Reduced Tyk2/SHP-1 interaction and lack of SHP-1 mutation ... - Nature

Leukemia (1998) 12, 200–206  1998 Stockton Press All rights reserved 0887-6924/98 $12.00

Reduced Tyk2/SHP-1 interaction and lack of SHP-1 mutation in a kindred of familial hemophagocytic lymphohistiocytosis M Tabrizi1, W Yang1, H Jiao1, EMG DeVries2, LC Platanias3, M Arico4 and T Yi1 1

Department of Cancer Biology, The Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH; 2Department of Pediatric Oncology, Mayo Clinic, Rochester, MN; 3Section of Hematology/Oncology, Department of Medicine, University of Illinois at Chicago, Chicago, IL, USA; 4Department of Pediatrics, IRCCS Policlinico S Matteo, Pavia, Italy

Familial hemophagocytic lymphohistiocytosis (FHLH) is an autosomal recessive disease with features similar to those of the murine motheaten phenotype resulting from mutations of protein tyrosine phosphatase SHP-1. This has raised the possibility that defects in SHP-1 or SHP-1-regulated signaling molecules may be present in FHLH. In this study, we examined SHP-1 protein and transcript in the peripheral blood mononuclear cells (PBMC) of an FHLH family. Our results show that the FHLH patient and the parents express comparable levels of a single SHP-1 protein and that the SHP-1 cDNA clone from the patient contains no mutation in the coding region. Interestingly, a reduced association of SHP-1 with the Jak family kinase Tyk2 was detected in the patient and the defect appears to have been inherited from one of the parents. This reduced SHP-1/Tyk2 association is likely due to a defect in Tyk2 or in cellular factors regulating Tyk2, because we found no abnormalities in SHP-1 or in SHP-1 association with the other Jak kinases. These data demonstrate that the SHP-1 gene is intact in FHLH and that the defect in some cases with this disease may involve signaling molecules regulated by SHP-1. Keywords: SHP-1; Tyk2; tyrosine phosphorylation; signal transduction; FHLH

Introduction Familial hemophagocytic lymphohistiocytosis (FHLH) is a rare, fatal, autosomal recessive disease in infants and young children.1 Since the original report in 1952,2 more than 200 similar patients have been documented under various terms, including familial histiocytic reticulosis,2 generalized lymphohistiocytic infiltration,3 familial erythophagocytic lymphohistiocytosis,4 lymphohistiocytose familiale,5 familial lymphohistiocytosis6 and familial histocytosis.7 This disease is usually noted in the first years of life and progresses rapidly, corresponding to that of a highly aggressive neoplastic disorder. Several therapeutic strategies, including antibiotics, steroids, chemotherapy and irradiation, have failed to achieve long-term remission.1,8 The disease is usually fatal within a few months of presentation. The etiology and the pathogenesis of FHLH are poorly understood at present.8 However, it has been noticed that FHLH and the murine motheaten disease share a number of clinical and histologic features, including hematosplenomegaly, anemia, organ infiltration of histiocytes and lymphocytes, erythrophagocytosis, monocyte hyperactivity and impaired natural killer activity.1,9 Since the motheaten disease is associated with loss of functional hematopoietic cell phosphatase (SHP-1) due to mutations in the SHP-1 gene,9,10 the

Correspondence: T Yi, Department of Cancer Biology, The Lerner Research Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195, USA; Fax: 216 445 6269 Received 9 September 1997; accepted 19 November 1997

