Wyk, Robert A. Weinberg, and Harvey F. Lodish for discussion about this work; and Steven R. Goldring, Stephen M. Krane,. Stephen M. Strittmatter, Akira Kikuchi ...
Proc. Natl. Acad. Sci. USA Vol. 90, pp. 11772-11776, December 1993
Cell Biology
Conversion of G-protein specificity of insulin-like growth factor II/mannose 6-phosphate receptor by exchanging of a short region with /8-adrenergic receptor (G-protein activation/chimeric receptors)
KATSUTOSHI TAKAHASHI*t, YOSHITAKE MURAYAMAt, TAKASHI OKAMOTO*, TAKASHI YOKOTAt, TSUNEYA IKEZUt, SHUJI TAKAHASHI§, UGO GIAMBARELLA*, ETSURO OGATA1, AND IKUO NISHIMOTO*II *Department of Medicine, Harvard Medical School, Cardiovascular Research Center, Massachusetts General Hospital-East, 149 The Navy Yard-13th Street, Charlestown, MA 02129; tFourth Department of Internal Medicine, Tokyo University School of Medicine, 3-28-6 Mejirodai, Bunkyo-ku, Tokyo 112, Japan; *Department of Molecular Biology, Tokyo University Institute of Medical Science, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan; §Department of Pathology, Sapporo Medical College, S1, W17, Chuo-ku, Sapporo 060, Japan; and 1Cancer Research Institute, 1-37-1 Kami-Ikebukuro, Toshima-ku,
Tokyo 170, Japan Communicated by William S. Sly, August 30, 1993
RRSSKFCLKEHKALK (,1III-2), can directly activate G. in vitro. In this study, we constructed a vector that expresses a chimeric receptor (,f1II-2/IGF-IIR) in which the peptide 14 sequence of IGF-IIR was replaced with the P1III-2 sequence and studied the properties of expressed chimeric receptors.
ABSTRACT The 14-residue peptide (peptide 14) corresponding to Arg2"0-Lys"23 of the insulin-like growth factor II receptor (IGF-IIR) can activate the adenylate cyclase-inhibitor guanine nucleotide-bincling protein GI, and the 15-residue fu-2 peptide ArgM'-Lys273 of the 132-adrenergic receptor (32AR) can activate the stimulatory protein G.. In phospholipid vesicles, IGF-IIR and 12AR activate Gi and G. in response to IGF-ll and isoproterenol, respectively. We constructed a chimeric IGF-H receptor (,3Il-2/IGF-IIR) by converting its native peptide 14 sequence to the pIII-2 sequence. In cells expressing ,3I1-2/IGF-IIR, membrane adenylate cyclase activity markedly increased without IGF-II and was further promoted by IGF-II. This was verified by measuring chloramphenicol acetyltransferase (CAT) activity in /II-2/IGFIHR cells with cotransfection of a cAMP response element-CAT construct. This study shows not only the conversion of G-protein specificity of a receptor from Gi to G, but also the simulation of G protein-coupled receptor signals by using a short receptor region and intact cells. These findings indicate that the G protein-activation signals are interchangeable, selfdetermined structural motifs that function in the setting of either a single-spanning or multiple-spanning receptor.
