Regulation of ATG8 membrane association by ATG4

Basic Research Paper

Autophagy 9:9, 1334–1348; September 2013; © 2013 Landes Bioscience

Regulation of ATG8 membrane association by ATG4 in the parasitic protist Toxoplasma gondii Marie A. Kong-Hap,1 Annabelle Mouammine,1,† Wassim Daher,1,2 Laurence Berry,1 Maryse Lebrun,1 Jean-François Dubremetz1 and Sébastien Besteiro1,* UMR 5235 CNRS; Universités de Montpellier 1 et 2; Dynamique des Interactions Membranaires Normales et Pathologiques; Montpellier, France; 2 Department of Microbiology and Molecular Medicine; Faculty of Medicine; Centre Medical Universitaire; Geneva, Switzerland

1

†

Current affiliation: UMR 1333 INRA; Université de Montpellier 2; Diversité, Génomes & Interactions Microorganismes–Insectes; Montpellier, France

Keywords: Toxoplasma, autophagy, ATG8, ATG4, peptidase, protease, apicoplast, mitochondrion, plastid Abbreviations: ATc, anhydrotetracycline; ATG, autophagy-related; cKD, conditional knock-down; comp, complemented; DAPI, 4´,6-diamidino-2-phenylindole; DIC, differential interference contrast; DMEM, Dulbecco’s modified Eagle’s medium; GFP, green fluorescent protein; HA, hemagglutinin; HBSS, Hank’s balanced salt solution; HFF, human foreskin fibroblasts; HxGPRT, hypoxanthine guanine phosphoribosyl transferase; IFA, immunofluorescence assay; Ku80, 80 kDa Ku subunit; PAGE, polyacrylamide gel electrophoresis; PE, phosphatidylethanolamine; RT-PCR, reverse transcription polymerase chain reaction; SDS, sodium dodecyl sulphate; TATi-1, trans-activator trap identified 1; tetO7, tetracyclin operator

In the process of autophagy, the Atg8 protein is conjugated, through a ubiquitin-like system, to the lipid phosphatidylethanolamine (PE) to associate with the membrane of forming autophagosomes. There, it plays a crucial role in the genesis of these organelles and in autophagy in general. In most eukaryotes, the cysteine peptidase Atg4 processes the C terminus of cytosolic Atg8 to regulate its association with autophagosomal membranes and also delipidates Atg8 to release this protein from membranes. The parasitic protist Toxoplasma gondii contains a functional, yet apparently reduced, autophagic machinery. T. gondii Atg8 homolog, in addition to a cytosolic and occasionally autophagosomal localization, also localizes to the apicoplast, a nonphotosynthetic plastid bounded by four membranes. Our attempts to interfere with TgATG8 function showed that it appears to be essential for parasite multiplication inside its host cell. This protein also displays a peculiar C terminus that does not seem to necessitate processing prior to membrane association and yet an unusually large Toxoplasma homolog of ATG4 is predicted in the parasite genome. A TgATG4 conditional expression mutant that we have generated is severely affected in growth, and displays significant alterations at the organellar level, noticeably with a fragmentation of the mitochondrial network and a loss of the apicoplast. TgATG4depleted parasites appear to be defective in the recycling of membrane-bound TgATG8. Overall, our data highlight a role for the TgATG8 conjugation pathway in maintaining the homeostasis of the parasite’s organelles and suggest that Toxoplasma has evolved a specialized autophagic machinery with original regulation.

Introduction Autophagy is a catabolic process conserved in most eukaryotic cells. Mechanistically, autophagy is subdivided into several types, some of which are highly specialized and are specific of particular cell types. Macroautophagy is the most conserved and the most studied form of autophagy and hence it will here be referred to as “autophagy.” This process involves the formation of a double-membrane structure, called the autophagosome, to sequester cytosolic or organellar material.1 Autophagosomes will then fuse with a lytic compartment for degradation and recycling of this cellular material. At a basal level, the autophagic pathway delivers misfolded or long-lived cytoplasmic proteins and

damaged organelles to lysosomes for degradation and recycling. It is also involved in response to nutrient stresses or to infections by pathogens. In general, autophagy can act as a cell protector and its dysfunction is correlated with diverse pathologies; hence, understanding the signaling pathways involved in the regulation of autophagy has become important for several therapeutic strategies.2 The molecular machinery involved in the autophagic process has been mainly characterized in yeast through a series of genetic screens, and to date, more than 35 autophagy-related (ATG) genes have been identified.3 Among all Atg proteins, Atg8 occupies a central position.4 First, it is essential to the process of autophagosome formation, especially for the membrane expansion