clinical and histologic similarities between FHLH and the motheaten disease suggest a potential association of FHLH with abnormalities in SHP-1.9 SHP-111 is a cytoplasmic protein tyrosine phosphatase predominantly expressed in cells of the hematopoietic system12,13 and is also termed PTP1C,14 SHPTP1,15 SHP.16 It has two srchomology 2 (SH2) domains at the amino region and a PTPase domain at the carboxyl terminal region. Previous studies indicate that SHP-1 functions by associating via its SH2 domains with specific phosphotyrosine sites17,18 in membrane receptors. This association leads to the activation of SHP-1 PTPase19,20 and the down-regulation of signaling by the dephosphorylation of substrates. A number of membrane molecules have been found to associate with SHP-1 via its SH2 domains, including receptors of hematopoietic growth factors and cytokines,21–25 subunits of the B cell antigen receptors26–29 and the inhibitory receptor of natural killer cells.30 The functional significance of these associations is underscored by the increased signaling from these membrane molecules in motheaten hematopoietic cells which lack functional SHP-1.24,28,31–34 It is believed that the increased signaling due to loss of the negative regulatory SHP-1 leads to hyperproliferation and organ infiltration of hematopoietic cells in these mice. While few SHP-1 substrates have been identified, several lines of evidence indicate that SHP-1 dephosphorylates the Jak family kinases (Jak1, Jak2, Tyk2 and Jak3) which are coupled to the receptors of hematopoietic growth factors and cytokines.35 It has been shown that a mutant of the Epo receptor (EpoR) lacking phosphotyrosine sites recognized by the SHP-1 SH2 domains induces prolonged Jak2 hyperphosphorylation and cell hyperproliferation,25 indicating that SHP-1 is recruited to the receptor complex to dephosphorylate Jak2. Moreover, Jak kinases in macrophages from motheaten mice were found to be hyperphosphorylated following IFN␣/␤ treatment.24 Our recent study demonstrates that SHP-1 directly binds to the Jak family kinases via a region in its N-terminus independently of SH2/phosphotyrosine interactions.36 As this interaction leads to SHP-1 activation and the dephosphorylation of Jak kinases, it may be a critical factor required for specific and efficient dephosphorylation of SHP-1 substrates. Because the Jak kinases play critical roles in signal transduction of many hematopoietic growth factors and cytokines,35,37 defects in SHP-1/Jak interactions may affect SHP-1 dephosphorylation of these substrates and cause hematopoietic disorders. Interestingly, we have recently shown that GM-CSF induces only a modest Jak2 hyperphosphorylation in motheaten macrophages which contain multiple markedly hyperphosphorylated proteins.34 This suggests that those hyperphosphorylated proteins are major SHP-1 substrates and that the role of SHP-1 in regulating Jak phosphorylation may be complicated. In the present study, we examined SHP-1 and its interactions with the Jak kinases in the peripheral blood mononuclear cells (PBMC) from members of an FHLH family. Our data

Reduced Tyk2 association with SHP-1 in FHLH M Tabrizi et al

show that the protein levels, phosphatase activities and cDNA sequences of SHP-1 in these individuals are comparable to those of normal controls, demonstrating that FHLH is not associated with an intrinsic defect in SHP-1. Interestingly, the association of Tyk2, but not the other Jak family kinases, with SHP-1 is markedly reduced in the patient and one of the parents. Our results indicate a potential defect in the Tyk2 kinase or in cellular factors regulating Tyk2 that affects its interaction with SHP-1 and may contribute to pathogenesis of FHLH.

Materials and methods

Patient and patient family The kindred involved in this study had six members (Figure 1). The patient was the fourth child of the family. An older child was previously deceased due to FHLH. The other two siblings and the parents are healthy. Diagnosis was established based on typical clinical symptoms, laboratory findings and family history. Peripheral blood samples were collected from the patient and the parents. The patient subsequently underwent bone marrow transplantation, developed acute graft-versushost disease (GVHD) and died during this study. Peripheral blood from three healthy volunteers (one male and two females) were also studied.

Cells, cell culture, transient transfection Peripheral blood mononuclear cells (PBMC) were isolated by centrifugation on a density gradient (Histopaque-1077; Sigma, St Louis, MO, USA), washed three times in phosphatebuffered saline (PBS) and stored as cell pellets at −80°C. Cos-7 cells were grown in DMEM medium supplemented with 10% FCS and transiently transfected with the expression constructs using a DEAE-dextran method.38 The transfected cells were harvested by lysing in cold lysis buffer.

Isolation and characterization of SHP-1 and Tyk2 cDNA clones from PBMC of the FHLH family Poly A+ RNA was isolated from PBMC pellets of the FHLH patient using a QuickPrep mRNA purification kit (Pharmacia, Piscataway, NJ, USA) and reverse-transcribed into cDNA using a Superscript reamplification kit (GibcoBRL, Gaithersburg, MD, USA). SHP-1 cDNA fragments were derived from the reverse-transcribed cDNA by PCR (95°C, 1 min; 55°C, 1 min; 72°C, 2 min; for 36 cycles) using a set of oligonucleotide primers (P1, gaattcctctccggaagcccccagg; P2, ctgaattcaggttgtgagtctgtc) that flank the coding region of SHP-1 (Figure 3a). The cDNA fragments were digested with EcoRI, gel purified and cloned into the Bluescript vector. A SHP-1 cDNA clone of the patient was randomly selected for sequencing analysis39 with a panel of 20 oligonucleotide primers that distribute within the coding region at approximately 200 bp distance/primer. For isolation of Tyk2 cDNA clones from the PBMC of the patient’s parents, similar procedures were followed using two sets of oligonucleotide primers (P1, gaattcagcatgcctctgcgccactgg; P2, cagtggctcccgcggcctgtc; P3, gacaggccgcgggagccactg; P4 ggaattcagcacacgctgaacactga). The Tyk2 cDNA fragments were digested with EcoRI/SstII, ligated to