EXPERIMENTAL PROCEDURES Gene Construction. Human IGF-IIR cDNA in plasmid pECE (23) was provided by Richard A. Roth (Stanford University). The Nde I-EcoRI fragment of IGF-IIR cDNA was subcloned into pBR322 (pBR-IIR). The BamHI-EcoRl fragment of IGF-IIR cDNA was subcloned into M13mpl8 and was transfected into CJ236 competent Escherichia coli. Deoxyuridine-containing single-stranded DNA was prepared. Oligonucleotides were annealed to this singlestranded DNA to create a unique Xho I site at the beginning and at the end of the peptide 14 sequence (M13-Xho). The EcoRI-BamHI fragment of M13-Xho was inserted into pBRIIR (pBR-IIR-Xho). The BstXI-Nde I fragment of pBR-IIRXho was inserted into the original IGF-IIR cDNA (cIGFIIR). Thus, cIGF-IIR cDNA has two unique Xho I sites before and after the peptide 14 region. The entire region that had been through a single-stranded intermediate was sequenced to confirm the absence of unwanted changes. Oligonucleotides corresponding to the 811I-2 sequence (5'TCGAGCGCAGATCTTCCAAGTTCTGCTTGAAGGAGCACAAAGCCCTCAAGC-3' and 5 '-TCGAGCTTGAGGGCTTTGTGCTCCTTCAAGCAGAACTTGGAAGATCTGCGC-3') were hybridized and inserted between the Xho I sites. Double-stranded plasmids were sequenced again. A mutant IGF-IIR cDNA (PIII-1/IGF-IIR cDNA) was constructed in a similar manner. A mutant IGF-IIR (IGFIIRA2410-2423) which possesses Leu-Glu instead of the peptide 14 region was constructed by digesting cIGF-IIR cDNA with Xho I. Cell Transfection. Plasmids were transiently expressed in COS-7 monkey cells. The mixture of DNA (10 ytg, unless specified) and DEAE-dextran (Pharmacia) was incubated with cells for 15 min in Dulbecco's modified Eagle's medium (DMEM). After the medium was changed to DMEM plus 10% fetal bovine serum, cells were cultured for another 48 hr. Cells were incubated for 30 min with phosphate-buffered
One of the best-characterized signal transducers is the heterotrimeric guanine nucleotide-binding protein (G protein) family, which transduces receptor signals to effectors (1). While most of the G protein-coupled receptors share a common membrane-spanning configuration with seven transmembrane domains, the insulin-like growth factor II receptor (IGF-IIR), a receptor with a single transmembrane domain, has been demonstrated to couple to Gi2 in response to IGF-II in various environments (2-4). This protein is also a specific receptor for mannose 6-phosphate (Man-6-P) and lysosomal enzymes (5). IGF-IIR possesses a small domain of 14 amino acids at residues 2410-2423 that activates Gi2 (6). The peptide corresponding to this region, RVGLVRGEKARKGK (peptide 14), directly activates Gi2 (6, 7), and has been shown to be involved in the Gi-activating function of IGF-IIR in phospholipid vesicles (6). Signal transduction of the 32-adrenergic receptor (/32AR) stimulated by isoproterenol occurs through G., which activates adenylate cyclase. We have identified a G.-activator sequence of 15 amino acids in P2AR as residues 259-273 (8), which is included in the receptor area essential for coupling to G. (9). The peptide which corresponds to this region,
Abbreviations: IGF, insulin-like growth factor; IGF-IIR, IGF-II/ mannose 6-phosphate receptor; CAT, chloramphenicol acetyltransferase; P2AR, f32-adrenergic receptor; CRE, cAMP response element; TRE, tetradecanoylphorbol acetate response element; Bt2cAMP, dibutyryl cAMP. IlTo whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
11772
Proc. Natl. Acad. Sci. USA 90 (1993)
Cell Biology: Takahashi et al. saline (PBS) containing 5 mM Man-6-P, washed with PBS three times, scraped, suspended in ice-cold PBS, and centrifuged at 185 x g for 5 min. The pellet was suspended in ice-cold buffer A (20 mM Hepes-NaOH, pH 7.4/1 mM EDTA/1 mM dithiothreitol/20 ,uM leupeptin with aprotinin at 20 pg/ml) homogenized, and centrifuged at 185 x g for 5 min. The pellet was again suspended in buffer A, homogenized, and centrifuged. The first and the second supernatants were mixed and centrifuged at 18,500 x g for 60 min at 4°C. The final pellet suspended in buffer A was subjected to immunoblot analysis, IGF-II binding assay, and adenylate cyclase assay. Assays. Immunoblot analysis was carried out as described (10). An anti-IGF-IIR antibody, provided by S. Peter Nissley (National Institutes of Health), was used at 1:500 dilution. An anti-j8III-2 monoclonal antibody, raised by immunizing mice with pIII-2 peptide, was used at 1:1000 dilution. IGF-II binding and adenylate cyclase activity were measured as described (2, 8). Chloramphenicol acetyltransferase (CAT) activity was measured as described (11). Forty-eight hours after transfection, cells were washed twice with ice-cold PBS and scraped in 40 mM Tris HCl, pH 7.8/150 mM NaCl/l mM EDTA. Cells were treated with IGF-II for the last 12 hr or with 1 mM dibutyryl cAMP (Bt2cAMP) or 100 ,uM isoproterenol for the last 24 hr after transfection. After centrifugation at 53 x g for 2 min at 4°C, the pellet was suspended in 250 mM Tris-HCl (pH 7.8) and homogenized by freezing/ thawing with liquid nitrogen and heating to 37°C. After
11773
heating at 65°C for 10 min, the sample was centrifuged at 16,000 x g for 5 min. The supematant was subjected to the assay. CAT plasmids connected with a cAMP response element (CRE) and with a phorbol 12-myristate-13-acetate ("tetradecanoylphorbol acetate," TPA) response element (TRE) were provided by Shunsuke Ishii (The Institute of Physical and Chemical Research, Saitama, Japan) (12).