*Correspondence to: Sébastien Besteiro; Email: [email protected] Submitted: 11/19/12; Revised: 05/23/13; Accepted: 05/27/13 http://dx.doi.org/10.4161/auto.25189 1334 Autophagy

Volume 9 Issue 9



step that will in part determine the size of the organelle.5,6 Second, it also appears to be involved in specific cargo recognition.7 Atg8 is present as a soluble form in the cytosol, and, upon induction of autophagy, gets recruited to the autophagosomal membrane thanks to a machinery that resembles ubiquitin-conjugation systems.8 Briefly, in most eukaryotes, Atg8 is activated by Atg7, an E1-like protein, and subsequently conjugated to the lipid phosphatidylethanolamine (PE) through the action of Atg3, an E2-like enzyme. Prior to this, Atg8 has to be C-terminally cleaved by the cysteine peptidase Atg4 to expose the specific glycine residue that will be conjugated to PE. While Atg8 binds to both sides of the phagophore as it is being generated, Atg4 also appears to be able to release outer membrane-bound Atg8 upon completion of the autophagosome. It is not currently known what regulates the Atg4-dependent cleavage of Atg8–PE, but both this and Atg4-dependent maturation of Atg8 prior to conjugation likely participate in a post-translational regulation of Atg8 function. Toxoplasma gondii is a parasitic protist and the causative agent of toxoplasmosis which is a widespread disease of man.9 Toxoplasma belongs to the phylum Apicomplexa, which includes very important human pathogenic species such as Plasmodium spp., the causative agent of malaria. These parasites share specialized apical secretory organelles (rhoptries and micronemes), as well as a relict plastid called the apicoplast. The apicoplast is bounded by four membranes, which are related to the secondary endosymbiosis of a plastid-bearing red alga.10 This organelle is nonphotosynthetic, but it harbors metabolic pathways similar to those found in plant and algal chloroplasts that directly contribute to the survival of the apicomplexan parasites; it thus contains potential targets for disease-controlling drugs. Database searches currently show that T. gondii appears to contain a limited set of Atg proteins, yet it contains the core machinery involved in the conjugation of Atg8 to PE. Moreover, when tachyzoites (the invasive form of the parasite that multiplies intracellularly) are starved for amino acids, they generate TgATG8decorated double-membrane autophagosomes, showing that the pathway is probably functional and can be regulated.11 When interfering with TgATG3 function in T. gondii, not only TgATG8 lipidation was prevented, but the parasites were severely affected in growth and showed marked organellar defects. More precisely, the mitochondrial network was fragmented in TgATG3-depleted parasites. Overall, this suggests that TgATG3 and TgATG8 have a prosurvival function in the parasites, possibly because they are involved in maintaining the homeostasis of important organelles. Of course, in these divergent eukaryotes, pleiotropic functions are possible for autophagy proteins and their involvement in cellular processes promoting either life or death is currently being investigated.12,13 In the present report, we provide a further characterization of TgATG8 and its regulation machinery and reveal several unusual features for this protein and associated peptidase TgATG4. Results TgATG8 appears to be important for the growth of tachyzoites. To investigate directly the role of TgATG8 in T. gondii,