form full-length Tyk2 cDNA and inserted into the PRK5 vector for expression assays.

Reagents Wild-type SHP-1 and the SHP-1 mutant cDNAs have been described.36 The wild-type human Tyk2 cDNA was a gift from Dr George Stark, The Cleveland Clinic Foundation, Cleveland, OH, USA. The cDNA clones were inserted into the eukaryotic cell expression vector pRK5 or pXM as indicated. The antibodies against SHP-1, Tyk2, Jak1, Jak2 and Jak3 have been reported previously.36 The monoclonal antibody (4G10) specific for phosphotyrosine was purchased from UBI.

Immunoprecipitation and Western blotting15 Cells and cell pellets were lysed in cold lysis buffer (50 M Tris, pH 7.4, 50 mM NaCl, 0.5% sodium deoxycholate, 0.2 mM Na3VO4, 20 mM NaF, 1% NP-40, 2 mM PMSF, 20 ␮g/ml of aprotinin and 10% glycerol). The lysates were clarified by centrifuging for 20 min at 10 000 g at 4°C. Antisera were added to cell lysates and incubated at 4°C for 60 min with gentle agitation. Immune complexes were collected with protein A Sepharose 4B (Pharmacia) at 4°C for 30 min, washed gently in cold lysis buffer and analyzed by SDS-PAGE. For Western blotting, protein samples separated on SDS-PAGE gels were blotted on to nitrocellulose membrane (Schleicher & Schuell, Keene, NH, USA). The membranes were then blocked with 5% milk in washing buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 0.1% Tween-20) for 2 h, incubated with rabbit polyclonal antibodies (1:5000 dilution of whole serum) or with the mouse monoclonal anti-phosphotyrosine antibody 4G10 (1 ␮g/ml, UBI) for 2 h, washed for 1 h, incubated with a secondary antibody for 1 h and washed for another hour. Specific antibody signals were detected using an enhanced chemiluminescence kit (ECL, Amersham, Arlington Heights, IL, USA). Results

PBMC of FHLH patients express normal levels of functional SHP-1 phosphatase with no mutation in its cDNA coding region The motheaten mutations are point mutations in splicing acceptor/donor sites of the SHP-1 gene. The mutations cause deletions or insertions in SHP-1 transcript and premature translation termination, resulting in loss of SHP-1 protein expression or the expression of two forms of mutant SHP-1 proteins with sizes (66 and 71 kDa) different from the wildtype protein (68 kDa). To determine whether motheaten mutations occur in FHLH patients, we examined the expression of SHP-1 protein in peripheral blood mononuclear cells of the FHLH patient and her healthy parents (Figure 1). We detected a single SHP-1 protein about 68 kDa, with comparable expression levels in these samples (Figure 2, lanes 1–6). The SHP-1 protein immunoprecipitated from the PBMC samples was tyrosine phosphorylated and associated with phosphotyrosine proteins of 48, 32 and 30 kDa (Figure 2, lanes 8, 10 and 12), consistent with previous findings in hematopoietic cell lines.40 However, there were no marked differences in these samples in terms of the

201


202

produced a single SHP-1 cDNA fragment of 1.8 kb (Figure 3b). Sequencing analysis of the cDNA fragment revealed that the coding region sequence is identical to the previously reported human SHP-1 cDNA sequence13 (data not shown), indicating that the SHP-1 protein of the patient did not have point mutations. In support of this, we found that immunoprecipitated SHP-1 from the patient and the parents had comparable PTPase activities in in vitro PTPase assays (data not shown).

