebral, cardiac, and cochlear abnormalities. In double knockout studies, however, the absence of Dvl leads to more severe phenotypes including embryonic lethality [17], indicating that the remaining isoform is not capable of assuming the role(s) left vacant due to the knockouts. F9 cells express all three Dvl isoforms with Dvl2 constituting 95% of the pool [18]. The structure of each Dvl is conserved and include 3 main protein binding domains allowing them to interact with over 60 proteins [19], including the redox-regulating protein nucleoredoxin (NRX) [20]. Recently, our lab reported that the RA-induced activation of canonical Wnt signaling in F9 cells and subsequent EMT leading to PrE formation is accompanied by increased levels of reactive oxygen species (ROS) [7]. Although ROS are byproducts from the incomplete reduction of oxygen through cellular respiration and known for their deleterious effects on various targets, convincing studies show that the specific production of ROS, especially by membrane-bound NADPH oxidases (Nox), is beneficial where the products are used for a variety of physiologically and developmentally relevant purposes [21]. Nox1 was recently shown to play a crucial role in the redox regulation of canonical Wnt signaling in colon and intestinal epithelial cells [22]. We have also reported that five out of the six genes encoding Nox catalytic subunits expressed in F9 cells are RA-responsive and blocking Nox activity prevents PrE formation [7]. Despite the fact that reports have documented on the redox regulation of the Wnt pathway during axis formation in Xenopus embryos and in bone development in mouse [23,24], there remain questions for a universal role during embryogenesis [25–27]. Nevertheless, our data from F9 cells treated with H2O2 showing morphological and molecular changes, similar to those resulting from either RA treatment or from exposure to Wnt6 conditioned media [6,7], strongly suggest that ROS are involved in crosstalk with the canonical Wnt/ b-catenin pathway during the EMT that accompanies extraembryonic endoderm formation. Whether or not this crosstalk centers on redox regulation of canonical Wnt signaling involving NRX and Dvl was heretofore not known. Initially, real-time polymerase chain reaction (PCR) and immunoblot analysis were used to measure mRNA and protein levels, respectively, of the three Dvl isoforms in undifferentiated F9 cells and those induced by RA to form PrE. That no significant changes were detected between the two groups and the same being true for NRX, suggested that other mechanisms to regulate Wnt signaling were involved.
SANDIESON, HWANG, AND KELLY
Toward that end, the interaction between NRX and Dvl was determined using a co-immunoprecipitation assay of protein lysates from F9 cells cultured under reduced or oxidizing conditions. The results showed that cells treated with dithiothreitol (DTT) had more NRX bound to Dvl2 compared with those treated with H2O2. Further, knocking down NRX expression using an sh-RNA approach led to morphological and molecular changes indicative of PrE. Reduced NRX levels also correlated to an increase in Tcfs-Lefs-mediated transcription, an indicator of active canonical Wnt/b-catenin signaling. Further analysis using a molecular marker of differentiation and monitoring changes in cell morphology showed that cells depleted of NRX and subsequently treated with db-cAMP to increase protein kinase A activity completed the EMT and differentiated into PE. Together these results would indicate that a mechanism involving NRX is involved in maintaining F9 cells in an undifferentiated state, while the increase in ROS that follows RA treatment leads to its dissociation from Dvl; the latter now available to prime the requisite canonical Wnt pathway required for PrE induction.
Materials and Methods Cell culture F9 cells (ATCC) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 1% penicillin– streptomycin and 10% fetal bovine serum and incubated at 37C and 5% CO2. Cells were treated with dimethyl sulfoxide (DMSO), serving as a vehicle control, 10 - 7 M RA (alltrans; Sigma), or 0.05 and 0.1 mM H2O2 (EMD). Further analysis of cell differentiation was tested using RA plus 0.05 mM db-cAMP (Sigma), or H2O2 and db-cAMP.
Polymerase chain reaction Total RNA was collected using the RNeasy kit (Qiagen) and converted into first strand cDNA using reverse transcriptase qScript cDNA Supermix (Quanta). RNA was isolated following treatment of F9 cells with DMSO, RA (for 1, 2, 3, and 4 days), H2O2 (for 1, 2, and 3 days), or RA/H2O2 and db-cAMP. Primers were designed to L14 sense (5¢ GGGAGAGGTGGCCTCGGACGC) and antisense (5¢ GGC TGGCTTCACTCAAAGGCC), a constitutively expressed gene in F9 cells used as an internal control; NRX sense (5¢ TCTGCTCACCATTCTGGACA) and antisense (5¢ ACAC GCTGGAAAAGTCCAAG); Gata6 sense (5¢ CTCTGCAC GCTTTCCCTACT) and antisense (5¢ GTAGGTCGGGTG ATGGTGAT); thrombomodulin (TM) sense (5¢ CCAGGC TCTTACTCCTGTA) and antisense (5¢ TGGCACTGAAA CTCGCAGTT); Dvl1 sense (5¢ CATCCTCCTTCAGCAGC ATCAC) and antisense (5¢ ACTCGTACCATAGCGGGGC); Dvl2 sense (5¢ AGACTCGGATGAGGATGACA) and antisense (5¢ AAGGCTCCAGTCAGCGCA); and Dvl3 sense (5¢ TGGGGCTGTGGCAGCTGATGG) and antisense (5¢ GAG GCCATGGCTTTTACGATG) [28]. Primers were used with first strand cDNA template for reverse transcriptase–polymerase chain reaction (RT-PCR) and the following conditions: NRX—35 cycles of 30 s at 94C, 30 s at 55C, and 30 s at 72C; Dvl1—40 cycles of 30 s at 94C, 30 s at 55C, and 30 s at 72C; Dvl2—38 cycles of 30 s at 94C, 30 s at 55C, and 30 s at 72C; Dvl3—42 cycles of 30 s at 94C, 30 s at
REDOX REGULATION OF CANONICAL WNT SIGNALING
1039
60C, and 30 s at 72C; Gata6—35 cycles of 30 s at 94C, 30 s at 57C, and 30 s at 72C; TM—32 cycles of 30 s at 94C, 30 s at 57C, and 30 s at 72C. PCR products were analyzed on 1% agarose gels containing ethidium bromide and DNA was visualized using a FluorChem 8900 Gel Doc System (Alpha Innotech). All amplicons were sequenced at the Roberts’ Research Institute (UWO), to confirm their identity. Quantitative reverse transcription-PCR (qRTPCR) analysis was carried out in triplicate using the Rotor Gene 3000 (Corbett). Each reaction contained 50 ng of cDNA, 500 nM concentrations of each of the primers described above, and a PerfeCTa SYBR green PCR Fastmix (Quanta Biosciences). Gene expression analysis was performed using the comparative cycle threshold (Ct) method, and the fold changes were calculated relative to control DMSO-treated cells.