we attempted to interrupt the open reading frame of the corresponding gene by a single homologous crossover14 resulting in the integration of a plasmid bearing a 5´ TgATG8 cassette, as diagrammed in Figure S1A. Despite repeated attempts in the RH-derived Ku80Δ strain, which is more amenable to targeted gene deletion,15 this approach did not yield viable knock-in parasites. Only when using a sequential semi-nested PCR strategy we could efficiently amplify fragments that would correspond to the recombined locus (Fig. S1B), suggesting that very few transgenic parasites were present in the population of transfected parasites. These appeared to be progressively lost within the population, possibly because of a reduced fitness compared with those still retaining the endogenous locus. This result suggests that the expression of TgATG8 is critical for the survival of T. gondii inside its host cell. TgATG8 partly localizes to the apicoplast. Our previous work has shown that when overexpressing a GFP-fused version of TgATG8 in tachyzoites, the protein is essentially localized in the cytosol and gets recruited to autophagosomes upon induction of autophagy by amino acid starvation.11 Besides the cytosolic and autophagosomal localizations of TgATG8, a weaker and transient GFP signal could also be seen in the Golgi apparatus/apicoplast area, but was not examined further at the time.11 Contrarily to the overexpressed GFP-TgATG8, native TgATG8 detected with a specific antibody, appears to be already present in significant proportions as a lipidated protein in basal conditions, suggesting it might be bound to cellular membranes to a considerable extent.11 Moreover, very recent reports have been mentioning the presence of ATG8 at the apicoplast in intracellular T. gondii tachyzoites in specific stress conditions,16 but also during intra-erythrocytic development of the related apicomplexan parasite Plasmodium.17 We sought to re-evaluate TgATG8 localization by immunofluorescence assay (IFA) with the anti-TgATG8 antibody. Interestingly, besides its cytosolic localization, we could see a TgATG8 signal delineating the characteristic V-shape of dividing apicoplasts in several intracellular parasites (Fig. 1A). We then re-examined GFPTgATG8 localization and could indeed detect an apicoplast localization of this fusion protein in several, but not all, tachyzoites (Fig. 1B). This labeling was mostly found in dividing parasites and was clearly distinct from the signal corresponding to autophagosomes (Fig. 1A and B, arrowhead), which is occasionally found in intracellular parasites.11 Moreover, the association of TgATG8 with the apicoplast does not seem to be enhanced by the induction of autophagy by starvation for example (data not shown). To determine whether the association of TgATG8 with the apicoplast is dependent on the lipidation status of TgATG8, we further assessed the localization of a glycine mutant of GFPTgATG8 (we replaced the C-terminal glycine by an alanine) that cannot be conjugated to PE.11 We could see that GFPTgATG8G124A was essentially cytosolic and thus largely absent from the apicoplast (Fig. 1C). This indicates that TgATG8 is probably associated with one of the membranes of the apicoplast through an association with PE, which has also been very recently suggested for P. berghei ATG8.18

www.landesbioscience.com Autophagy 1335

Figure 1. TgATG8 localizes to the apicoplast. (A) IFA on intracellular tachyzoites using anti-TgATG8 antibody to detect native TgATG8 and anti-ATrx1 to detect the apicoplasts. Arrowhead shows a putative autophagosome. (B) GFP-TgATG8 and the apicoplast protein marker ATrx1 show partial colocalization in the GFP-TgATG8 overexpressing cell line. Also shown are magnified images from selected areas (white squares). Arrowhead shows a putative autophagosome. (C) Similar analysis as in (B), performed with the GFP-TgATG8G124A mutant (unlipidated version of TgATG8) overexpressing cell line. A magnified image from selected area (white square) is shown. DNA was labeled with DAPI. For all images, scale bar: 5 µM.

The C terminus of TgAtg8 can be cleaved by an endogenous peptidase. The conjugation of Atg8 to the autophagosomal membrane, as described in other eukaryotic systems such as yeast or mammals, resembles ubiquitination.8 Atg8 first undergoes proteolytic maturation by the Atg4 peptidase to expose a C-terminal glycine that is then conjugated to PE through the action of the Atg7Atg3 system.19,20 Thus, most eukaryotic Atg8 orthologs described so far possess one or several amino acids after their C-terminal glycine. Surprisingly, the C-terminal end of TgATG8 and of most of the predicted Atg8 orthologs from related apicomplexan

parasites is already ending with a glycine residue.11 This raises the possibility that a TgATG4 peptidase activity may not be required for regulating the conjugation of TgATG8 to the autophagosomal membrane. However, similar with deubiquitination, Atg4 is also able to cleave the amide bond in the Atg8–PE conjugate to release the protein from PE in membranes and it is assumed that this would have a role in the recycling of Atg8 from the membrane upon completion of the autophagosomes.19,20 Hence the possibility remains that such an activity would be retained in Toxoplasma for recycling of TgATG8.