RESULTS AND DISCUSSION We constructed a control IGF-IIR (cIGF-IIR) cDNA which possessed two Xho I sites, before and after the peptide 14 region. The chimeric ,8III-2/IGF-IIR cDNA was constructed by utilizing these Xho I sites. 831II-2/IGF-IIR has a BIII-2 sequence between the native IGF-IIR residues 2410 and 2423, with the remainder being IGF-IIR (Fig. 1A). Immunoblot analysis indicated enhanced expression of a 230-kDa protein which reacted with an anti-IGF-IIR antibody in the membranes from COS-7 cells transfected with 8III-2/IGF-IIR cDNA or with cIGF-IIR cDNA, whereas parental COS-7 cells had an antibody-reactive band also of 230 kDa (Fig. 1B). The 230-kDa protein reacted with an anti-pIII-2 peptide antibody only in membranes prepared from the cells transfected with ,III-2/IGF-IIR cDNA. By transfecting 10 ug of ,BIII-2/IGF-IIR cDNA, the densitometric intensity of the 230-kDa band was increased 2- to 3-fold. Accordingly, Scatchard analysis of IGF-II binding (Fig. 1C) revealed that transfection of 10 ,ug of BIII-2/IGF-IIR cDNA resulted in a
A
B kDa
[AR
200 -
97
-
69 -
frort F.
-.
{;, ;- -".r. Ei HF * ,r
;- .':'j ; r TV'
,_
Xho ) site
,T re
200 -
Xho I site
C
11.0
111-2/IGF-IIR LL -(
U-
c
m
0 LE RRSSKFCLKEHKALKLE
0.1
1
10
100
[IGF-I1] (nM)
FIG. 1. (A) ,I311-2/IGF-IIR construction. The cIGF-IIR has two Xho I sites (corresponding to Leu-Glu) between codons for native residues 2409 and 2410 and residues 2423 and 2424. The chimeric .3I1I-2/IGF-IIR thus consists of the ,1II-2 sequence, Leu-Glu before and after the ,III-2 sequence, and IGF-IIR lacking the native residues 2410-2423. (B) Immunoblot analysis of the membranes of parental COS-7 cells or cells transfected with recombinant IGF-IIR cDNAs. Membranes (100 jug) prepared from parental COS7 cells (Left), cells transfected with 10 pg of cIGF-IIR cDNA (Center), and cells transfected with 10 pg of PH131-2/IGF-IIR cDNA (Right) were subjected to immunoblot analysis using an anti-IGF-IIR (Upper) or an anti-81III-2 (Lower) antibody. (C) IGF-II binding to the membranes of parental COS-7 cells and cells transfected with ,BI1I-2/IGF-IIR cDNA. Membranes (50 pg) prepared from parental COS-7 cells (o) or from cells transfected with 10 pg of ,III-2/IGF-IIR cDNA (e) were incubated with 100 pM 1251-labeled IGF-II and various concentrations of unlabeled IGF-II. The binding of radioactive IGF-II to membranes is plotted as a function of the concentration of unlabeled IGF-II. Data in B and C are representative results of at least three similar
experiments.