Antibody-protein complexes were immobilized on sepharose beads for 2 h at 4C and bound proteins washed thrice with NP-40 lysis buffer, before being separated by SDS– polyacrylamide gel electrophoresis (PAGE). Proteins were transferred to nitrocellulose membrane, which was blocked with TBS-T and 5% skim milk for 1 h, and then probed with anti-NRX antibody (1:250) overnight at 4C. Following extensive washing, membranes were incubated with an HRP-conjugated anti-goat antibody (1:5,000) for 2 h. Following signal detection, membranes were stripped, re-probed with an anti-Dvl2 antibody (1:250) and subsequent HRP-conjugated anti-mouse antibody (1:5,000), and signals detected by ECL.
Immunoblot analysis Protein lysates were collected in sample buffer containing 0.5 M Tris-HCl pH 6.8, 5% glycerol, 4 M 2-mercaptoethanol, 2% sodium dodecyl sulfate (SDS), and 1% Halt Protease Inhibitor Cocktail (Thermo Scientific). Protein concentrations were determined using a Bradford Assay and *40 mg of protein were separated on denaturing 10% polyacrylamide gels. Following electrophoresis, the proteins were electrophoretically transferred to nitrocellulose membranes using Tris-glycine transfer buffer containing 20% methanol. The membranes were blocked in Tris buffered saline containing 0.1% Tween 20 (TBS-T) and 5% skim milk for 1 h at room temperature. Membranes were first probed with primary antibody(s) overnight at 4C followed by three washes in TBS-T, and then with secondary antibody(s) for 2 h at room temperature. Signals were detected using the SuperSignal West Pico Chemiluminescent ECL Detection Kit and X-Omat Blue XB-1 Film (Kodak) or captured on a Molecular Imager Gel Doc XR System and imaged using Quantity One Software (Bio-Rad). The primary antibodies were directed against TROMA-1 (1:10; Developmental Studies Hybridoma Bank), b-actin (1:10,000; Santa Cruz), NRX (1:250; Santa Cruz), Dvl1 (1:250; Santa Cruz), Dvl2 (1:250; Santa Cruz), and Dvl3 (1:200; Santa Cruz) and dissolved in 5% bovine serum albumin and TBS-T. Secondary antibodies including HRPconjugated anti-goat, anti-rat, and anti-mouse (1:5,000; Pierce) were dissolved in 5% skim milk and TBS-T.
sh-NRX knockdown The following sequence derived from the mouse NRX cDNA was used for the knockdown studies: sh-NRX (AA)GATCATTGCCAAGTACAAA; for the scrambled control the following sequence was used: sc-NRX (AA)GATCATTGCACAGTACAAA [20]. Oligonucleotide primers designed to amplify this sequence was used with PCR to clone the NRX sh-RNA into the pRS sh-RNA vector (a gift from Dr. Robert Cumming, UWO). Cells were transfected with sh-NRX, sc-NRX, or CMV-GFP constructs, the latter two serving as negative and transfection efficiency controls, respectively, using Lipofectamine 2000 and according to the manufacturer’s protocol. F9 cells grown to *90% confluency were transfected with 10 mL of Lipofectamine 2000 and 4 mg of each of the constructs in 2 mL of Opti-MEM. At 5 h posttransfection Opti-MEM was replaced with complete media and the cells cultured for 3 days. For differentiation to PE analysis, Opti-MEM was replaced with complete media containing 0.05 mM db-cAMP. RNA and protein collection was done as described above.
Tcf/Lef reporter assay Cells transfected with pGL3-BARL and then treated with 10 - 7 M RA, or co-transfected with equal amounts of either pGL3-BARL and sc-NRX or pGL3-BARL and sh-NRX, were prepared 24 h post-treatment or post-transfection using the Dual-Glo Luciferase Assay System as per the manufacturer’s instructions (Promega). Luciferase expression was quantified using the GloMax Multi Detection System (Promega). Cells were also co-transfected with pRL-TK to normalize luciferase levels.
Co-immunoprecipitation
Microscopy
Cells grown to *80% confluency were treated with 1 mM DTT or 1 mM H2O2 for 15 min and protein lysates were collected in nonyl phenoxypolyethoxylethanol-40 (NP40) lysis buffer containing 50 mM Tris pH 7.2, 100 mM NaCl, 0.1% IGEPAL (Sigma), 10% glycerol, 1 mM EDTA, and 0.1 mM PMSF. Lysates were incubated in NP-40 lysis buffer for 10 min then passed through a 25-gauge needle several times and then centrifuged for 10 min at 4C. Protein lysates (2 mg/mL) were pre-cleared using a 20-mL sepharose bead volume (Protein A/G PLUS Agarose Immunoprecipitation Reagent; Santa Cruz) for 1 h, and then treated overnight at 4C with either 1 mg of anti-Dvl2 antibody or 1 mg of IgG normal mouse serum (Santa Cruz), as a control.
Cells were examined by phase contrast microscopy using a Zeiss Axio Observer A1 inverted microscope and images were captured using a QImaging Retiga CCD camera. All images were assembled as plates using Adobe Photoshop CS5 and Adobe Illustrator CS5.
Statistical analysis Densitometric analyses of immunoblots and qRT-PCR data were compiled from three independent biological replicate experiments performed on separate occasions. Comparisons of data between the control and treated, or transfected groups were performed using a one-way ANOVA and Tukey’s HSD
1040
post hoc tests (SPSS v19). Data are presented as mean – standard error of the mean. The P values were one-sided and considered statistically significant at the 0.05 level.
