The EMBO Journal vol.5 no.6 pp.1367-1371, 1986. Nuclear factor 1 interacts with five DNA elements in the promoter region of the human cytomegalovirus major ...
The EMBO Journal vol.5 no.6 pp.1367-1371, 1986
Nuclear factor 1 interacts with five DNA elements in the promoter region of the human cytomegalovirus major immediate early gene
Lothar Hennighausen and Bernhard Fleckenstein' Laboratory of Biochemistry and Metabolism, National Institute of Arthritis, Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20205, USA, and Institut fur Klinische Virologie der Universitiit, Erlangen-Nurmberg, D-8520 Erlangen, FRG Communicated by W.Schaffner
The human cytomegalovirus (HCMV), a ubiquitous pathogen of the herpesvirus group, has a linear double-stranded DNA genome of 235 kb. The expression of its major immediate early gene (IE1) is entirely dependent on host factors, presumably proteins binding to DNA elements in the regulatory regions of the gene. We have identified four high-affinit binding sites for nuclear factor 1 (NF1) in the promoter upstream region of IE1 gene between nucleotides -780 and -610, and an additional, even stronger, binding site in the first intron near nucleotide +350. NF1 activity is found in a wide range of species and binds to the sequence 5' TGGC/ANNNNNGCCAA3' on double-stranded DNA, protecting -25 bp from DNase I digestion; its functional importance has been found first in the necessity for adenovirus DNA replication, where it may be important in mediating the binding of other proteins. The regulatory significance of NF1 recognition elements within other genes is unknown. The NF1 binding sites in the HCMV IE1 gene coincide with regions that had been shown to be sensitive to DNase I in the active gene but not sensitive in the silent gene; there was, however, no NFl binding in the strong and constitutively DNase I-hypersensitive transcription enhancer of the IE1 gene. This suggests that the specific protein-DNA interaction described is important in the regulated control of the IE1 gene. Key words: human cytomegalovirus/immediate early genes/ protein -DNA interaction/nuclear factor 1
Introduction Human cytomegalovirus (HCMV), a member of the herpes group, has a large double-stranded DNA genome (- 235 kd) that contains two unique stretches of DNA, UL and Us, each flanked by a pair of inverted repeats (Ebeling et al., 1983; Westrate et al., 1980). During the permissive infection cycle the viral genes are expressed in a three-step cascade, finally leading to the production of the structural polypeptides forming intact viral particles (Wathen and Stinski, 1982). The limited set of viral genes that are expressed soon after infection, the so-called immediate early (IE) genes, are transcribed even in the presence of inhibitors of protein synthesis (Jahn et al., 1984; Wathen and Stinski, 1982) suggesting that only host factors are required for their expression. The IE proteins that are encoded within the HindU E fragment in the UL region (Jahn et al., 1984) appear to be regulatory proteins, primarily since they are required for the initiation of transcription from the early (E) genes, followed by DNA replication and transcription of the late genes (DeMarchi, 1981; Wathen and Stinski, 1982; McDonough and Spector, 1983). The most IRL Press Limited, Oxford, England
abundantly transcribed immediate early gene (IEI) codes for a 72-kd nuclear protein which is proposed to play a major role in regulating transcription of other viral genes (Stenberg et al., 1984). Transcription of the IEl gene is negatively regulated at a late period during permissive infection (Jahn et al., 1984), and the profound accumulation of IE1 mRNA in the presence of cycloheximide, i.e. in the absence of de novo protein synthesis, may reflect an autoregulatory mechanism. The predominant expression of the IEl gene over the other IE genes could be explained by the finding of a very strong enhancer between nucleotides -118 and -524 5' to the IEl gene promoter (Boshart et al., 1985). Information about the nature of host cell encoded proteins that are required for regulated IEl gene expression comes from studies with teratocarcinoma cells. HCMV replicates in differentiated teratocarcinoma cells, but not in undifferentiated ones (Gonczol et al., 1984) with the block being at the transcription level of the IEl gene (Nelson and Groudine, 1986). Whereas the chromatin encompassing