11774
Cell Biology: Takahashi et al.
Proc. Natl. Acad. Sci. USA 90 (1993)
2- to 3-fold increase in IGF-II binding sites: 0.3-0.4 pmol/mg of protein with a Kd value of =3 nM in parental COS7 cells and 0.8-1.0 pmol/mg of protein with a similar Kd value (=4 nM) in jII-2/IGF-IIR cDNA-transfected cells. These data suggest that the 31III-2/IGF-IIR, which is >99.5% identical to IGF-IIR, was processed normally and expressed in membranes, where it bound IGF-II with normal affinity. Basal adenylate cyclase activity increased in the membranes of cells expressing .3III-2/IGF-IIR (Fig. 2). To ensure that ,BIII-2/IGF-IIR was free from bound Man-6-P or lysosomal enzymes, we prepared membranes from cells washed initially with Man-6-P-containing solution and then with Man-6-P-free solution. It has been reported that Man-6-P and lysosomal enzymes bound to IGF-IIR abolish IGF-II action in IGF-IIR-Gi vesicles (3) and that lysosomal enzymes can inhibit IGF-Il binding to IGF-IIR (13). As higher amounts of fIII-2/IGF-IIR cDNA were transfected, basal cyclase activity increased (Fig. 2A). Transfection of either IGF-IIR cDNA or cIGF-IIR cDNA had no effect on basal cyclase activity. In 38III-2/IGF-IIR cells, low concentrations of IGF-II had an additional, stimulatory effect on cyclase activity (Fig. 2B). The maximal cyclase activity that IGF-II promoted was
comparable to the level promoted by 100 ,uM isoproterenol in similar membranes. In parental COS-7 membranes and in membranes from cells transfected with IGF-IIR or cIGF-IIR cDNA, basal adenylate cyclase activity was 5-10 pmol/min per mg of protein, and IGF-II failed to promote the cyclase activity (Fig. 2B). This observation indicates that 81II-2/ IGF-IIR increases basal adenylate cyclase activity and causes IGF-II to stimulate the cyclase. We constructed another chimeric receptor, 3III-1/IGFIIR, in which His241-Lys263 (PIII-1 region, HVQNLSQVEQDGRTGHGLRRSSK) of I2AR was inserted between the two Xho I sites in cIGF-IIR cDNA. Adenylate cyclase activity of the membranes expressing /3III-1/IGF-IIR did not significantly differ from that of parental COS-7 membranes (data not shown). This is consistent with the in vitro data showing that ,BIII-1 fails to activate purified G. (8). IGF-I was without effect on membrane adenylate cyclase activity in 83III-2/IGF-IIR cells (Fig. 2C), indicating that neither IGF-I nor insulin receptor is involved in the cyclasestimulating action of IGF-II. In contrast, Man-6-P, which binds to an extracellular region of IGF-IIR different from that for IGF-II binding, promoted cyclase activity in fIII-2/IGF-
25 .
60 >
'-) :ta1.5:
.C
50
I
B
-
)
.-
.> 0
o)Q 40
Ca
on U) E
en E
>0C
C:
5
E 30
a) -
2
s< 20-
CU-
a) o -D E
m E f,
Ct
1
,0111-2//IGF-IIR
10 cDNA
0a 10
.0 0
30
(gg)
W
..