Results Exogenous agents induce extraembryonic endoderm Previous work in our lab has demonstrated an accompanied increase in ROS levels when F9 cells are treated with RA to induce PrE differentiation [7]. Moreover, cells also differentiate into PrE when they are treated with H2O2. To confirm these results and to determine whether these ROS-
SANDIESON, HWANG, AND KELLY
induced cells were competent to form PE, thus completing the EMT, cells were first treated with RA or H2O2 and then examined for morphological changes that are hallmark of PrE differentiation (Fig. 1A). Untreated cells or those treated with the DMSO vehicle were similar in morphology, appearing round in shape, and amassed into compact bodies. RA-treated cells were examined over 4 days and in this time they had adopted a more flattened morphology and had begun to spread out over the plate. Cells treated with 0.1 mM H2O2 for 3 consecutive days shared the morphological features seen in the RA treatment, suggesting they had either begun or had differentiated into PrE. This was confirmed by immunoblot analysis that showed TROMA-1
FIG. 1. H2O2-induced primitive endoderm (PrE) cells are competent to form parietal endoderm (PE). (A) F9 cells treated with dimethyl sulfoxide (DMSO) grow in tightly compact groups reminiscent of untreated cells, whereas those treated with H2O2 (0.1 mM) show a flattened, more elongated morphology, similar to that seen following retinoic acid (RA) treatment. RA and dibutyryl cyclic adenosine monophosphate (db-cAMP)-treated cells are more refractile in appearance than those treated with RA alone. Similarities in refractile properties were seen in cells treated with H2O2 and db-cAMP (0.05 mM). Scale bar = 50 mm: white arrows = filopodia. (B) Immunoblot analysis with the TROMA-1 antibody to detect the PrE marker endo-A cytokeratin shows an increase in endo-A protein levels from day 2 through 4 of RA treatment. (C) H2O2-treated cells also express endo-A, but signals appear 1 day earlier than in the RA treatment. (D) Reverse transcriptase–polymerase chain reaction (RT-PCR) analysis shows thrombomodulin (TM), a marker of PE, is expressed in cells treated with RA and db-cAMP (lane 5). Expression is also detected when cells were treated with either H2O2 concentration together with db-cAMP (lanes 6 and 7). H2O2 by itself had no obvious effect on TM expression. Data are representative of three independent experiments.
REDOX REGULATION OF CANONICAL WNT SIGNALING
1041
signals increasing in response to RA (Fig. 1B). The TROMA-1 antibody detects endo-A cytokeratin that assembles into intermediate filaments seen in PrE cells [6,7,29]. The presence of the increasing TROMA-1 signal in cells treated with H2O2 indicated that cells had been induced to form PrE (Fig. 1C), confirming our previous work. As expected, TROMA-1 signals were not seen in DMSO-treated control cells. Confident that increasing ROS levels in undifferentiated F9 cells led to differentiation, the next step was to determine whether these cells remained competent to complete the EMT and form PE. Although the ability to chemically induce F9 cells to form PE is well known [5] no report has documented whether H2O2 in the presence of dbcAMP would have the same outcome. To test this, cells were treated with RA and then db-cAMP as a control to induce PE, or with H2O2 and db-cAMP and examined by phase contrast microscopy (Fig. 1A). Our previous work had reported that subtle morphological differences exist between PrE and PE, specifically the refractile nature of PE cells and the presence of filopodia [8]. Both of these were obvious when the cells were treated with RA and then with dbcAMP, and although the H2O2 and db-cAMP-treated cells looked refractile, the difficulty in seeing filopodia extending from them required us to examine for changes in a molecular marker of PE. TM was selected as a PE marker since its expression increases 4-fold over that in PrE [30]. RT-PCR was used to detect TM and as expected an amplicon corresponding to TM was detected in the RA and db-cAMPpositive control (Fig. 1D). Amplicons were also seen in the two H2O2 treatments containing db-cAMP, but not in the DMSO negative control or in samples from cells treated with either RA or H2O2 alone. Together, these results indicated that in the absence of RA, cells treated with H2O2 had differentiated into PrE and were competent to form PE when treated with db-cAMP.
Profiling Dvl levels during PrE differentiation When the canonical Wnt signaling pathway is activated Dvl is recruited to the plasma membrane and acts to disassemble a destruction complex that otherwise would target b-catenin for proteasomal degradation. Since RA treatment of F9 cells is known to affect the expression of many genes [10], including Wnt6 [6], the possibility existed that other members of the canonical pathway and in particular Dvl may also be regulated by RA. To begin, endpoint PCR was used to confirm that the three Dvl genes were expressed in untreated F9 cells and those that were treated with RA to induce PrE (Fig. 2). Expression of Dvl1, Dvl2, and Dvl3 was seen in cells treated with DMSO and in those treated with RA for 1–4 days (Fig. 2A). Sequencing confirmed that the amplicons were cDNAs specific to the three Dvl genes (data not shown). L14 served as a loading control as it is constitutively expressed in all cells. The relative signal intensity of the Dvl amplicons appeared similar between the RA-treated and DMSO control cells (Fig. 2A), which prompted us to use qRT-PCR to detect subtle changes (Fig. 2B). The expression levels of Dvl1, Dvl2, and Dvl3 were normalized to L14 and the results showed that there were no significant changes in expression between treatments (Fig. 2B). To ensure RA had in fact induced cells to form PrE, cDNAs used in the Dvl survey were used for qRT-PCR analysis with
FIG. 2. Dishevelled (Dvl)1, Dvl2, and Dvl3 mRNA levels are not affected by RA treatment. F9 cells were treated with DMSO or RA (10 - 7 M) for 1–4 days and total RNA was collected, reverse transcribed into first strand cDNA, and used as template for PCR analysis with primers specific to Dvl1, Dvl2, and Dvl3. (A) RT-PCR analysis shows that all three Dvl genes appear to be equally expressed in both DMSO and RA-treated cells. L14 is a constitutively expressed gene and is used as a loading control. (B) Quantitative reverse transcription-PCR (qRT-PCR) analysis confirms that there was no significant difference in the transcript levels of any Dvl, while (C) Gata6 expression, an RA-responsive gene, shows significant increase as early as 2 days post RA treatment. *P < 0.05. Data represent the mean – standard error of three independent experiments.
primers to Gata6, a known RA-responsive gene and one whose expression is essential for the extraembryonic endoderm lineage [8,31]. qRT-PCR results showed that Gata6 expression increased at 1 day post-RA treatment and continued to increase significantly through day 4 (Fig. 2C).
1042
Thus, cells had responded to the RA, but this had no bearing on the expression of the three Dvl genes. Since there were no significant changes in the levels of Dvl1, 2, or 3 mRNA in response to RA, we then used immunoblot analysis to investigate whether or not the steady state levels in protein change under the same conditions (Fig. 3). Previous reports have shown that simply increasing or decreasing the level of Dvl proteins influences Wnt signaling in a positive or negative manner, respectively [18,24]. Antibodies against each specific Dvl were used on blots containing proteins isolated from DMSO- or RA-treated cells (Fig. 3A). A b-actin antibody was used to ensure equal loading between samples. Results showed that Dvl1, 2, and 3 were present in both vehicle-treated and RA-treated cells (Fig. 3A). Further, densitometry analysis confirmed that there were no significant changes in the levels of each Dvl isoform regardless of treatment (Fig. 3B). Taken together, these results would indicate that RA does not influence Dvl1–3 expression and the proteins encoded by these genes are present regardless of whether the cells are in an undifferentiated state or if they had been induced to form PrE.