the enhancer region was sensitive to DNase I in differentiated as well as undifferentiated cells, chromatin further upstream as well as in the first intron was only sensitive to DNase I in differentiated, i.e. permissive, cells (Nelson and Groudine, 1986). This is an indication that factors binding outside the enhancer region are required for expression in permissive cells and was a challenge for us to identify one or more of those proteins. Nuclear factor 1 (NFl) is a sequence-specific DNA-binding protein that was originally isolated from uninfected HeLa cells (Nagata et al., 1982; Rawlins et al., 1984) and is required for the in vitro replication of adenovirus (Ad) DNA (Nagata et al., 1982, 1983; Rawlins et al., 1984). Similar binding activities have been detected in a variety of cell types and species and it has been shown recently that the 'TGGCA' DNA-binding protein characterized by Sippel and co-workers (Nowock et al., 1985) is functionally related to NFl (Leegwater et al., 1986). The function of NFl in the network of the eukaryotic genome is currently largely unknown, although binding sites in regulatory regions of the human c-myc gene (Siebenlist et al., 1984), the human IgM gene (Hennighausen et al., 1985), the human papovavirus BK genome (Nowock et al., 1985; Hennighausen and Rosenthal, unpublished) and the chicken lysozyme gene (Borgmeyer et al., 1984) suggest a more universal role in regulated gene expression and in the activation of chromatin during early stages of cell differentiation. With this in mind we searched for NFl binding sites in the IE1 gene region of the HCMV. Results Construction of recombinant plasmids The parent plasmid (pCM5029) contained the PstI-m fragment cloned into the PstI site of pUC8 (Boshart et al., 1985). Plasmid CMPS 1.1 was constructed by inserting the EcoRI (within polylinker of pUC8)-SstI (nucleotide 1140 in Figures 1 and 2A) fragment from pCM5029 into pUC 13 restricted with EcoRI and SstI. Plasmid pCMPSp was derived by ligating the 800-bp SphI (nucleotide + 170) -PstI (nucleotide +9 10) fragment into 1367
L.Hennighausen and B.Fleckenstein
a
b
2.7 2.1 -W
d
c
3.6
2.7
0.2- .4
-
.I
0.8- *o
0.12
0.4-
0.6 0.55
-
o
S.
_-
+
+
_.
20ng e
2.7
f
2.7
-
2.7 -_ 0.66
0.42
0.38-
DIIIP
-
9
*-
_m
HBHBHc I .1( 1
NH S- HSp 1
HH
S
P Sa RI
a
b C d
I-----'
e
L._____J
f
-J A
__
L--
9
300 bp
Fig. 1. Mapping of NFI binding sites in the promoter region of the HCMV IEI. Recombinant plasmids were cut with restriction enzymes and the resulting fragments with 5' protruding ends were end-labeled using [a-32P]dNTPs (labeled deoxynucleotide triphosphates) and the large fragment of E. coli polymerase I (Hennighausen et al., 1985). Labeled DNA was incubated with the DNA-cellulose fraction of the NFl preparation (N) from rat liver nuclear extracts for 30 min at 25°C and then passed through nitrocellulose filters. Protein-bound DNA, retained on the filters, was extracted and analysed on agarose gels (+). The pattern of input DNA was assayed by omitting the nitrocellulose filtration step (-). Background bindings of labelled fragments to nitrocellulose filters was analysed by substituting bovine serum albumin (B) for nuclear proteins. The plasmid pCM5029 that was formed by ligating the PstI-m fragment (Boshart et al.) into pUC8 was cut with EcoRI and HindlIl (a), with Sail, NcoI and SphI (b) or with Hinfl (d). The EcoRI-SstI fragment covering the 5'-flanking region of the IEI gene was cloned into the plasmid pUC13 cut with EcoRI and SstI. To analyse binding of the resulting plasmid pCMPS1.1, the insert was cut out with Sall (due to the construction, the insert is flanked by Sail sites) and re-digested with HincIl (c). To define the boundaries of the NFl binding sites in the 5'-flanking region of the IEI gene, the Pstl-BalI (partial) fragments of pCMPSl.1 (during the construction of pCMPS1.1, PstI sites were forned on both sites of the insert) were subcloned into pUC13 cut with SmaI and PstI. The insert of pCMPBa (e), pCMPBb (f) and pCMPBe (g) were cut out with EcoRI and Hindmll and 1 ng of each insert was subjected separately to a binding assay. In a-d 5 ng of restricted plasmid were added to each binding assay. Solid lines represesnt DNA fragments bound to NFl, dashed lines non-bound fragments. B=BamHI, D=HindIII, H=Hinfl, P=PstI, RI=EcoRl, S=SstI, N=NcoI, HC=HincII, Sa=SaIl, Sp=SphI. The solid box indicates the first exon of IEI gene.