0.1
1
10
100
[IGF-II] (nM)
ox 180 0.5 U>
.5 w
e)Un
140 0 U) ct_
CU
a) 0 U)
0 U) 0
60o ILU) t)
-a
U)
-o U) -0
20 0 0
10 100 [IGF] (nM)
1000
0
0.1
1
10
100 1000
[IGF-I1] (nM)
FIG. 2. (A) Basal adenylate cyclase activities ofthe membranes from cells transfected with various amounts of ,111-2/IGF-IIR cDNA. Values here and in B-D represent the mean SE of at least three experiments. (B) Effect of IGF-II on cyclase activity in fIII-2/IGF-IIR-expressing membranes. Membrane adenylate cyclase activity of COS-7 cells transfected with 10 pg of )311I-2/IGF-IIR cDNA was measured in the absence or presence of various concentrations of IGF-II (c). As controls, activity of the membranes prepared from parental COS-7 cells (*) or cells transfected with 10 ug of cIGF-IIR cDNA (o) was measured in the presence of IGF-II. The batch of DEAE-dextran used in B was different from that used in A, C, and D. (C) Effect of Man-6-P (M6P) on IGF-II action on cyclase activity in ,III-2/IGF-IIR-expressing membranes. Membranes from cells transfected with 10 pg of 8I11I-2/IGF-IIR were incubated with various concentrations of IGF-II in the absence (filled bar) or presence (lighter stippled bar) of 5 mM Man-6-P. The effect of IGF-I in the absence of Man-6-P is also indicated (darker stippled bar). The 100%6 activity signifies the basal, increased adenylate cyclase activity in the 8III-2/IGF-IIR-expressing membranes, which was 19.3 t 2.2 pmol of cAMP per min per mg of protein. The O%o activity equals zero value. (D) Effect of IGF-II in cIGF-IIR-expressing membranes. Membranes prepared from cells transfected with 30 pg of cIGF-IIR cDNA were incubated with 100 ,uM isoproterenol in combination with various concentrations of IGF-II in the absence (s) or presence (*) of 5 mM Man-6-P. Membranes from parental COS-7 cells (o) and from COS-7 cells transfected with 30 pg of IGF-IIRA2410-2423 cDNA (>) were incubated with 100 pM isoproterenol and various concentrations of IGF-II. Here, the 100%o cyclase activity is the activity stimulated by 100 AM isoproterenol, 26.9 6.7 pmol/min per mg, and the 0%o activity is the basal activity, 9.7 1.3 pmol/min per mg.
Ceff Biology: Takahashi et al.
Proc. Natl. Acad. Sci. USA 90 (1993)
IIR cells (Fig. 2C) but not in parental COS-7 cells (data not shown). Man-6-P had no synergistic action on the stimulation by IGF-1I in 13III-2/IGF-IIR cells. These data indicate that the cyclase-stimulating pathway of IGF-II is shared by Man6-P in fIII-2/IGF-IIR cells and thereby show that ,1III-2/ IGF-IIR mediates the cyclase-promoting function induced by both ligands. In the membranes expressing cIGF-IIR cDNA or IGF-IIR cDNA, inhibition of isoproterenol-promoted adenylate cyclase activity was observed in response to IGF-II (Fig. 2D). IGF-II lacked similar effect in parental COS-7 cells. This effect of IGF-II was recorded only in the membranes from cells washed with Man-6-P and then with Man-6-P-free solution. Accordingly, the suppressive effect of IGF-II was abolished by Man-6-P (Fig. 2D). Therefore, in membrane preparations before washing, Man-6-P or lysosomal enzymes would be bound to IGF-IIR and block IGF-II-induced G1 activation through this receptor. We also examined the function of IGF-IIR that lacks the peptide 14 region (IGFIIRA2410-2423). Even in washed membranes, cyclase activity was not inhibited by IGF-II in the cells transfected with this mutant receptor (Fig. 2D). Therefore, IGF-IIR is a G1-coupled receptor whose function is turned on by IGF-II and is mediated by the peptide 14 sequence. To verify the PIII-2/IGF-IIR function, we measured CAT reporter activity in the cell homogenate after cotransfection of fIII-2/IGF-IIR cDNA with the CRE-CAT plasmid. The homogenate of fIII-2/IGF-IIR cells exhibited remarkably increased CAT activity relative to the positive controls (100 ,3111-1 p111-2 pECE chimera chimera Iso Bt2cAMP a3
al
c
pll-2 chimera DNA (gg) 10
3
1
pECE 10
IGF-I1 (+)
ca3 c
FIG. 3. Specific CAT expression in cells cotransfected with and the CRE-CAT cDNAs. (Upper) COS-7 cells were cotransfected with recombinant IGF-IIR cDNAs (10 ,g for each) and 10 Mg of CRE-CAT plasmid. After 48 hr, CAT activity of the cell homogenate was assayed. As controls, COS-7 cells were transfected with 10 Mg of pECE and incubated for 48 hrin the absence or presence of 100 ,uM isoproterenol (Iso) or 1 mM Bt2cAMP during the last 24 hr. (Lower Left) COS-7 cells were transfected with 10 ,g of CRE-CAT plasmid and various amounts of (3111-2/IGF-IIR cDNA, and CAT activity of the cell homogenate was measured. As a negative control, 10 MAg of pECE was transfected. (Lower Right) Cells were transfected with 10 Mg of CRE-CAT plasmid and 10 Mg of,1HII-2/IGF-IIR cDNA. During the last 12 hr, cells were incubated with 10 nM IGF-II (+) or vehicle (-). 3111-1 chimera, BII11-1/IGFIIR-encoding pECE; ,BIII-2 chimera, f3III-2/IGF-IIR-encoding pECE; c, chloramphenicol; al and a3, the two forms of monoacetylated chloramphenicol. Experiments were repeated at least three times and yielded similar results. Data presented are representative.