FIG. 3. Dvl1, Dvl2, and Dvl3 protein levels are not affected by RA treatment. F9 cells were treated with DMSO or RA (10 - 7 M) for 1–4 days and protein lysates were collected and used for immunoblot analysis with antibodies against Dvl1, Dvl2 and Dvl3. (A) Immunoblot analysis shows that the levels of Dvl1, Dvl2, and Dvl3 in DMSO and RA treatments are relatively equal. b-Actin served as a loading control. (B) Densitometry analysis confirms that there were no significant changes in Dvl1, Dvl2, or Dvl3 protein levels following either DMSO or RA treatments. Data represent the mean – standard error of three independent experiments.
SANDIESON, HWANG, AND KELLY
NRX mRNA and protein expression is not affected by RA treatment Since the Dvl genes were not RA-responsive and RA had no apparent effect on the steady state levels of the three isoforms the focus turned to NRX, a protein that is redox sensitive [32] and known to interact with Dvl [20]. NRX when bound to Dvl impedes canonical Wnt signaling [20] and the latter is required for F9 cells to differentiate into PrE [6,12]. Although reports indicate that the negative regulation imposed by NRX on the Wnt pathway is alleviated in response to changes in redox environment of the cell [20], the other possibilities including depleting NRX levels or downregulating the expression of the NRX gene in response to RA would have the same effect. It is interesting to note that there is hyperactive Wnt signaling in osteoblasts homozygous null for NRX [24]. Although we know H2O2 is capable of inducing PrE and have proposed that an increase in its levels results in the dissociation of NRX from Dvl, it was still necessary to eliminate the possibilities that either RA was negatively regulating the NRX gene or whether the same response was at the level of the protein. Toward that end and to first examine whether the expression of NRX changed in response to RA, cells were treated with RA for 1–4 days and total RNA was collected for endpoint PCR analysis. Results showed NRX amplicons of the expected size in DMSO-treated (undifferentiated) and RA-treated cells (Fig. 4A). Further, the relative levels appeared to remain constant following RA treatment prompting further analysis by qRT-PCR. Results, normalized to the expression of the L14 gene, showed there was no significant change in NRX expression between DMSO- and RA-treated cells (Fig. 4B). Protein lysates were collected from cells as treated above and used for immunoblot analysis with an NRX antibody to determine whether the steady state levels of the protein change in response to RA. An antibody against b-actin was used to probe blots to ensure equal protein loading between samples. Results showed NRX bands of the expected molecular mass in DMSO- and RAtreated cells (Fig. 4C). The intensity of the bands does not appear to be affected by RA and densitometry analysis confirmed that there were no significant changes between treatments (Fig. 4C). These results confirm that distinct changes in the expression of either Dvl or NRX do not have a role in the differentiation of PrE. Further, if NRX is involved in maintaining F9 cells in an undifferentiated state when Wnt ligands are absent, and with the apparent inability of RA to alter the steady state levels of either the messages or the proteins they encode, then some other post-translational mechanism of regulation must be in effect.
Interaction between NRX and Dvl2 is redox regulated Since protein and mRNA levels of NRX and Dvl1, Dvl2, and Dvl3 do not appear to change in response to RA then the third possibility that in response to H2O2 a post-translation modification to NRX leads to its dissociation of Dvl, had to be tested. To address this, F9 cells were cultured and then treated with agents to alter their oxidizing (H2O2) or reducing (DTT) environment. Whole cell lysates were isolated
REDOX REGULATION OF CANONICAL WNT SIGNALING
1043
FIG. 4. Nucleoredoxin (NRX) mRNA and protein levels are not affected by RA treatment. F9 cells were treated with DMSO or RA (10 - 7 M) for 1–4 days. Total RNA was collected, reverse transcribed into first strand cDNA and used as template for PCR analysis with primers designed to NRX. Total protein lysates were also collected and used for immunoblot analysis with an antibody to NRX. (A) RT-PCR results show that the NRX transcript is present in relatively equal amounts in cells treated with either DMSO or RA, and (B) qRT-PCR data confirmed that there were no significant differences in transcript levels between treatments. (C) Immunoblot analysis show that NRX protein levels did not appear to be affected by RA treatment, and this was confirmed by densitometry readings. Data represent the mean – standard error of three independent experiments.
and proteins immunoprecipitated using an antibody to Dvl2, the major Dvl isoform [18]. Bound proteins were separated by SDS-PAGE and then transferred to membranes, which were then probed with either a NRX or Dvl2 antibody. Normal mouse IgG, used as a negative control to assess for non-specific binding showed a band on the NRX blot, but there was no distinct signal for Dvl2 (IgG lane, Fig. 5A). The same weak signal for NRX was seen when cells were treated with H2O2 (lane 4), but in this case there was a distinct Dvl band to indicate that the immunoprecipitation had pulled down Dvl2. Similarly, a distinct band corresponding to NRX was immunoprecipitated by the Dvl2 antibody in lysates of cells treated with DMSO (lane 2). The intensity of this band dramatically increased under the reducing conditions with DTT (lane 3). The b-actin signal representing the loading control was relatively equal in all lanes. Densitometry analysis, representative of NRX bound to immunoprecipitated Dvl2 and normalized to the levels of immunoprecipitated Dvl2, confirmed (P < 0.05) that DTT had in fact augmented the interaction between Dvl2 and NRX while H2O2 treatment greatly reduced it (Fig. 5B). These results showing that NRX interacts with Dvl2 in F9 cells, together with those from our earlier study where H2O2 treatment enhances TOPFlash activity while antioxidants quench RA-induced activity [7], provide evidence that the redox regulation of NRX dictates the degree of binding to Dvl, and this is likely to impact canonical Wnt signaling.