pUC19. The core element of NFl binding site I, II and III is cut by Ball (Figure 2A), a fact which was exploited to design plasmids containing one or several binding sites cloned into pUC13. pCMPBb contains a 413-bp PstI-BalI (nucleotides -1138 to -725) fragment, pCMPSa a 655-bp BalI-SstI (nucleotides -671 to -16) fragment, pCMPBc a 467-bp PstIBall (nucleotides -1138 to -671) fragment, pCMPSb a 709-bp Ball-SstI (nucleotides -725 to -16) fragment and PCMPH a 540-bp PstI-HincH (nucleotides -1138 to -598) fragment. Location of NFI binding site NFl binding sites in the promoter region of the IEl gene (Boshart et al., 1985) were mapped by using cloned restriction fragments
1368
and partially purified NFl in a nitrocellulose filter binding assay. The 2.1-kb PstI-m fragment that covers the first exon and first intron of the IEl gene, as well as 1 140-bp 5'-flanking DNA, bound to partially purified NFl (Figure la), indicating the presence of one or more NF 1 binding sites. The location of those binding sites was further mapped by using several smaller restriction fragments. From digestion of the plasmid containing the PstI-m fragment with Sall, NcoI and SphI (Figure Ib) it became clear that both the first intron and the 5'-flanking region contained binding sites, the latter ones residing upstream of the known enhancer (Figures Ic, 2B) (Boshart et al., 1985). It is known from several recent reports (Henninghausen et al., 1985; Gronostajski et al., 1985; Nowock et al., 1985; Rawlins et al.,
Interaction of NF1 with human cytomegalovirus immediate early gene ioo CTGCAGTGAATAATAAAATGTGTGTTTGTCCGAAATACGCGTTTGAGATT -1050 TCTGTCCCGACTAAATTCATGTCGCGCGATAGTGGTGTTTATCGCCGATA -1000 GAGATGGCGATATTGGAAAAATCGATATTTGAAAATATGGCATATTGAAA -1
CCAAAA ATGTCGCCGATGTGAGTTTCTGTGTAACTGATATCGCCATT-_-900 A_ GTTGATTTTTGGGCATACGCGATATCTGGCGATACGCTTATATCGTTTAC _
_
_
_
_
_
__
_
_
_
_
_
_
-850 GGGGGATGGCGATAGACGCCTTTGGTGACTTGGGCGATTCTGTGTGTCGC -800
-P
Ad5 c-mycIi1 IgH
i 1t
AAATATCGCAGTTTCGATATAGGTGACAGACGATATGAGGCTATATCGCC
NF1
-750
GATAGAGGCGACATCAAGCITGGCACAT CCAATGCATATCGATCTATAC ________-700 ATTGAATCAATATTGGCCATTAGCC TATTATTCATTGGTTATATAGCAT 650 AAATCAATATTGGCTATTGGCC tTGCATACGTTGTATCCATATCATAAT _____-600 ATGTACATTTATAfTGGCTCATGTC AMCATTACCGCCATGTTGACATTG -550
AT TAT TGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA -500 GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCT -450 GGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGT -400 TCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGT -350
CMVI CMVII CMVIII CMVIV CMVV
I
"
III
__ _
liv E N H A N
C E R
-150 GGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCAT -100 TGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAA -50 AATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTA
CGGTGGGAGGTCIAIAIAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGC +50 +100
CTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACC
CCAGCCCT GC TCCCAT CC T CCCAC T CA T GGT CCT CGGCAGC TCCT T GC T C +650 CTAACAGTGGAGGCCAGACTTAGGCACAGCACGATGCCCACCACCACCAG +700
TGTGCCCACAAGGCCGTGGCGGTAGGGTATGTGTCTGAAAATGAGCTC
ggaggacaTGGCACTGGGCCAAtcttcotg TGG .