,BI1-2/IGF-IIR
11775
,uM isoproterenol, 1 mM Bt2cAMP) (Fig. 3 Upper). The homogenate of parental COS-7 cells or of 8III-1/IGF-IIR cells showed virtually no CRE-CAT expression. When a larger amount of f3III-2/IGF-IIR cDNA was transfected, the cell homogenate showed correspondingly higher CAT activity (Fig. 3 Lower Left). IGF-II treatment had an additional effect on CRE-CAT expression (Fig. 3 Lower Right). Cotransfection of 3II-2/IGF-IIR cDNA with a TRE-CAT plasmid resulted in no CAT expression (data not shown). These data are compelling evidence that PIII-2/IGF-IIR activates the adenylate cyclase-cAMP-protein kinase A signaling cascade. We have shown that the G-protein specificity of IGF-IIR in cells is changed from Gi to G. by exchanging its short sequence with that of /32AR. The results are consistent with the G protein-activation signals being interchangeable, selfdetermined structural motifs that function in the setting of either a single-spanning or multispanning receptor. Wess et al. (14) and Lechleiter et al. (15) have reported that limited regions in the muscarinic acetylcholine receptors determine specificity for G proteins, but it is not known whether those regions themselves can generate G protein-activation signals. Peptides derived from a2AR and from rhodopsin inhibit receptor-G protein interaction in crude membranes (16, 17), and peptides derived from a2AR (18), muscarinic acetylcholine receptor (19), and f32AR (8) mimic the cognate receptors by activating G proteins in vitro. On the other hand, data on the in vivo function of partial regions in receptors have been limited. Only Luttrell et al. (20) have reported that the third intracellular loop of ajAR shows an antagonism against phospholipase C activation in intact cells. Our study demonstrates that a short region in a G protein-coupled receptor simulates the physiological function of the entire receptor in intact cells. In cells transfected with a cIGF-IIR cDNA carrying a sequence insertion between two Xho I sites, the adenylate cyclase-promoting activity with and without IGF-II would represent the G.-activating function of the inserted sequence. Thus, the method used here would provide an opportunity to examine the G,-activating function of any sequence in living cells. It is also possible to confer on a receptor the cyclaseactivating function by altering short regions inside the receptor for the BIII-2 sequence. Adenylate cyclase is the bestestablished effector for G, and a good physiological reporter of the signaling activity of Gs-coupled receptors. In contrast, the pluripotent effects of Gi on adenylate cyclase complicate the monitoring of the output of Gi-coupled receptors (21). Therefore, the substitution of functional regions in Gicoupled receptors (19) for the PIII-2 sequence would provide a simpler method for analyzing the signaling mechanism of Gi-coupled receptors, by changing them to Gs-coupled receptors. This study also suggests a mechanism for receptor control of the G-protein activation signals encoded in their cytoplasmic regions (Fig. 4). The data indicate that (i) the chimeric receptor becomes constitutively active and (ii) IGF-II still stimulates the chimeric IGF-IIR function. Thus, the exchange of the G protein-activator regions alone failed to confer complete ligand dependency. A simple interpretation is that another region in IGF-IIR is required to exchange with /32AR to restore ligand dependency. Such a region would suppress the function of the peptide 14 sequence, resulting in low basal activity of IGF-IIR to activate Gi and would also be regulated by IGF-II to decrease its affinity for the G,activator region. IGF-IIR may have such a ligand-responsive, suppressive region because IGF-IIR contains the peptide 14 sequence that can activate G- in the absence of IGF-II (6, 7); nevertheless, purified IGF-IIR can activate G; only in the presence of IGF-II (2, 3). In PIII-2/IGF-IIR, the putative suppressor region, which is primarily intended for regulating
11776
Proc. Natl. Acad Sci. USA 90 (1993)
Cell Biology: Takahashi et al.