1336 Autophagy

Volume 9 Issue 9

Figure 2. The C terminus of TgATG8 can be cleaved by an endogenous peptidase whose activity is upregulated by starvation. (A) Left inset: fluorescence microscopy analysis of extracellular tachyzoites expressing GFP-TgATG8, C-terminally HA-tagged GFP-TgATG8-HA, and its mutated version on the P2 amino acid (GFP-TgATG8-P2mut-HA). Tachyzoites shapes are delineated by dashed lines. Autophagosome-containing parasites are indicated with arrowheads. Scale bar: 5 µm. Right: proportion of parasites bearing GFP-TgATG8-labeled autophagosomes was quantified after inducing of autophagy for 8 h in HBSS. Data are mean from n = 3 independent experiments ± SEM (B) western blot analysis, after urea SDS-PAGE separation of protein extracts from the cell lines described in (A) that were either unstarved or starved for 8 h. The anti-GFP antibody was used to detect unprocessed (GFPTgATG8-HA), processed (GFP-TgATG8) and lipidated (GFP-TgATG8-PE) forms. The anti-HA antibody was used to identify the unprocessed form and quantify cleavage of the HA epitope tag. ROP5 was used as a loading control.

To test whether a parasite peptidase has retained the ability to cleave at the C terminus of TgATG8, we constructed several variants of GFP-TgATG8 by site-directed mutagenesis. First, we added an extra amino acid (a cysteine) after the glycine, to establish whether this would prevent lipidation of GFP-TgATG8 and its association to the autophagosome. Constructs for expressing GFP-TgATG8, GFP-TgATG8X125C, and a GFP-TgATG8G124A glycine mutant as a negative control, were independently transfected into tachyzoites and GFP-positive clones were selected. Autophagy was induced by starvation in amino acid-depleted medium and the appearance of autophagosomes was monitored by fluorescence microscopy as described earlier.11 While the proportion of autophagosomebearing cells increased along time in the GFP-TgATG8 control cell line, we did not observe an autophagosomal localization of GFP-TgATG8G124A protein, as expected. Interestingly, the GFPTgATG8X125C cell line was found to display autophagosomes upon starvation (Fig. S2A). We followed by western blot the lipidation of GFP-TgAtg8 in the different cell lines following starvation. Consistent with the microscopy results, no lipidated form could be detected for GFP-TgATG8G124A, while GFP-TgATG8X125C

did produce the GFP-TgATG8-PE form, as did wild-type GFPTgATG8 (Fig. S2B). To further assess whether there is a peptidase with the ability to cleave TgATG8’s C-terminal end, we also generated a construct with a hemagglutinin (HA) epitope tag that we would be able to detect immunologically (GFP-TgATG8-HA). Additionally, we generated a version of this GFP-TgATG8-HA construct that has been mutated to replace the penultimate amino acid (position P2 of the putative cleavage site), in order to see whether this would impair cleavage by the peptidase. After transfection of the parasites and selection of transgenic clones, autophagy was induced by amino acid starvation. As monitored by fluorescence microscopy,11 vesicular fluorescent signal could be found in GFPTgATG8-HA-expressing parasites upon induction of autophagy by starvation (Fig. 2A), which suggests that the HA tag could be efficiently cleaved to allow lipidation of GFP-TgATG8 C-terminal end and its conjugation to autophagosomes. To confirm this, corresponding parasite extracts were also analyzed by western blot after urea SDS-PAGE to allow separation of the different forms of GFP-TgATG8. We could demonstrate that