GCCAA
III
ATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCA -300 AGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTA -250 TGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG -200 TATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAAT
GATCCAGCCTCCGCGCCCGGGAACGGTGCATTGGAACGCGGATTCCCCGT 4 ~~~~~~+150 GCCAAGAGTGAgG1AAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTT +200 icesite GGCTTCTTA TGCATGCTATACTGTTTTTGGCTTGGGGTCTATACACCCCC +250 GCTTCCTCATGTTATAGGTGATGGTATAGCTTAGCCTATAGGTGTGGGTT +300 ATTGACCATTATTGACCACTCCCCTATTGGTGACGATACTTTCCATTACT AATCCATAACATGGCTCTTTGCACAACTCTCTTT TACACTGTCCTTCAGAGACTGACACGGACTCTGTATTTTTACAGGATGGG +450 GTCTCATTTATTATTTACAAATTCACATATACAACACCACCGTCCCCAGT +500 GCCCGCAGTTTTTATTAAACATAACGTGGGATCTCCAGCGAATCTCGGGT +550 ACGTGTTCCGGACATGGGGCTCTTCTCCGGTAGCGGCGGAGCTTCTACAT +600
consensus
catca qcTGGCACATGGCCAAtgcoatatc gootaa aTGGCTAATGGCCAAtattgatt gtotgcoaaTGGCCAATAGCCAAtattgatt gqtaatgtTGGACATGAGCCAAtatoaatg c ctttatTGGCTATATGCCAAtacactgt ccttatttTGGATTGAAGCCAAtatgataa toaatgccTGGAAGGCAGCCAAatt toat
11
L
Fig. 2. Structure of the HCMV IEI gene promoter region. Nucleotide sequences. Restriction fragments from pCM5029 were subcloned into M13 and sequenced by the dideoxy chain terminating method. The core elements of the NFl binding sites are boxed and the dyad symmetry axis between nucleotides -910 and -960 is marked by an arrow. The mRNA start site and the first intron splice site are also marked by arrows. Structural features. The dotted box represents the first exon of the IEl gene and the vertical arrow to its right the path of transcription. The TATA box preceding the mRNA start site is indicated. The open box marks the region with enhancer activity and the filled in squares represent the NFI binding sites I-V. Horizontal arrows point to some of the DNase I-hypersensitive sites deternined by Nelson and Groudine (1986). The two arrows facing each other mimic the dyad symmetry as indicated in the left part of the figure. P=PstI, S=SstI.
1984; Siebenlist et al., 1984) that NFl recognizes and binds the sequence TGGN6GCCAA on linear double-stranded DNA. Therefore the 1.85-kb segment between the 5' PstI site and the 3' SstI site of the PstI-m fragment (Figure 1) was sequenced in order to identify the exact positions of the NFl binding site consensus sequences. The sequence as shown in Figure 2A reveals several elements with features of NFl binding sites. (i) The sequence TGGCTATATGCCAA can be found 355 bp 3' from the CAP site. This element resides in a 250-bp Hinfl fragment that has a high affinity for NFl (Figure Id) and that competes well with other NFl binding sites, as shown below (Figure 4). (ii) Around positions -765, -720, -675 and -620 (with respect to the CAP site) four elements with the consensus sequence were found (see boxed sequence in Figures 2A and 3). The positions of the NF1 binding site consensus sequence correlate with the filter binding assays. The 540-bp PstI-HincH fragment that harbors the four copies of the consensus sequence is bound by NF 1, but the 590-bp HincII -SstI fragment overlapping the enhancer
Fig. 3. NFl consensus sequence. The five HCMV NFI binding sites are compared with those in the IgH gene (Hennighausen et al., 1985), the adenovirus (AdS) terminal repeat (Rawlins et al., 1984) and the human c-myc gene (Siebenlist et al., 1984). The core elements are printed in capital letters.