Detection of reduced Tyk2/SHP-1 association in the FHLH patient and one of the parents

Figure 1 FHLH kindred. Family relationships are shown; affected subjects, unaffected subjects, living unsampled subjects and deceased subjects are indicated by filled symbols, unfilled symbols, dotted symbols and diagonal lines, respectively. Peripheral blood samples were collected from the parents (M1 and F1) and the patient (D1) who died during this study.

phosphorylation contents of SHP-1 or the SHP-1-associated proteins. To determine whether SHP-1 in the FHLH patient is mutated despite the apparently normal SHP-1 protein migration, we amplified the coding region of SHP-1 cDNA from the PBMC of the patient by PCR (Figure 3a). Consistent with our detection of a single SHP-1 protein, the PCR reaction

Our recent study demonstrated that SHP-1 associates via its Nterminal region with Jak kinases. To determine whether such associations are defective in FHLH, we immunoprecipitated SHP-1 from PBMC of the patient and the parents, and probed the immunocomplexes with antibodies against the Jak kinases. Consistent with our previous reports,36,41 Tyk2 was detected in the SHP-1 immunocomplexes from the father (Figure 4a, lane 2). However, the levels of Tyk2 in the SHP-1 immunocomplexes from the patient and the mother were markedly reduced, representing approximately 5–10% of the father’s. In contrast, similar amounts of Jak3 were detected in these SHP-1 immunocomplexes (Figure 4a, lower panel). We also detected comparable levels of Jak1 and Jak2 in the SHP-1 immunocomplexes from these individuals (data not shown). A similar reduction of SHP-1 in the immunocomplexes of Tyk2 from the patient and the mother was also detected (data not shown).

Figure 2 PBMC of the FHLH family members express the wild-type SHP-1 protein. Cell lysates were prepared from PBMC of the FHLH patient (D1) and the parents (F1 and M1). SHP-1 proteins were immunoprecipitated from the lysates. The immunocomplexes and the lysates were analyzed in a 7.5% SDS-PAGE gel which can separate the wild-type and the motheaten mutants of SHP-1 proteins.9,34 The protein samples were then transferred to a membrane and detected with antibodies as indicated. The positions of protein size markers, SHP-1 and SHP-1associated phosphoproteins (p48, p32 and p30) are indicated.


203

Figure 3 PCR cloning of SHP-1 cDNA from the FHLH patient. Oligonucleotide primers franking the coding region of the SHP-1 transcript were prepared (a) and used in PCR reactions to derive SHP-1 cDNA fragments from reverse-transcribed mRNA of the FHLH patient. The PCR products were analyzed in a 1.2% agarose gel and detected by ethidium bromide staining (b).

Figure 4 Reduced Tyk2 association with SHP-1 in the FHLH patient and one of the parents. (a) SHP-1 was immunoprecipitated from the lysates of PBMC of the FHLH family members. The immunocomplexes and the lystates were analyzed by SDS-PAGE/Western blotting with antibodies as indicated. The positions of protein size markers, Tyk2, SHP-1 and Jak3 are indicated. (b) SHP-1 was immunoprecipitated from the lysates of PBMC of three healthy volunteers. The immunocomplexes were analyzed by SDS-PAGE/Western blotting with antibodies as indicated.


204

When the association of Tyk2 with SHP-1 in the PBMC of three healthy volunteers was studied, we found that the amounts of Tyk2 detected in SHP-1 immunocomplexes from such samples were similar (Figure 4b), suggesting that the reduced Tyk2 association in the FHLH family is unlikely to be a random event. Consistent with this, comparable levels of Tyk2 were also detected in the SHP-1 immunocomplexes from PBMC samples of five additional individuals (data not shown). Status of Tyk2/SHP-1 interaction in the unaffected siblings of the FHLH kindred has not been determined as samples of the siblings were not available.