Loss of NRX expression leads to PrE differentiation Studies have indicated that mouse NRX - / - osteoblasts exhibit hyperactive Wnt signaling while cardiac cells from the same pups do not [24]. Our data would indicate that in undifferentiated F9 cells NRX is bound to Dvl2 and the increase in the levels of ROS, either through exogenous or
endogenous application resulting from RA treatment, alters the ability of NRX to bind Dvl, thus favoring activation of the canonical Wnt pathway as seen in the NRX - / - osteoblasts. In this manner, the loss of NRX would free up a pool of Dvl, thereby either priming the latter to be available if and when the Wnt ligand presents itself to a Fzd receptor or in the extreme case to directly activate the pathway in the absence of the ligand as seen in Dvl overexpression studies [18,33]. To investigate this, NRX was knocked down by transfecting sh-NRX into F9 cells. The efficiency of the knockdown was evaluated by qRT-PCR (Fig. 6A). As noted earlier, treating cells with DMSO or RA had no effect on NRX levels and the same was true for RA and db-cAMP or db-cAMP by itself (described below). In contrast, NRX amplicons were not obvious when cells were transfected with sh-NRX (lanes 6 and 7) and this significant decrease in expression compared with that in cells transfected with the sc-NRX scrambled control or sc-NRX and db-cAMP (lanes 4 and 5, respectively) was statistically confirmed by qRT-PCR. Confident that the sh-NRX would effectively knock down endogenous expression, the effects on cell morphology were examined by phase contrast microscopy (Fig. 6B). F9 cells transfected with the sc-NRX control appeared morphologically similar to those treated with DMSO. Specifically, cells were round in shape and grew in compact masses. In contrast, those transfected with sh-NRX were elongated and flattened out, which are characteristic changes in morphology associated with RA-induced PrE cells [8]. The ability of NRX-depleted cells to differentiate into PrE was confirmed by immunoblot analysis (Fig. 6C). DMSO or RA treatment had no affect on the levels of NRX while cells transfected with sh-NRX showed reduced NRX levels. Immunoblot analysis with the TROMA-1 antibody to detect the endo-A PrE marker showed, as expected, a strong signal in the RA lane. TROMA-1 levels appeared higher in RA-treated cells
1044
SANDIESON, HWANG, AND KELLY
having elevated b-catenin/Tcf activity when NRX is depleted [20]. We employed a Tcf luciferase assay to confirm our hypothesis that an increase in Tcfs-Lefs activity, as a result of NRX depletion, contributes to PrE formation (Fig. 7). F9 cells were co-transfected with pGL3-BARL and a Renilla luciferase construct and then treated with RA, or co-transfected with sc-NRX or sh-NRX. Results showed that RA had a 2.5-fold increase in luciferase activity compared with the DMSO control. Likewise, there was a 1.8-fold increase in luciferase activity in cells depleted of NRX relative to those transfected with the sc-NRX control. Thus, depleting F9 cells of NRX is sufficient to activate canonical Wnt/b-catenin signaling and this trigger sets in motion the EMT required for PrE formation.
Addition of db-cAMP to sh-NRX-transfected cells induces PE
FIG. 5. NRX binds Dvl2 in a redox-dependent manner. Cells were either untreated or treated with dithiothreitol (DTT) (1 mM) or H2O2 (1 mM) for 15 min and protein lysates were collected for co-immunoprecipitation analysis. Protein complexes were immunoprecipitated with an antiDvl2 antibody or with normal mouse IgG as a control. (A) Immunoblot analysis show that compared to controls, the relative amount of NRX that was pulled down with Dvl2 appears less when cells were treated with H2O2 (lane 4). In contrast, cells treated with DTT appear to have much more NRX in the Dvl2 complex (lane 3) compared with controls lanes 1 (IgG) and 2 (untreated). (B) Densitometry analysis confirmed that NRX protein levels were significantly less in H2O2-treated cells than those treated with DTT. *P < 0.05. Data represent the mean – standard error of three independent experiments.
than those treated with DMSO (Fig. 6C). The signal also appeared higher in cells transfected with sh-NRX than those transfected with the sc-NRX control. Densitometry data confirmed these results and showed there was not only a significant increase in TROMA-1 levels in RA-treated cells compared to those seen in DMSO treatments, but also a significant increase resulting from the NRX knockdown. Together the molecular and morphological data confirmed that the NRX knockdown in the absence of RA was sufficient to induce F9 cells to form PrE.
Loss of NRX correlates to an increase in canonical Wnt signaling activity The evidence we have shown so far appears to be in agreement with an earlier study showing NIH3T3 cells
PrE is an intermediate step and the completion of EMT is required for cells to adopt the parietal fate [6]. The data would indicate that depleting cells of NRX was sufficient to induce F9 cells to form PrE, but the questions remained as to whether or not these cells were in fact PrE in nature and if so were they competent to complete EMT and differentiate into PE. To answer these questions, F9 cells transfected with either sc-NRX or sh-NRX were treated with db-cAMP and their morphology and molecular characteristics assessed by phase contrast microscopy and qRT-PCR, respectively (Fig. 8). Those transfected with sc-NRX and treated with dbcAMP were morphologically indistinguishable from those treated with DMSO (data not shown). In contrast, cells transfected with sh-NRX and treated with db-cAMP were morphologically similar to those treated with RA and dbcAMP (Fig. 8A). Further analysis using qRT-PCR showed the upregulated expression of the PE marker TM in cells transfected with sh-NRX and db-cAMP. Although the increase was not as dramatic as that seen in PE cells induced by RA and db-cAMP, the amount was significant compared with that in the other treatments (Fig. 8B). Thus, the effect of knocking down NRX in the presence of db-cAMP on PE formation may not be as robust as treating cells with RA and db-cAMP, it is nevertheless sufficient to do so.
Discussion The canonical Wnt/b-catenin signaling pathway has been studied in great detail and numerous reports underlie its importance in keystone events required for normal embryonic development and those in adult life [13]. Wnt signaling is also at the root of several human diseases and its importance in the maintenance of embryonic, adult, and cancer stem cells has gained considerable attention in the last few years [34]. For these reasons it is important to identify how Wnt pathways are regulated under normal conditions in the eventual effort of being able to target these regulatory mechanisms to prevent the onset and/or progression of the disease state. Toward that end we have been using the F9 teratocarcinoma stem cell model to study how the activation of canonical Wnt/b-catenin signaling in naı¨ve cells leads to the initiation of an EMT required to pattern extraembryonic endoderm in the mouse embryo. The F9 cell line is a wellestablished experimental in vitro model system to study this
REDOX REGULATION OF CANONICAL WNT SIGNALING
1045
FIG. 6. NRX depletion induces PrE differentiation. (A) Total RNA from F9 cells transfected with sh-NRX or the scrambled control, sc-NRX, or transfected and then treated with db-cAMP (0.05 mM), or from cells treated with DMSO, RA (10 - 7 M), or RA and db-cAMP, were collected, reverse transcribed into first strand cDNA and used as a template for PCR and qRT-PCR using primers specific to NRX and L14 (control). An NRX amplicon appears in all lanes except those from cells that had been transfected with the sh-NRX plasmid (lanes 6 and 7). qRT-PCR confirmed that the decrease in NRX expression, as a result of the sh-NRX transfection, is significant. (B) F9 cells transfected with sc-NRX are morphologically similar to cells treated with DMSO, appearing in tightly compact groups reminiscent of undifferentiated cells. In contrast, F9 cells transfected with sh-NRX show a flattened, more elongated morphology, comparable to RA-induced PrE cells. Scale bar = 50 mm. (C) F9 cells were transfected with sh-NRX or sc-NRX, or treated with DMSO or RA, and protein lysates collected to detect the PrE marker endo-A cytokeratin. Immunoblot analysis with the TROMA-1 antibody, which detects endo-A, shows little to no endo-A signal in the DMSO or sc-NRX controls. Signals are seen in RA-treated cells and in those transfected with the sh-NRX. An antibody to NRX confirmed the efficiency of the knockdown, while one to b-actin ensured equal loading between samples. (C) Densitometry analysis confirmed that there was a significant increase in the TROMA-1 positive signal when cells were transfected with RA compared with DMSO, and the same was true for the endo-A levels in the sh-NRX sample compared to the sc-NRX control. *P < 0.05. Data represent the mean – standard error of three independent experiments.