is not bound (Figure ic). The 375-bp PstI -Ball fragment from the 5' end of the PstI-m does not bind (Figure le) whereas the 655-bp BalI -Sstl fragment does bind (Figure Ig), demonstrating that all 5' binding sites are confined to a stretch of 180 bp. Sequence requirements for NFI binding The structure of the NFl binding sites in the HCMV DNA (Figure 3) confirms the consensus sequence derived recently (Hennighausen et al., 1985). Although the sequence outside the 14-bp core element does not seem to have any influence on binding capability, disruption of the core abolishes binding activity. The 5' PstI-Ball fragment (Ball cuts in core sequence I, II and HI) was cloned into pUC13 and the NFl binding site I was thereby changed from TGGCACATGGCCAA to TGGCACATGGGGGCGA, abolishing the binding capacity (Figure le). On the other hand, the consensus sequence alone is not a guarantor for binding. For example, the sequence TGGGCGGCGGCCAA in pBR322 (Gronostajski et al., 1985 and the sequence TGGCAACTTGCCAA in a middle repetitive element of mouse DNA (Dubnick et al., 1983) are non-binders (L.Hennighausen, unpublished). The spacing between the TGG and CCA motif also seems to be of importance. Despite all the evidence suggesting that only a 7-nucleotide spacer results in a functional binding site, a binding site with an 8-nucleotide spacer has been described recently (Gronostajski et al., 1985). A core sequence with an 8-nucleotide spacer can been seen between nucleotides 650 and 664 (Figure 2A), but is not recognized in our binding assay (Figure Ic). As detected earlier (Siebenlist et al., 1984), some NFl binding sites are flanked by A/T-rich regions. Although the functional significance of A/T-rich flanking elements is not known, it is worth mentioning that the HCMV binding sites I-IV show the same feature (Figure 2A). Relative affinities of different NFl binding sites The first hint that each of the five NFl binding sites might have quantitatively different affinity came from a filter binding assay in which the NFl concentration was limited (Figure Id). Plasmid pCM5028 containing the Pstl-m fragment was cut with Hinfl and end labeled; 5 ng or 20 ng of the labeled DNA were added to the assay. Although the fragments did not label uniformly it is clear that the 555-bp fragment (overlapping core element IV-IV), the 250-bp fragment (core element V) and the 120-bp fragment (core element I) are specifically recognized by NFl (Figure Id). Increasing the input DNA to 20 ng leads to relative preferential binding of the 250-bp fragment over the 120-bp fragment and over the 555-bp fragment, with the last competing more extensively than the 120-bp fragment (Figure Id). In order to compare the relative affinities of the independent NF1 core elements, subcloned NFl binding sites were tested in an equilibrium competition assay. -
1369
L.Hennighausen and B.Fleckenstein 100
z c z I-
50F
z w 0-
5
25
102
250
50
1
COMPETITOR DNA (fmol)
Fig. 4. Analysi is of the relative affinities of NFl binding sites in an equilibrium connpetition assay. Plasmid CMPSp was cut with EcoRI and Hindml (NFI c-ore element V is located on the 0.8-kb insert as shown in Figure 1) and tthe 3' recessive ends were labeled by filling in using the large fragment of DNA polymerase I. Increasing amounts of linear competitor DN)A were added to 5 fmol of labeled DNA and, after addition, the NFl fractioin binding was quantitated using a filter binding assay and scintillation counting. The vertical axis represents percentage of binding, the horizontal aixis amount of added competitor DNA. V, pCMPSp (core element %V); 0, pUC13; O, the synthetic NFl binding site TGGCACTGT(GCCAA integrated into pUC13; o, pCMPH (core element
I-IV); V, pC]MPS (core element IV), OpIgHSP (Hennighausen et al., 1985); *, pCIt4PBb (core element I).