The Tyk2 encoded by cDNAs from the patient’s parents show comparable association with the SHP1/N mutant when co-expressed in Cos-7 cells The reduced association of Tyk2, but not other Jak kinases, with SHP-1 in the FHLH patient cells suggested an intrinsic defect in Tyk2 or related molecules affecting its interactions with the phosphatase. This appears to have been inherited from the parent in whose cells a similar reduction of SHP1/Tyk2 association was also detected. To determine whether the potential intrinsic defect in Tyk2 is a characteristic independent of the cellular environment, we examined the interactions of Tyk2 proteins from both of the parents with SHP-1 in Cos-7 cells in transient transfection assays. Tyk2 cDNA fragments were derived from both of the parents by PCR and ligated to generate cDNA clones encoding full length Tyk2 protein (Figure 5a and b), which were co-expressed with the SHP-1/N mutant in Cos-7 cells. The mutant has Jak-binding activity but contains point mutations inactivating the SHP-1 SH2 domains to prevent its association with phosphotyrosine receptors (Figure 5c).36 We detected Tyk2 protein from both parents in the antiSHP-1/N immunocomplexes in the transfected cells (Figure 5d, lanes 3 and 4). The amount of Tyk2 from the parent M1, whose PBMC showed reduced Tyk2/SHP-1 association, was smaller than that of the F1 Tyk2 (compare lane 4 to lane 3 of Figure 5d, upper panel). However, there was a proportionally smaller amount of SHP-1/N mutant in the immunocomplex (lane 4 of Figure 5d, middle panel). These results indicated a comparable association of Tyk2 proteins of both parents with the SHP-1 mutant, demonstrating that the differential association of SHP-1/Tyk2 in the PBMC of the parents could not be reproduced when the SHP-1/Tyk2 molecules were co-expressed in Cos-7 cells. Consistent with this, we detected comparable amounts of SHP-1/N protein in the immunocomplexes of Tyk2 from F1 and M1 (data not shown). This suggests the involvement of additional cellular factors in the reduced Tyk2/SHP-1 association. The association of SHP1 with the Tyk2 cloned from the patient has not been determined. Since the patient and the affected parent (M1) showed a similar defect in Tyk2/SHP-1 association, it is expected that the patient Tyk2 will behave like that of the affected parent in its association with SHP-1 in similar transfection experiments. Discussion The clinical and pathological similarities between FHLH and the motheaten disease suggest that they originate through similar genetic defects and mechanisms. Recent discovery9,10,42 that mutations in the SHP-1 gene correlate with the expression of the motheaten phenotype prompted us to

determine whether similar mutations occur in an FHLH family. The motheaten mutations cause the expression of a truncated protein of 102 amino acids (the me mutation) or two catalytically inactive mutants of 67 and 71 kDa (the mev mutation).9 Our results demonstrate that the SHP-1 genes in the FHLH family members contain no motheaten type of mutations since they express comparable levels of a single SHP-1 protein of 68 kDa as expected for the wild-type SHP-1. The lack of motheaten type of mutations in FHLH was also confirmed by sequencing of the coding region of an SHP-1 cDNA clone from the FHLH patient. It is consistent with our finding of single SHP-1 protein band in three additional FHLH patients (data not shown). Our results further demonstrate that the 68 kDa SHP-1 protein of the patient also contains no other types of mutations that affect its function because the SHP-1 cDNA isolated from the patient encodes a wild-type SHP-1 protein. Consistent with this, we detected comparable PTPase activities and phosphoproteins in the SHP-1 immunocomplexes from the members of the FHLH family. These results together indicate that there are no mutations in the SHP-1 gene in the FHLH patient and that SHP-1 mutation is not involved in the pathogenesis of the FHLH patient. Similar results were obtained by another group who analyzed and sequenced SHP-1 cDNA from FHLH patients (Dr RJ Matthews, personal communication). In the absence of SHP-1 mutation, our finding of a reduced association of Tyk2, but not the other Jak kinases, with SHP1 in the FHLH patient indicates a potential defect intrinsic in the Tyk2 molecule or in cellular factors regulating Tyk2 that affects its interactions with the phosphatase. Since dephosphorylation and inactivation of Tyk2 by SHP-1 may depend on intermolecular interactions,36 the reduced Tyk2 association with SHP-1 may lead to increased Tyk2 activity and enhanced cellular responses that depend on the Tyk2 kinase for signal transduction. Given the functional involvement of Tyk2 in the signal transduction of multiple hematopoietic growth factors/cytokines, a hyperactive Tyk2 is not inconsistent with the hyperproliferation of hematopoietic cells that is characteristic of FHLH. While our preliminary study showed that Tyk2 from the three members of the FHLH family had similar phosphotyrosine content (our unpublished data), this result should be interpreted with caution as Tyk2 contains multiple potential phosphotyrosine sites. Their differential phosphorylation and their regulation by the phosphatase may not be readily reflected by the phosphotyrosine content of the whole protein. Determination of the activities of Tyk2 and Tyk2-related signaling pathways in FHLH cells will help to reveal the functional consequences of the reduced Tyk2/SHP-1 association. The requirement of fresh cell samples which are not readily available limits such effort. The nature of the putative Tyk2 defect responsible for the reduced Tyk2/SHP-1 association is not clear. Our recent studies demonstrate that the N-terminal region of SHP-1 specifically binds to all of the members of the Jak family kinases but not the src or c-fes kinases. This suggests that Jak-binding activity of SHP-1 recognizes a sequence motif conserved uniquely in the Jak kinases, which has not been clearly defined. It is possible that the putative Tyk2 defect is caused by mutations that affect the motif in the Tyk2 molecule of the patient and thus reduces Tyk2 association with SHP-1. Our current effort to map the SHP-1-binding motif in the Jak kinases will provide critical information allowing us to detect the mutations by determining putative mutations in FHLH patients. Alternatively, the Tyk2 defect may be the result of