Figure 3. Detection of TgATG4 and generation of a TgATG4 conditional mutant cell line. (A) Schematic representation of the strategy to replace TgATG4 endogenous promoter, by an ATc-regulated promoter. Arrows represent primers used for PCR detections presented in (B) and expected sizes of the fragments shown in italics. TATi-1, trans-activator trap identified 1; HxGPRT, hypoxanthine guanine phosphoribosyl transferase selection marker; tetO7, tet operator; pSAG1, SAG1 minimal promoter. (B) PCR analysis of native and recombined promoter regions. Genomic DNA from parental Ku80Δ, TgATG4 conditional knockdown clone and cosmid-complemented clone, were submitted to PCR analysis with the couple of primers depicted in (A). (C) Semiquantitative RT-PCR analysis of TgATG4 expression in the mutant and complemented cell lines, preceded or not by three days of induction by ATc to regulate expression. Primers specific of the gene coding for tubulin β chain were used as a control. (D) Western blot detection of TgATG4 after a 3–8% acrylamide gradient SDS-PAGE separation of protein extracts from TgATG4 conditional knockdown mutant and cosmid-complemented cell line (from parasites previously incubated for 4 d with ATc or not) and from a Ty-tagged TgATG4 cell line. Blot on the left was revealed with the anti-TgATG4 antibody and asterisks denote cross-reacting proteins. Blot on the right was revealed with the anti-Ty antibody and the arrow designates TgATG4-Ty. Anti-ROP5 was used as a loading control. (E) IFA of TgATG4-Ty cell line and Ku80Δ parental cell line with the anti-TgATG4 or anti-Ty antibodies to label TgATG4 and its tagged version. Arrowheads mark vesicles corresponding to probable cross-reacting signal. DNA was labeled with DAPI. Scale bar: 5 µm.

the P2 mutant version of GFP-TgATG8-HA cannot be cleaved and is thus not lipidated (Fig. 2B). On the contrary, the HA tag fused to GFP-TgATG8 with a wild-type C terminus is cleaved, as evidenced by the detection of the GFP-TgATG8 protein and of its lipidated version GFP-TgATG8-PE (Fig. 2B). The tag appears to be almost constitutively cleaved, even in basal conditions; however, the cleavage of remaining HA is enhanced when

starving the extracellular parasites prior to analysis, as evidenced by the lesser amount of GFP-TgATG8-HA detected with the anti-HA antibody in these conditions (Fig. 2B). Taken together, these data demonstrated that there is in T. gondii, a peptidase that is able to cleave TgATG8 after the glycine residue, and that this peptidase activity is regulated and coordinated with the induction of autophagy.

1338 Autophagy

Volume 9 Issue 9

Figure 4. TgATG4-depleted tachyzoites are deficient in intracellular growth. (A) Confluent monolayers of fibroblasts were infected with Ku80Δ, TgATG4 conditional knockdown and cosmid-complemented parasites and kept for five days in the absence or presence of ATc. Plaques resulting from the lysis of host cells due to the multiplication of the parasites are only visible when TgATG4 is expressed. (B) Mean plaque area comparisons between fibroblast layers infected with controls and TgATG4-depleted parasites. Plaques observed with the mutant in the presence of ATc were significantly smaller than with control cell lines in the same conditions. A.U., arbitrary units. Data are mean from n = 6 independent experiments ± SEM (C) Ku80Δ, TgATG4 knockdown and cosmid-complemented parasites were kept in the presence of ATc for four days prior to invasion of a fibroblast monolayer and, after 24 h still in the presence of ATc, numbers of parasites per vacuole were counted. Numbers of parasites per vacuole are significantly lower in TgATG4-depleted cell line compared with controls 24 h post-invasion. Data are mean from n = 4 independent experiments ± SEM.

Generating a conditional knockdown mutant of TgATG4. The analysis of apicomplexan genome data revealed the presence of a protein with a significant degree of sequence similarity with Atg4 from yeast.11 Alignment of T. gondii putative TgATG4 with yeast and human protein sequences shows a conserved active site and catalytic triad (C, D and H), but also highlights unconventional sequence insertions that intersperse the conserved regions in TgATG4 (Figs. S3 and S4). Consequently, putative TgATG4 is predicted to be significantly larger than Atg4 from other eukaryotes (400 kDa, vs. about 40 kDa for yeast and human orthologs). One should note that these insertions bear no significant homology with other known proteins or a particular functional domain. Yet, the proteomics data available on the ToxoDB genomic database identifies several peptides matching these regions, confirming they were parts of an expressed protein