sion of HCMV, but also to its function at the level of the cellular gene. 7he binding sites Common to the five NFl binding sites in the HCMV IEl gene and to other NF1 binding sites (Hennighausen et al., 1985; Nowock et al., 1985; Siebenlist et al., 1984; Rawlins et al., 1984) is a core sequence of 2-fold rotational symmetry (Figure 3). It suggests that NF1 forms a dimeric complex with its binding site (Hennighausen et al., 1985). Despite extensive sequence data from a number of binding sites, the parameters determining specificity and affinity are not fully understood, but the TGG .... GCCAA motif and a 6-nucleotide spacer seem to be of crucial importance. Whereas the flanking DNA does not seem to confer binding specificity, the sequence of the spacer has a profound effect on the affinity. Interestingly, binding sites with an affinity equivalent to the described synthetic NFl binding site (Figure 4), have not yet been found in vivo. From this one could conclude that too tight a binding might be detrimental to nuclear metabolism. The five NFl core elements within the HCMV IEl gene have different affinities, with an apparent order V > I > II, Ill, IV.
Although the functional significance of this observation is unknown, better understood biological systems with other purified transcription factors show a similar feature. For example, within the SV40 21-bp repeats there are six SPl binding sites that govern the expression of early and late promoters. Although the affinity of the SPI binding site is considerably lower than that of site
II, it plays a more important role in the transcription from the early promoter (Gidoni et al., 1985). Our data, however, reflect
only the binding affinities of NFl with linear and double-stranded DNA in vitro and it is worth keeping in mind that the affinity in vivo might be different. So far we do not know whether additional non-histone proteins bind in the vicinity of the NFl core elements and therefore have the capability of interacting with NFl
Radioactiviely labeled PCMPSp (core element V) was mixed with increasi ng amounts of several unlabeled competitor DNAs and after inc-ubation with the DNA -cellulose fraction of NFl, admdlteisbnig subjected to a filter binding assay. The results are plotted in The strongest binding site, V, is placed 350 bp 3' from the Figure 4. NIFl was not the limiting component in this assay CAP site, within the first intron of the gene, and the other four as shown by competition with pCMPSp itself. The qualitative bindin sites are located within a -r180 bp stretch 5' to the known observation lthat binding site V is stronger than I, H, III and IV elocat wigure a h symmetreterso the four enhangcer combined (Figure id) could be substantiated and quantified by enhancer element (Figure 2B). The symmetry centers of the four element as compeio competitior r DNA. Bindusing pCMPiHi(cor binding fashion sites in (44 the 5' a relatively region are spaced -IV)thas an elementy similaI -IV) Dinding siesIregular bp,flanking 49 bp and 54 bp), allowingin conclusions ing site I has ian affinity similar to that of binding I, I sites wich to be drawn about the positioning of NFl on DNA in the B conand IV comblined (Figure Id) and also than site IV alone, which frain h G n C oiswti ahcr r has a KD C()mparable with the NFl core element within the formation. The TGG and CCA motifs within each core are human IgH ]locus (Figure 4). From those studies we can order 3.4 nm apart, suggesting that the protein monomers recognize the HCMV NFl core elements according to their affinity to positions on one face of the DNA helix. Due to different spacpartially puriified NFl as V > I > II, III, IV The affinity of ing of the four binding sites, NFl will recognize different faces the NFl binsding site can be modulated by altering altering the ssequencee of theIVdouble within the elements sitesIIII dingsitecan will behelix and on one face, I-IV. site H and recognized bindingBinding between the 'TGG and CCA motif. Applying in vitro mutagenesis* on the opposite side. Regular spacing of protein binding sites we synthesized a number of different NFl binding sites that difwith different affinities has been observed for the lambda fer only in tdte sequence between the two flanking motifs. The affinity found so far, 10-fold repressor and its operator and shown to be of importance for binding site with the highest the. the the life cycle of the phage (Ptashne et al., 1982). Other examples igIgH gene hs the sequence higher than the one within gene, has themsequenc include SPI binding sites in viral and cellular systems (Dynan TGGCACT(STTGCCAA, containing a pronounced 2-fold axis and Tjian, 1985). of symmetr Z (Figure 4). a nd aspects Functional aspects Discussion Recently it has been observed that the HCMV can replicate in In this reportt we identify five high-affinity binding sites for the differentiated teratocarcinoma cells but not in undifferentiated eukaryotic D)NA binding protein NFl in the promoter region of cells (Gonczol et al., 1984), with an apparent block at the the HCMV rEl gene. The five binding sites map closely to DNA transcriptional level of the IEl gene (Nelson and Groudine, 1986). Teratocarcinoma cells therefore seem to represent a valuable elements thal,t are believed to govern the expression of the IEI system to dissect anatomically and physiologically the elements gene in permtissive cells. These results may be relevant not only necessary in cis and the factors required in trans to activate IEl to the undersstanding of the role NFl plays in IEI gene expres-