quence. In any event, the present method should make it possible to analyze ligand-dependent and -independent functions of any receptor sequence in living cells.
A
m-
I
§ 4_Gi
M Gi-activator Arg241 0-Lys2423 of
B
activation
IGF-IIR
E Gs-aptivator Arg259-Lys273 of BAR Emi Putative constraining sequence of IGF-IIR
I
s-
Gs activation
I
bGs activation
FIG. 4. Model for the regulation mechanism of chimeric ,BIII-2/ IGF-IIR. (A) Authentic receptor. Activity of the Gi-activator peptide 14 sequence (Arg2410-Lys2423) is suppressed in the absence of IGF-II. After exposure to IGF-II, IGF-IIR acquires the ability to activate Gi through the peptide 14 sequence in phospholipid vesicles. Thus, another region in IGF-IIR may constrain the peptide 14 sequence. (B) Chimeric receptor. It is reasonable to assume that the putative constraining sequence in IGF-IIR has a weaker constraining action on the heterologous ,1III-2 sequence than on the native peptide 14 sequence. Escape of the 3III-2 sequence activity from the receptor constraint would keep the larger fraction of the chimeric receptor capable of activating G. without binding IGF-II. The smaller fraction of this receptor, which is kept inactive, would respond to IGF-II binding and release the III-2 sequence from inhibitory conformation. This model is speculative, as it is suggested but not demonstrated by the present study.
the Gi-activator peptide 14 region of IGF-IIR, may have a low affinity for the G.-activator ,BIII-2 sequence of 832AR, which is similar but not identical to the peptide 14 sequence. Therefore, a major fraction of the chimeric receptor would mimic the ligand-activated form of the receptor and be constitutively active. The ability of the chimeric receptor to activate adenylate cyclase in response to IGF-II suggests that there is some interaction between the suppressor region of IGF-IIR and the 811I-2 sequence. Such interaction would produce a minor fraction of the chimeric receptor in which the receptor is inactive and thereby responsive to IGF-II. This hypothesis is consistent with the study (22) that suggested the presence of a ligand-responsive, suppressor element in a1AR. It remains unknown why Man-6-P has positive effect on the (1III-2 sequence in fBIII-2/IGF-IIR, despite the fact that Man-6-P negatively modulates the function of the peptide 14 sequence in IGF-IIR. The positive action of Man-6-P in ,31II-2/IGF-IIR may reflect the presence of a Man-6-Presponsive suppressor region that has high affinity for the peptide 14 sequence but has no affinity for the ,3III-2 se-
K.T. and Y.M. contributed equally to this work. We thank Richard A. Roth for human IGF-IIR cDNA; Shunsuke Ishii for CAT plasmids; Tomoki Okazaki for COS-7 cells; S. Peter Nissley for an anti-IGF-IIR antibody; Ken-ichi Arai, Shigetaka Asano, Toshiro Fujita, and Yoshiomi and Yumi Tamai for support; Judson J. Van Wyk, Robert A. Weinberg, and Harvey F. Lodish for discussion about this work; and Steven R. Goldring, Stephen M. Krane, Stephen M. Strittmatter, Akira Kikuchi, Kenneth Bloch, Mark C. Fishman, John T. Potts, Jr., and Richard A. Roth for critical