EMT [5] and despite the fact that there are few and reliable definitive PrE markers, inducing F9 cells by exogenous chemical agents or ectopically expressed proteins and then treating them with db-cAMP causes distinct morphological changes and the appearance of definitive PE markers; dbcAMP alone has no effect on differentiation [6]. We have identified Wnt6 as the ligand at the center of the EMT [6], and the transcription factors responsible for the upregulation of the Wnt6 gene [8]. Moreover, we know that differentiation is accompanied by a concomitant increase in the levels of ROS, which is obligatory for this EMT to proceed [7] and have now turned our attention to test whether or not the candidate redox protein NRX modulates canonical Wnt signaling during the differentiation of F9 cells into extraembryonic endoderm.
NRX is a member of the thioredoxin (TRX) family of evolutionarily conserved and ubiquitously expressed proteins that contain a redox active cysteine–glycine–proline– cysteine site [32]. TRX catalyzes NADP-dependent reductions of disulfide bridges and functions as a disulfide oxidoreductase. Under oxidizing conditions the thiol functional group on the two cysteine residues form a disulfide bridge capable of changing protein function or protein–protein interactions [35]. The importance of TRX in embryogenesis is evident from the studies showing that the knockout of either of the two TRX genes in mouse embryos is lethal with TRX1 - / - embryos dying shortly after implantation [36,37]. It is also interesting to note that although NRX - / - pups show embryonic defects they die later around birth [24]. Although the whole mount in situ
1046
FIG. 7. NRX depletion leads to increased b-catenin/Tcell-factor (Tcf ) dependent transcription. Protein lysates from cells transfected with pGL3-BARL and then treated with RA, from cells co-transfected with pGL3-BARL and the sc-NRX control, or from those transfected with the sh-NRX plasmid, were collected and processed for luciferase activity 24 h post-RA treatment or transfection. Cells treated with RA had 2.5-fold increase in luciferase activity relative to DMSO-treated control cells, while sh-NRX transfected cells showed 1.8-fold increase relative to the sc-NRX-transfected controls. Data represent the mean fold change – standard error normalized for Renilla luciferase activity of three independent experiments. *P < 0.05. hybridizations studies indicate that NRX plays a role in patterning various tissues/regions during mouse embryogenesis [32,38], nothing until now has been reported on its involvement in the early events associated with extraembryonic endoderm development. That ROS can induce F9 cells to form PrE [7] (Fig. 1), in a manner that recapitulates the events resulting from exposing F9 cells to Wnt6conditioned media [6], prompted us to determine whether the redox state of NRX regulates canonical Wnt/b-catenin signaling. Evidence from cell culture and from Xenopus and mouse embryos indicates that one form of regulation centers on Dvl and the redox state of NRX [20,23,24]. We pursued this line of evidence, but first tested the possibility that the three Dvl genes (Fig. 2) or the NRX gene was RA responsive (Fig. 4A, B). Although it is well known that RA treatment of F9 cells affects the expression of numerous genes some of which directly impact the Wnt signaling pathway [6,10] our studies, focussing on the Dvl (Fig. 2) or NRX (Fig. 4A, B) genes, did not detect any obvious changes in expression. The focus then turned to the possibility that changes in the levels of the proteins encoded by these genes were responsible for initiating the EMT. There is precedence for this as increased Dvl2 levels are known to activate Wnt signaling in pancreatic cancer [39] and more specifically, evidence exists that overexpressing any of the three Dvl genes in F9 leads to an increase in Tcfs-Lefs-mediated transcriptional activity [18], a direct readout of activated Wnt-b-catenin signaling [7]. The immunoblot analysis (Figs. 3 and 4C) did not reveal any obvious differences in Dvl or NRX protein levels in response to RA, which prompted us to investigate the idea that the post-translational modification to NRX, as initially
SANDIESON, HWANG, AND KELLY
proposed by Funato et al. [20], was responsible for regulating canonical Wnt signaling. In their inaugural report, Funato et al. [20] found that the amount of Dvl1 bound to NRX in NIH3T3 cells increases under reducing conditions and decreases when cells are subjected to H2O2. Thus, this reduced redox state of the cell would be expected to augment the negative regulation of b-catenin in the Wnt pathway. Oxidizing conditions on the other hand would favor disulfide bond formation in NRX, changing its confirmation and precluding its association with Dvl. In this manner NRX along with Dvl would serve as a lynchpin in both canonical and non-canonical Wnt signaling and while the former is supported by evidence showing NRX - / - causes perinatal lethality due to dysregulation of Wnt/b-catenin signaling [24], there is precedence for the latter in non-canonical signaling controlling PCP [23]. Although these NRX knockout studies highlight one means of regulating canonical Wnt signaling, which interestingly is either in a negative or positive manner depending on the cell type, they do not address if there were any defects associated with the EMT linked to extraembryonic endoderm formation. Our data with the F9 model showing oxidizing conditions favoring the dissociation of NRX from Dvl2 (Fig. 5) and the knockdown of NRX leading to the molecular and morphological changes that recapitulate those that occur as a result of RA treatment (Fig. 6) or when cells are treated with Wnt6-conditioned media [6], would indicate NRX acts to negatively regulate Wnt signaling during extraembryonic endoderm formation. That NRX depleted cells have increased Tcfs-Lefs-mediated transcriptional activity (Fig. 7) lends support to the idea that NRX in the reduced state serves as a negative regulator of the Wnt pathway. In F9 cells the loss in stemness following the downregulation of Oct4, Klf4 and Nanog expression is the result of the activation of Akt by RA [40]. It is interesting to note that increased Akt signaling and concomitant decrease in GSK3b activity also occurs when cellular H2O2 levels increase [41]. Under these conditions b-catenin levels would also be expected to increase. This has not been examined in reference to F9 cells, but together it is easy to envision how increasing the H2O2 load and changing the redox state of the cell are likely to have a considerable influence on multiple signaling events. In the case of extraembryonic endoderm formation these changes lead to PrE formation with cells remaining competent to be further induced to PE under the appropriate conditions (Fig. 8). Together, our working model proposes that in undifferentiated F9 cells NRX is bound to Dvl, thereby preventing the latter from destabilizing the b-catenin destruction complex. RA treatment induces differentiation where changes in gene expression including the upregulation of Gata6, FoxA2, and Wnt6, and a concomitant increase in Nox activity leads to the generation of ROS [7]. An increase in ROS levels is sufficient and necessary to promote the dissociation of Dvl from NRX, which allows the former to await recruitment to the plasma membrane following binding of the Wnt6 ligand to its Fzd receptor and LRP5/6 co-receptor. The increase in ROS load also facilitates an increase in Akt activity and loss of stemness [40], while inhibiting constitutively active GSK3b. Together with a now active Wnt pathway the increase in b-catenin levels would lead to the subsequent activation of the Tcfs-Lefs dependent
REDOX REGULATION OF CANONICAL WNT SIGNALING
1047
FIG. 8. Cells transfected with sh-NRX are competent to form PE. (A) F9 cells treated with RA and db-cAMP form PE, where the cells have flattened out over the dish and show multiple protrusions. In contrast, cells transfected with the scNRX control and treated with db-cAMP grow in tightly compact groups, similar to that seen when cells are treated with DMSO alone (Fig. 6B). Cells transfected with the sh-NRX and then treated with db-cAMP share morphological features in common with the RA and db-cAMP-induced PE, specifically the protrusions and the refractile appearance. Scale bar = 50 mm. (B) Total RNA from F9 cells treated with DMSO, RA (10 - 7 M), or RA and db-cAMP (0.05 mM), transfected with the sc-NRX control, transfected with sh-NRX, or transfected with sc-NRX or sh-NRX and then treated with dbcAMP, was isolated, reverse transcribed into first strand cDNA, and used as template for PCR analysis with primers designed to the PE marker, TM. The constitutively expressed L14 gene was used a loading control. RT-PCR analysis shows that TM is upregulated in PE cells that were induced by RA and db-cAMP (lane 3). A slight increase is also seen in cells transfected with sh-NRX and then treated with db-cAMP (lane 7). qRT-PCR analysis confirmed that these increases in TM expression seen in lanes 3 and 7 are significant. *P < 0.05. Data represent the mean – standard error of three independent experiments.