205

Figure 5 The Tyk2 proteins encoded by cDNA clones from the parents of the FHLH patient show comparable association with the SHP1/N mutant when co-expressed in Cos-7 cells. (a) Two sets of oligonucleotide primers (p1/p2 and p3/p4) were prepared to derive Tyk2 cDNA fragments from the parents of the FHLH patient by PCR. (b) The PCR reaction products were analyzed in a 1.2% agarose gel and detected by ethidium bromide staining. The cDNA fragments were ligated to form cDNA clones encoding the full length Tyk2. (c) The SHP-1/N mutant was co-expressed with the Tyk2 clones into Cos-7 cells by transient transfection. (d) Cell lysates were prepared and incubated with an anti-SHP-1 antibody. The immunocomplexes and lysates (TCL) were analyzed by SDS-PAGE/Western blotting with antibodies as indicated.

an aberrant post-translational modification of the motif, which will be more difficult to define. Moreover, it is likely that the reduced Tyk2/SHP-1 interaction involves additional cellular factors since it could not be detected outside of the original cellular environment in transfection assays (Figure 5). The detection of reduced Tyk2/SHP-1 association in the patient and one of the parents indicates that it is passed from the parent to the patient, consistent with the inherent nature of the disease. This also indicates that the reduced Tyk2/SHP1 association is not the only pathogenic factor in FHLH because the affected parent appears healthy. The recessive nature of the genetic disease suggests that the patient may have inherited another defect from the other parent which is required and complements the putative Tyk2 abnormality in FHLH pathogenesis. This defect could be in molecules that function cooperatively with Tyk2. A number of such molecules are known, including membrane receptors, kinases and STATs that are functionally and physically coupled to Tyk2.35,37 Defects in the Jak family kinases are known to be associated with a number of diseases. Mutations of Jak3 have been identified in human autosomal severe combined immune deficiency (SCID) with normal ␥c chain.43,44 Mutations of the Jak homologue encoded by the Drosophila hopscotch locus cause development abnormalities.45 Interestingly, a mutation that activates the Jak homologue at TumL allele causes a leukemia-like disease in flies.46–48 Our finding of reduced

Tyk2/SHP-1 association in an FHLH family implicates a potential Tyk2 defect in this lethal human hematopoietic disease. Further studies to characterize the potential Tyk2 defect and to examine Tyk2/SHP-1 interactions in additional FHLH families will help to define its role in the pathogenesis of FHLH and allow us to assess its potential involvement in other aggressive neoplastic disorders of the hematopoietic system in the future.

Acknowledgements This work was supported by grants from the American Cancer Society (DB-74554) to T Yi and by Policlinico S Matteo grant No. 390 RCR9701 to M Arico. The authors thank Drs RJ Matthews for sharing unpublished data and X Zhao for DNA sequencing analysis.

References 1 Janka GE. Familial hemophagocytic lymphohistiocytosis. Eur J Pediatr 1983; 140: 221–230. 2 Farquhar JW, Claireaux AF. Familial hemophagocytic reticulosis. Arch Dis Child 1952; 27: 519–525. 3 Nelson P, Santamaria A, Olson RL, Nayak NC. Generalized lymphohistiocytic infiltration. A familial disease not previously described and different from Letterer–Siwe disease and Chediak– Higashi syndrome. Pediatrics 1961; 27: 931–950.