(Fig. S3). To confirm the database predictions, we have PCRamplified, cloned, sequenced and built a contig for TgATG4 cDNA (GenBank accession number KC175547). The 11,420 nucleotides-long cDNA, from the 5´ noncoding end to the stop codon, predicts a corresponding protein of 390 to 398 kDa, depending on which methionine is used as the start codon (there are three in-frame potential ATG codons). We sought to generate TgATG4 mutants to study the function of the corresponding protein in the parasites. In spite of repeated attempts, using a cosmid-based strategy (with large flanking regions)21 and the Ku80Δ cell line to favor homologous recombination, so far we have not been able to remove or disrupt the corresponding gene. Similar to what we have described above for TgATG8, this suggests an important role of TgATG4 for parasite growth (data not shown). Consequently, we next


Figure 5. TgATG4-depleted parasites show a defect in mitochondrion morphology. (A) Ku80Δ, TgATG4 conditional knockdown and cosmid-complemented parasites were kept in the presence of ATc for four days and then allowed to invade new host cells. Twenty-four hours later, parasites were fixed and analyzed by IFA with a mitochondrial protein marker. The mitochondrial network is significantly fragmented in TgATG4-depleted parasites. DNA was labeled with DAPI. Scale bar: 5 µm. (B) Quantification of the percentage of parasites with fragmented mitochondria after incubation in the presence or absence of ATc. At least 200 parasites were counted per experiment. Data are mean from n = 4 independent experiments ± SEM (C) Altered mitochondrial ultrastructure in TgATG4-depleted tachyzoites observed by electron microscopy. Ultrathin section of a TgATG4-depleted (5 d of incubation with ATc) tachyzoite showing the dramatic alteration of the mitochondrion. Insets are magnified images from selected areas showing an apparently intact part of the mitochondrial network (a) and a severely altered part of the network, were cristae remnants are still visible, but which is encircled by multiple layers of membranes (b). Mito, mitochondrion, Nu, nucleus, Mic, micronemes. Scale bar: 1 µm.

tried to generate a conditional knockout cell line for TgATG4 in the Ku80Δ cell line. To this end, we used a strategy based on the replacement of the native promoter region of TgATG4 by an anhydrotetracycline (ATc)-regulated promoter (Daher W, Soldati-Favre D, unpublished). With this approach (Fig. 3A), the transactivator cassette (TATi-1) is put under the dependence of the native promoter, with the aim to ensure a timing of expression similar to the one of the wild-type gene during the cell cycle; however, in these conditions, the level of expression of TgATG4 is driven by a SAG1 promoter and thus might be different from the native one. After transfection of the plasmid, several clones were isolated in which 5´ and 3´ integrations at the genomic locus were assessed by PCR with specific primers (Fig. 3B). One clone was chosen for subsequent analyses and this conditional knockdown transgenic cell line was named cKD TgATG4. In the cKD TgATG4 genetic background, we generated a complemented cell line by transfecting a cosmid (ToxPG30) containing the TgATG4 locus to re-express the gene; this cell line was named

cKD TgATG4 comp. Semi-quantitative RT-PCR analysis was performed with specific primers on samples from parasites kept in the presence of ATc for three days. It confirmed that TgATG4 expression could indeed be efficiently diminished by ATc in the conditional knockdown cell line, while the complemented cell line displayed restored TgATG4 expression levels (Fig. 3C). Even without ATc, the conditional knockdown cell line presented a lower expression of TgATG4 than in the parental Ku80Δ cell line (Fig. 3C); as aforementioned, this could be explained by the modified SAG1 promoter that would be weaker than native TgATG4 promoter. To detect TgATG4, we raised an antibody directed against the conserved active site region, in the C terminus of the protein. Even after affinity purification, the antibody was revealing a complex pattern of proteins by western blot after a separation by 3–8% acrylamide gradient SDS-PAGE (Fig. 3D). To confirm the specificity of the antibody, we generated a transgenic cell line to directly fuse a Ty epitope tag to the C terminus of native TgATG4.