regulation of Wnt target genes, which encode proteins that promote the EMT associated with PrE formation. This model is of course in its simplest form and the question arises as to why naı¨ve cells need the negative regulation imparted by NRX on Dvl when the Wnt ligand is absent? Although there are many plausible explanations we favor the idea that it is a failsafe mechanism that prevents aberrant activation of the pathway in the absence of the Wnt6 ligand. Altering this redox balance and the Wnt pathway, as in the case of oxidation resulting from an increase in endogenous levels of ROS, would therefore have profound and deleterious effects to the embryo. Although Nox1 overexpression is known to reverse the effects of NRX overexpression in intestinal and colon epithelial cells [22] the source that produces the ROS in response to RA in F9 cells is presently not known and is under current investigation. Regardless of the source, however, it is important to note that the regulation of ROS levels in the embryo is essential since the inability to modulate them not only puts the usual nucleic acid, protein, and lipid targets at risk, but also the multiple redox-regulated signaling pathways that are required for normal embryogen-
esis. Thus, our study not only provides new insight into how this regulation may effect extraembryonic endoderm differentiation in the mammalian embryo, it also gives us a better understanding of the relationship between ROS and the aberrant activation of signal transduction pathways involved in human pathophysiology.
Acknowledgments G.M.K. would like to thank the Natural Sciences and Engineering Research Council of Canada for funding. The authors also acknowledge the Ontario Graduate Scholarship Program and the University of Western Ontario, Faculty of Graduate and Postgraduate Studies for support to L.S. and J.T.K.H. Finally, we thank Drs. Robert Cumming and Jim Karagiannis for their advice and technical assistance with this project as well as the suggestions made by reviewers.
Author Disclosure Statement The authors declare no conflict of interest.
1048
References 1. Lu CC, J Brennan and EJ Robertson. (2001). From fertilization to gastrulation: axis formation in the mouse embryo. Curr Opin Genet Dev 11:384–392. 2. Niwa H, Y Toyooka, D Shimosato, D Strumpf, K Takahashi, R Yagi and J Rossant. (2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123:917–929. 3. Tam PP and DA Loebel. (2007). Gene function in mouse embryogenesis: get set for gastrulation. Nat Rev Genet 8:368–381. 4. Verheijen MH and LH Defize. (1999). Signals governing extraembryonic endoderm formation in the mouse: involvement of the type 1 parathyroid hormone-related peptide (PTHrP) receptor, p21Ras and cell adhesion molecules. Int J Dev Biol 43:711–721. 5. Strickland S, KK Smith and KR Marotti. (1980). Hormonal induction of differentiation in teratocarcinoma stem cells: generation of parietal endoderm by retinoic acid and dibutyryl cAMP. Cell 21:347–355. 6. Krawetz R and GM Kelly. (2008). Wnt6 induces the specification and epithelialization of F9 embryonal carcinoma cells to primitive endoderm. Cell Signal 20:506–517. 7. Wen JW, JT Hwang and GM Kelly. (2012). Reactive oxygen species and Wnt signalling crosstalk patterns mouse extraembryonic endoderm. Cell Signal 24:2337–2348. 8. Hwang JT and GM Kelly. (2012). GATA6 and FOXA2 regulate Wnt6 expression during extraembryonic endoderm formation. Stem Cells Dev 21:3220–3232. 9. Strickland S and V Mahdavi. (1978). The induction of differentiation in teratocarcinoma stem cells by retinoic acid. Cell 15:393–403. 10. Su D and LJ Gudas. (2008). Gene expression profiling elucidates a specific role for RARgamma in the retinoic acid-induced differentiation of F9 teratocarcinoma stem cells. Biochem Pharmacol 75:1129–1160. 11. Krawetz R and GM Kelly. (2009). Coordinate Galpha13 and Wnt6-beta-catenin signaling in F9 embryonal carcinoma cells is required for primitive endoderm differentiation. Biochem Cell Biol 87:567–580. 12. Liu T, YN Lee, CC Malbon and HY Wang. (2002). Activation of the beta-catenin/Lef-Tcf pathway is obligate for formation of primitive endoderm by mouse F9 totipotent teratocarcinoma cells in response to retinoic acid. J Biol Chem 277:30887–30891. 13. Anastas JN and RT Moon. (2013). WNT signalling pathways as therapeutic targets in cancer. Nat Rev Cancer 13: 11–26. 14. Bikkavilli RK, ME Feigin and CC Malbon. (2008). G alpha o mediates WNT-JNK signaling through dishevelled 1 and 3, RhoA family members, and MEKK 1 and 4 in mammalian cells. J Cell Sci 121:234–245. 15. LaMonica K, M Bass and L Grabel. (2009). The planar cell polarity pathway directs parietal endoderm migration. Dev Biol 330:44–53. 16. Wynshaw-Boris A. (2012). Dishevelled: in vivo roles of a multifunctional gene family during development. Curr Top Dev Biol 101:213–235. 17. Etheridge SL, S Ray, S Li, NS Hamblet, N Lijam, M Tsang, J Greer, N Kardos, J Wang, et al. (2008). Murine dishevelled 3 functions in redundant pathways with dishevelled 1 and 2 in normal cardiac outflow tract, cochlea, and neural tube development. PLoS Genet 4:e1000259.