reading of the manuscript. The technical assistance of Toshimni Okamoto, Yasuko Homma, Misaki Nagashima, Lorraine Duda, and Dovie R. Wylie is greatly acknowledged. This work was supported in part by grants from the Ministry of Education, Science, and Culture of Japan; the Mochida Memorial Foundation for Medical and Pharmaceutical Research; the Arima Memorial Foundation for Medical Research; the Kudo Science Foundation; and the Uehara Foundation. K.T. was a recipient of fellowships from the Japan Research Foundation for Clinical Pharmacology, the Nakatomi Foundation, and the Japan Heart Foundation. T.O. was a recipient of fellowships from the Byotai-Taisha Foundation and the Mochida Memorial Foundation. 1. Bourne, H. R., Sanders, D. A. & McCormick, F. (1990) Nature (London) 348, 125-132. 2. Nishimoto, I., Murayama, Y., Katada, T., Ui, M. & Ogata, E. (1989) J. Biol. Chem. 264, 14029-14038. 3. Murayama, Y., Okamoto, T., Ogata, E., Asano, T., Iiri, T., Katada, T., Ui, M., Grubb, J. H., Sly, W. S. & Nishimoto, I. (1990) J. Biol. Chem. 265, 17456-17462. 4. Okamoto, T., Asano, T., Harada, S., Ogata, E. & Nishimoto, I. (1991) J. Biol. Chem. 266, 1085-1091. 5. Kornfeld, S. (1992) Annu. Rev. Biochem. 61, 307-330. 6. Okamoto, T., Katada, T., Murayama, Y., Ui, M., Ogata, E. & Nishimoto, I. (1990) Cell 62, 709-717. 7. Okamoto, T. & Nishimoto, I. (1991) Proc. Natl. Acad. Sci. USA 88, 8020-8023. 8. Okamoto, T., Murayama, Y., Hayashi, Y., Inagaki, M., Ogata, E. & Nishimoto, I. (1991) Cell 67, 723-730. 9. O'Dowd, B. F., Hantowich, M., Regan, J. W., Leader, W. M., Caron, M. G. & Lefkowitz, R. J. (1988) J. Biol. Chem. 263, 15985-15992. 10. Nishimoto, I., Okamoto, T., Matsuura, Y., Okamoto, T., Murayama, Y. & Ogata, E. (1993) Nature (London) 362, 75-79. 11. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051. 12. Matsuda, S., Maekawa, T. & Ishii, S. (1991) J. Biol. Chem. 266, 18188-18193. 13. Kiess, W., Thomas, C. L., Greenstein, L. A., Lee, L., Sklar, M. M., Rechler, M. M., Sahagian, G. G. & Nissley, S. P. (1989) J. Biol. Chem. 264, 4710-4714. 14. Wess, J., Brann, M. R. & Bonner, T. I. (1989) FEBS Lett. 258, 133-136. 15. Lechleiter, J., Heilmiss, R., Duerson, K., Ennulat, D., David, N., Clapham, D. & Peralta, E. (1990) EMBO J. 9, 4381-4390. 16. Dalman, H. M. & Neubig, R. R. (1991) J. Biol. Chem. 266, 11025-11029. 17. Konig, B., Arendt, A., McDowell, J. H., Kahlert, M., Hargrave, P. A. & Hofmann, K. P. (1989) Proc. Natl. Acad. Sci. USA 86, 6878-6882. 18. Ikezu, T., Okamoto, T., Ogata, E. & Nishimoto, I. (1992) FEBS Lett. 311, 29-32. 19. Okamoto, T. & Nishimoto, I. (1992) J. Biol. Chem. 267, 8342-8346. 20. Luttrell, L. M., Ostrowski, J., Cotecchia, S., Kendall, H. & Lefkowitz, R. J. (1993) Science 259, 1453-1457. 21. Federman, A. D., Conklin, B. R., Schrader, K. A., Reed, R. R. & Bourne, H. R. (1992) Nature (London) 356, 159-161. 22. Kjelsberg, M. A., Cotecchia, S., Ostrowski, J., Caron, M. G. & Lefkowitz, R. J. (1992) J. Biol. Chem. 267, 1430-1433. 23. Morgan, D. O., Edman, J. C., Standring, D. N., Fried, V. A., Smith, M. C., Roth, R. A. & Rutter, W. J. (1987) Nature (London) 329, 301-307.