206

4 MacMahon HE, Bedizel M, Ellis CA. Familial erythrophagocytic lymphohistiocytosis. Pediatrics 1963; 32: 868–879. 5 Mozziconacci P, Nezelof C, Attal C et al. La lymphohitiocytose familiale. Arch Fr Pediatr 1965; 22: 385–408. 6 Peterson RA, Kuwabara T. Ocular manifestation of familial lymphohistiocytosis. Arch Ophthalmol 1968; 79: 413–418. 7 Frisell E, Bjorksten B, Holmgren G, Angstrom T. Familial occurrence of histiocytosis. Clin Genet 1977; 11: 163–170. 8 Arico M, Janka G, Fischer A et al. Hemophagocytic lymphohistiocytosis. Report of 122 children from the International Registry. FHL Study Group of the Histiocyte Society. Leukemia 1996; 10: 197–203. 9 Shultz LD, Schweitzer PA, Rajan TV et al. Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell 1993; 73: 1445–1454. 10 Tsui HW, Siminovitch KA, de Souza L, Tsui FW. Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene. Nat Genet 1993; 4: 124–129. 11 Adachi M, Fishcher EH, Ihle J et al. Mammalian SH2-containing protein tyrosine phosphatases. Cell 1996; 85: 15. 12 Yi T, Cleveland JL, Ihle JN. Identification of novel protein tyrosine phosphatases of hematopoietic cells by polymerase chain reaction amplification. Blood 1991; 78: 2222–2228. 13 Yi TL, Cleveland JL, Ihle JN. Protein tyrosine phosphatase containing SH2 domains: characterization, preferential expression in hematopoietic cells, and localization to human chromosome 12p12-p13. Mol Cell Biol 1992; 12: 836–846. 14 Shen SH, Bastien L, Posner BI, Chretien P. A protein-tyrosine phosphatase with sequence similarity to the SH2 domain of the protein-tyrosine kinases (unpublished erratum appears in Nature 1991; 353: 868). Nature 1991; 352: 736–739. 15 Plutzky J, Neel BG, Rosenberg RD. Isolation of a src homology 2containing tyrosine phosphatase. Proc Natl Acad Sci USA 1992; 89: 1123–1127. 16 Matthews RJ, Bowne DB, Flores E, Thomas ML. Characterization of hematopoietic intracellular protein tyrosine phosphatases: description of a phosphatase containing an SH2 domain and another enriched in proline-, glutamic acid-, serine-, and threonine-rich sequences. Mol Cell Biol 1992; 12: 2396–2405. 17 Songyang Z, Cantley LC. Recognition and specificity in protein tyrosine kinase-mediated signalling. TIBS 1995; 20: 470–475. 18 Burshtyn DN, Yang W, Yi T, Long EO. A novel phosphotyrosine motif with a critical amino acid at position −2 for the SH2 domainmediated activation of the tyrosine phosphatase SHP-1 (in process citation). J Biol Chem 1997; 272: 13066–13072. 19 Pei D, Neel BG, Walsh CT. Overexpression, purification, and characterization of SHPTP1, a Src homology 2-containing proteintyrosine-phosphatase. Proc Natl Acad Sci USA 1993; 90: 1092– 1096. 20 Pei D, Lorenz U, Klingmuller U, Neel BG, Walsh CT. Intramolecular regulation of protein tyrosine phosphatase SH-PTP1: a new function for Src homology 2 domains. Biochemistry 1994; 33: 15483–15493. 21 Yi T, Mui AL, Krystal G, Ihle JN. Hematopoietic cell phosphatase associates with the interleukin-3 (IL-3) receptor beta chain and down-regulates IL-3-induced tyrosine phosphorylation and mitogenesis. Mol Cell Biol 1993; 13: 7577–7586. 22 Yi T, Ihle JN. Association of hematopoietic cell phosphatase with c-Kit after stimulation with c-Kit ligand. Mol Cell Biol 1993; 13: 3350–3358. 23 Yi T, Zhang J, Miura O, Ihle JN. Hematopoietic cell phosphatase associates with erythropoietin (Epo) receptor after Epo-induced receptor tyrosine phosphorylation: identification of potential binding sites. Blood 1995; 85: 87–95. 24 David M, Chen HE, Goelz S, Larner AC, Neel BG. Differential regulation of the alpha/beta interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol Cell Biol 1995; 15: 7050–7058. 25 Klingmuller U, Lorenz U, Cantley LC, Neel BG, Lodish HF. Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell 1995; 80: 729–738. 26 D’Ambrosio D, Hippen KL, Minskoff SA et al. Recruitment and