SANDIESON, HWANG, AND KELLY
18. Lee YN, Y Gao and HY Wang. (2008). Differential mediation of the Wnt canonical pathway by mammalian Dishevelleds-1, -2, and -3. Cell Signal 20:443–452. 19. Gao C and YG Chen. (2010). Dishevelled: the hub of Wnt signaling. Cell Signal 22:717–727. 20. Funato Y, T Michiue, M Asashima and H Miki. (2006). The thioredoxin-related redox-regulating protein nucleoredoxin inhibits Wnt-beta-catenin signalling through dishevelled. Nat Cell Biol 8:501–508. 21. Altenhofer S, PW Kleikers, KA Radermacher, P Scheurer, JJ Rob Hermans, P Schiffers, H Ho, K Wingler and HH Schmidt. (2012). The NOX toolbox: validating the role of NADPH oxidases in physiology and disease. Cell Mol Life Sci 69:2327–2343. 22. Kajla S, AS Mondol, A Nagasawa, Y Zhang, M Kato, K Matsuno, C Yabe-Nishimura and T Kamata. (2012). A crucial role for Nox 1 in redox-dependent regulation of Wnt-beta-catenin signaling. FASEB J 26:2049–2059. 23. Funato Y, T Michiue, T Terabayashi, A Yukita, H Danno, M Asashima and H Miki. (2008). Nucleoredoxin regulates the Wnt/planar cell polarity pathway in Xenopus. Genes Cells 13:965–975. 24. Funato Y, T Terabayashi, R Sakamoto, D Okuzaki, H Ichise, H Nojima, N Yoshida and H Miki. (2010). Nucleoredoxin sustains Wnt/beta-catenin signaling by retaining a pool of inactive dishevelled protein. Curr Biol 20:1945–1952. 25. Covarrubias L, D Hernandez-Garcia, D Schnabel, E SalasVidal and S Castro-Obregon. (2008). Function of reactive oxygen species during animal development: passive or active? Dev Biol 320:1–11. 26. Hernandez-Garcia D, CD Wood, S Castro-Obregon and L Covarrubias. (2010). Reactive oxygen species: a radical role in development? Free Radic Biol Med 49:130–143. 27. Back P, BP Braeckman and F Matthijssens. (2012). ROS in aging Caenorhabditis elegans: damage or signaling? Oxid Med Cell Longev 2012:608478. 28. Soares ML, S Haraguchi, ME Torres-Padilla, T Kalmar, L Carpenter, G Bell, A Morrison, CJ Ring, NJ Clarke, DM Glover and M Zernicka-Goetz. (2005). Functional studies of signaling pathways in peri-implantation development of the mouse embryo by RNAi. BMC Dev Biol 5:28. 29. Krawetz R, MJ MacKenzie, Q Sun, PA Walton and GM Kelly. (2006). Galpha13 activation rescues moesindepletion induced apoptosis in F9 teratocarcinoma cells. Exp Cell Res 312:3224–3240. 30. Weiler-Guettler H, K Yu, G Soff, LJ Gudas and RD Rosenberg. (1992). Thrombomodulin gene regulation by cAMP and retinoic acid in F9 embryonal carcinoma cells. Proc Natl Acad Sci U S A 89:2155–2159. 31. Ralston A and J Rossant. (2005). Genetic regulation of stem cell origins in the mouse embryo. Clin Genet 68:106–112. 32. Kurooka H, K Kato, S Minoguchi, Y Takahashi, J Ikeda, S Habu, N Osawa, AM Buchberg, K Moriwaki, H Shisa and T Honjo. (1997). Cloning and characterization of the nucleoredoxin gene that encodes a novel nuclear protein related to thioredoxin. Genomics 39:331–339. 33. Kwan HT, DW Chan, PC Cai, CS Mak, MM Yung, TH Leung, OG Wong, AN Cheung and HY Ngan. (2013). AMPK activators suppress cervical cancer cell growth through inhibition of DVL3 mediated Wnt/beta-catenin signaling activity. PLoS One 8:e53597. 34. Holland JD, A Klaus, AN Garratt and W Birchmeier. (2013). Wnt signaling in stem and cancer stem cells. Curr Opin Cell Biol 25:254–264.
REDOX REGULATION OF CANONICAL WNT SIGNALING
1049
35. Paulsen CE and KS Carroll. (2013). Cysteine-mediated redox signaling: chemistry, biology, and tools for discovery. Chem Rev 113:4633–4679. 36. Nonn L, RR Williams, RP Erickson and G Powis. (2003). The absence of mitochondrial thioredoxin 2 causes massive apoptosis, exencephaly, and early embryonic lethality in homozygous mice. Mol Cell Biol 23:916–922. 37. Matsui M, M Oshima, H Oshima, K Takaku, T Maruyama, J Yodoi and MM Taketo. (1996). Early embryonic lethality caused by targeted disruption of the mouse thioredoxin gene. Dev Biol 178:179–185. 38. Hirota K, M Matsui, M Murata, Y Takashima, FS Cheng, T Itoh, K Fukuda and J Yodoi. (2000). Nucleoredoxin, glutaredoxin, and thioredoxin differentially regulate NFkappaB, AP-1, and CREB activation in HEK293 cells. Biochem Biophys Res Commun 274:177–182. 39. Wang L, DG Heidt, CJ Lee, H Yang, CD Logsdon, L Zhang, ER Fearon, M Ljungman and DM Simeone. (2009). Oncogenic function of ATDC in pancreatic cancer through Wnt pathway activation and beta-catenin stabilization. Cancer Cell 15:207–219. 40. Chen B, Z Xue, G Yang, B Shi, B Yang, Y Yan, X Wang, D Han, Y Huang and W Dong. (2013). Akt-signal inte-
gration is involved in the differentiation of embryonal carcinoma cells. PLoS One 8:e64877. 41. Clerkin JS, R Naughton, C Quiney and TG Cotter. (2008). Mechanisms of ROS modulated cell survival during carcinogenesis. Cancer Lett 266:30–36.
Address correspondence to: Prof. Gregory M. Kelly Molecular Genetics Unit Department of Biology Child Health Research Institute Western University London N6A5B7 Canada E-mail:
[email protected] Received for publication January 3, 2014 Accepted after revision January 28, 2014 Prepublished on Liebert Instant Online January 28, 2014