wthe
1370
Interaction of NF1 with human cytomegalovirus immediate early gene
gene expression. Using an enhancer trap, a DNA element has been located between nucleotides -118 and -524 that can stimulate transcription from hetereologous promoters (Boshart et al., 1985). The information regarding the position and intensity of DNase I-hypersensitive sites within the El gene promoter region has been used to monitor the actual transcriptional state of the gene (Nelson and Groudine, 1986). Whereas the chromatin structure of the enhancer region was independent of changes on the transcription level, the appearance of four additional DNase Ihypersensitive sites further upstream was closely correlated to transcription activation. This suggests that the block of IE transcription in undifferentiated cells is most likely not at the level of the enhancer but is caused by different and as yet unidentified differentiation signals that might act in a positive or negative fashion. Work with murine leukemia virus suggests a negative regulation (Gorman et al., 1985). Within the resolving power inherent to the method, one induced DNase I-hypersensitive site maps around NFl binding site I and one between binding site III and IV (Nelson and Groudine, 1986). NFl binding site V with the highest relative affinity, overlaps with a DNase Ihypersensitive site even in the absence of active transcription (Figure 2B) and its state in permissive cells is not clear (Nelson and Groudine, 1986). The notion that NFl binding sites and altered chromatin structures coincide is tenable (Siebenlist et al., 1984; Hennighausen et al., 1985; Fritton et al., 1983). Our studies with the IEl gene of HCMV lead to the working hypothesis that NFl binding is part of an early step inactivation of chromatin which leads to sensitization and expression of genes in permissive cells.
Materials and methods Purification of NFI Nuclei were isolated from 67 g rat liver as described (Siebenlist et al., 1984) and eluted in a buffer containing 300 mM NaCl. The eluted protein solution was brought to 45 % saturation with (NH4)2SO4, the precipitate was recovered by centrifugation and dissolved in buffer A containing 10% sucrose, 25 mM Hepes at pH 7.5, 20 mM NaCl, 1 mM EDTA and 1 mM dithioireitol (DTT. The purification procedure was adapted from Rawlins et al. (1984). The crude fraction was applied to a DEAE-Sephadex column and the activity was eluted with 300 mM NaCl. After dialysis against buffer A, the material was applied to a second DEAESepharose column and eluted with a 280 ml linear gradient of 20-670 mM NaCl in buffer A. The active fractions were pooled, dialyzed and applied to a denatured DNA-cellulose column. The activity was eluted with a 150 ml linear gradient of 20-800 mM NaCI. The 250 mM NaCI fraction was used for the binding assays. Nitrocellulose filter binding assay Binding reactions were performed in 100 yI containing 10 mM Hepes at pH 8.0, 100 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA, 2 mM DTT, 5 LI bovine serum albumin (BSA), 5 ng of [32P]DNA and 0.1 1 of the DNA-cellulose fraction. After incubation at 25°C for 30 min the reaction mixture was filtered through a nitrocellulose filter (Millipore HA 0.45 ltm). Filters were washed twice with 1 ml aliquots of a buffer containing 10 mM Hepes (pH 8.0), 100 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA and 2 mM DTT. DNA was extracted from filters overnight at 37°C with 500 1l of 0.25% SDS containing 40 ,ug of pre-digested pronase. After adding 0.05 volume of 5 M NaCI and 2 jig of Escherichia coli tRNA, polynucleotides were precipitated with ethanol, dissolved in 0.2% SDS, and subjected to gel electrophoresis. As a control for non-specific binding, BSA was substituted for the nuclear extract. Nucleotide sequence analysis The nucleotide sequence was determined from both strands by applying the dideoxy chain termninating method according to the BRL (Bethesda Research Laboratories) manual. For this purpose the cytomegalovirus (CMV)-specific DNA inserts from the plasmid pCM5029 and the subclones described in Results were subcloned in M13. In addition, the AluI and HaeIII fragments that overlap the IEl gene region were subcloned and sequenced.