27 28

29

30 31 32 33

34

35 36

37 38 39 40 41

42 43 44 45 46 47

48

activation of PTP1C in negative regulation of antigen receptor signaling by Fc gamma RIIB1 (see comments). Science 1995; 268: 293–297. Doody GM, Justement LB, Delibrias CC et al. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP. Science 1995; 269: 242–244. Cyster JG, Goodnow CC. Protein tyrosine phosphatase 1C negatively regulates antigen receptor signaling in B lymphocytes and determines thresholds for negative selection. Immunity 1995; 2: 13–24. Pani G, Kozlowski M, Cambier JC, Mills GB, Siminovitch KA. Identification of the tyrosine phosphatase PTP1C as a B cell antigen receptor-associated protein involved in the regulation of B cell signaling. J Exp Med 1995; 181: 2077–2084. Burshtyn DN, Scharenberg AM, Wagtmann N et al. Recruitment of tyrosine phosphatase HCP by the killer cell inhibitor receptor. Immunity 1996; 4: 77–85. Van Zant G, Shultz LD. Hematopoietic abnormalities of the immunodeficient mouse mutant, viable motheaten (mev). Exp Hematol 1989; 17: 81–87. Chen H, Chang S, Trub T, Neel BG. Regulation of colony-stimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol Cell Biol 1996; 16: 3685–3697. Tapley P, Shevde NK, Schweitzer PA et al. Increased G-CSF response of bone marrow cells from hematopoietic cell phosphatase deficient viable motheaten mice. Exp Hematol 1996; 25: 122–131. Jiao H, Yang W, Berrada K, Tibrizi M, Shultz L, Yi T. Macrophages from motheaten and viable motheaten mutant mice show increased proliferative response to GM-CSF: detection of potential HCP substrates in GM-CSF signal transduction. Exp Hematol 1997; 25: 592–600. Ihle JN. Cytokine receptor signalling. Nature 1995; 377: 591–594. Jiao H, Berrada K, Yang W, Tabrizi M, Platanias LC, Yi T. Direct association and dephosphorylation of Jak2 kinase by SH2 domaincontaining protein tyrosine phosphatase SHP-1. Mol Cell Biol 1996; 16: 6985–6992. Ihle JN. STATs: signal transducers and activators of transcription. Cell 1996; 84: 331–334. Roussel MF, Cleveland JL, Shurtleff SA, Sherr CJ. Myc rescue of a mutant CSF-1 receptor impaired in mitogenic signalling. Nature 1991; 353: 361–363. Sanger F, Nichklen S, Coulson A. DNA-sequencing with chaintermination inhibitors. Proc Natl Acad Sci USA 1977; 74: 5463–5467. Yang W, Tabrizi M, Berrada K, Yi T. SHP-1 C-terminus interacts with novel substrates in IL-3 and Epo mitogenic responses. Mol Cell Biol 1997 (submitted). Yetter A, Uddin S, Krolewski JJ, Jiao H, Yi T, Platanias LC. Association of the interferon-dependent tyrosine kinase Tyk-2 with the hematopoietic cell phosphatase. J Biol Chem 1995; 270: 18179–18182. Yi T, Gilbert DJ, Jenkins NA, Copeland NG, Ihle JN. Assignment of a novel protein tyrosine phosphatase gene (Hcph) to mouse chromosome 6. Genomics 1992; 14: 793–795. Macchi P, Villa A, Gillani S et al. Mutations of Jak-3 gene in patients with autosomal severe combined immune deficiency (SCID). Nature 1995; 377: 65–68. Russell SM, Tayebi N, Nakajima H et al. Mutation of Jak3 in a patient with SCID: essential role of Jak3 in lymphoid development. Science 1995; 270: 797–800. Binari R, Perrimon N. Stripe-specific regulation of pair-rule genes by hopscotch, a putative Jak family tyrosine kinase in Drosophila. Genes Dev 1994; 8: 300–312. Luo H, Hanratty WP, Dearolf CR. An amino acid substitution in the Drosophila hopTum-1 Jak kinase causes leukemia-like hematopoietic defects. EMBO J 1995; 14: 1412–1420. Harrison DA, Binari R, Nahreini TS, Gilman M, Perrimon N. Activation of a Drosophila Janus kinase (JAK) causes hematopoietic neoplasia and developmental defects. EMBO J 1995; 14: 2857– 2865. Luo H, Rose P, Barber D et al. Mutation in the Jak kinase JH2 domain hyperactivates Drosophila and mammalian Jak-Stat pathways. Mol Cell Biol 1997; 17: 1562–1571.