References Borgmeyer,U., Nowock,J. and Sippel,A.E. (1984) Nucleic Acids Res., 12, 4295 -4311. Boshart,M., Weber,F., Jahn,G., Dorsch-Hasler,K., Fleckenstein,B. and Schaffner,W. (1985) Cell, 41, 521-530. DeMarchi,J.M. (1981) Virology, 114, 23-38. Dynan,W.S. and Tjian,R. (1985) Nature, 316, 774-778. Dubnick,M., Chou,J., Petes,T.D. and Farber,R.A. (1983) J. Mol. Evol., 19, 115-121.
Ebeling,A., Keil,G., Nowak,B., Fleckenstein,B., Berthelot,N. and Sheldrick,P. (1983) J. Virol., 45, 715-726. Fritton,H., Sippel,A.E. and Igo-Kemenes,T. (1983) Nucleic Acids Res., 11, 3467-3485. Gidoni,D., Kadonaga,J.T., Barrera-Saldana,H., Takahashi,K., Chambon,P. and Tjian,R. (1985) Science, 230, 511-517. Gonczol,E., Andrews,P.W. and Plotkin,S.A. (1984) Science, 224, 159-161. Gorman,C.M., Rigby,P.W.J. and Lane,P.D. (1985) Cell, 42, 519-526. Gronostajski,R.A., Adhya,S., Nagata,K., Guggenheimer,R. and Hurwitz,J. (1985) Mol. Cell. Biol., 5, 946-971. Hennighausen,L., Siebenlist,U., Danner,D., Leder,P., Rawlins,D., Rosenfeld,P. and Kelley,T.J.,Jr. (1985) Nature, 314, 289-292. Jahn,G., Knust,E., Schmolla,H., Sarre,T., Nelson,J.A., McDougall,J.K. and Fleckenstein,B. (1984) J. Virol., 49, 363-370. Leegwater,P.A.J., van der Vliet,P.C., Rupp,R.A.W., Nowock,J. and Sippel,A.E. (1986) EMBO J., 5, 381-386. McDonough,S.H. and Spector,D.H. (1983) Virology, 125, 31-46. Nagata,K., Guggenheimer,R.A., Enomoto,T., Lichy,J.H. and Hurwitz,J. (1982) Proc. Natl. Acad. Sci. USA, 79, 6438-6442. Nagata,K., Guggenheimer,R.A. and Hurwitz,J. (1983) Proc. Natl. Acad. Sci. USA, 80, 6177-6181. Nelson,J.A. and Groudine,M. (1986) Mol. Cell. Biol., 6, 452-461. Nowock,J., Borgemeyer,U., Puschel,A.W., Rupp,R.A.W., and Sippel,A.E. (1985) Nucleic Acids Res., 13, 2045-2061. Ptashne,M., Johnson,A.D. and Pabo,C.O. (1982) Sci. Am., 247, 128-140. Rawlins,D.R., Rosenfeld,P.J., Wides,R.J., Chalberg,M.D. and Kelly,T.J.,Jr. (1984) Cell, 37, 309-319. Siebenlist,U., Hennighausen,L., Battey,J. and Leder,P. (1984) Cell, 37, 381-391. Stenberg,R.M., Thomsen,D.R. and Stinski,M.F. (1984) J. Virol., 49, 190-199. Wathen,M.W. and Stinski,M.F. (1982) J. Virol., 41, 462-477. Westrate,M.W., Geelen,J.L.M. and van der Noordaa,J. (1980) J. Gen. Virol., 49, 1-21. Received on 8 January 1986; revised on I April 1986
Acknowledgements Lothar Hennighausen thanks Philip Leder for his most generous support. Part of the project was funded by the Deutsche Forschungsgemeinschaft.
1371