1340 Autophagy

Volume 9 Issue 9

that TgATG4 is primarily a cytosolic protein and that the vesicular signal observed with anti-TgATG4 antibody is probably due to cross-reactivity of this antiserum with other T. gondii proteins (Fig. 3E). TgATG4 is important for intracellular multiplication of T. gondii tachyzoites and for maintaining organellar homeostasis. We examined the effects of TgATG4 depletion on parasite growth by plaque assays. After continuous incubation with ATc during 5 d, the conditional knockdown cell line displayed significantly smaller plaques than parental Ku80Δ cell line on the monolayers of host fibroblasts and the complemented cell line showed a restoration of the wild-type phenotype (Fig. 4A and B). One should note that even without ATc, the cKD TgATG4 cell line produced somewhat smaller plaques than the parental cell line, which could be linked to the reduced basal TgATG4 expression in this transgenic cell line; however, the addition of ATc clearly amplified this effect, which shows that TgATG4 expression is efficiently regulated by this drug. Ku80Δ, mutant and complemented parasites were preincubated with ATc for 4 d and Figure 6. TgATG4-depleted parasites tend to lose the apicoplast. (A) Ku80Δ, TgATG4 conditional were then allowed to invade host cells. knockdown and cosmid-complemented parasites were kept in the presence of ATc for four days and Cultures were kept in the presence of then allowed to invade new host cells. Twenty-four hours later, parasites were fixed and analyzed by ATc, then fixed 24 h later and numbers IFA with an apicoplast protein marker. The apicoplast appears to be missing from a significant number of TgATG4-depleted parasites. DNA was labeled with DAPI. Scale bar: 5 µm. (B) Quantification of of parasites per vacuole were counted. the percentage of parasites with missing apicoplast after incubation with or without ATc. At least 200 TgATG4-depleted parasites showed a parasites were counted per experiment. Data are mean from n = 3 independent experiments ± SEM. considerable delay in growth compared with controls, and they did not progress This was achieved by a single homologous recombination at the through cell division as they accumulated vacuoles with mostly endogenous locus.14 Corresponding TgATG4-Ty transgenic one or two parasites (Fig. 4C). parasites were analyzed with an anti-Ty antibody. Western As the growth of tachyzoites was severely affected following blot analysis showed unambiguously that TgATG4 is indeed a TgATG4 depletion, we sought to investigate whether this was large protein, detected at around 460 kDa on the gradient gel. associated with a specific morphological defect. We used a This allowed the identification of TgATG4 among the proteins comprehensive set of antibodies recognizing specific subcellular recognized by the anti-TgATG4 antibody by western blot. The structures within the tachyzoites. Secretory organelles rhoptries, corresponding protein was found to be undetectable in extracts micronemes and dense granules, as well as the inner membrane from the conditional knockdown cell line, but also without complex (a subpellicular membrane network that defines the induction by ATc (Fig. 3D), which is consistent with our RT-PCR periphery of both tachyzoites and nascent daughter cells), were data (Fig. 3C) and this confirms the SAG1 promoter is probably apparently not significantly affected (Fig. S5). On the contrary, weaker than native TgATG4 promoter. There is nevertheless the mitochondrial network was affected as illustrated by a probably a residual amount of TgATG4 protein in conditional significant fragmentation observed in more than 60% of the knockdown parasites in the absence of ATc, which might be mutant parasites (Fig. 5A and B). We used electron microscopy to expected to be sufficient to perform its cellular function, and can investigate more precisely the subcellular aspect of the TgATG4be further depleted by the addition of the drug. IFA with anti- depleted parasites and we identified several mitochondrial defects, TgATG4 showed a dual localization (cytosolic and vesicular) in including large membranous structures next to, or encircling, intracellular parasites. IFA analysis with the anti-Ty confirmed vestigial cristae (Fig. 5C). This phenotype is reminiscent of what


Figure 7. TgATG8 can be a substrate for TgATG4. (A) Western blot analysis, after urea SDS-PAGE separation of protein extracts from parasites put in starvation medium for 8 h or not. Transgenic parasites analyzed are expressing GFP-TgATG8, C-terminally HA-tagged GFP-TgATG8-HA, or are TgATG4 mutant and complemented cell lines preincubated for 4 d with ATc and transiently expressing the GFP-TgATG8-HA construct. The anti-GFP antibody was used to detect unprocessed (GFP-TgATG8-HA), processed (GFP-TgATG8) and lipidated (GFP-TgATG8-PE) forms. The anti-HA antibody was used to identify the unprocessed form and quantify cleavage of the HA epitope tag. (B) Left: western blot analysis of endogenous TgATG8 in Ku80Δ, TgATG4 mutant and complemented cell lines preincubated for 4 d with ATc and either unstarved or put in starvation medium for 8 h. Anti-ROP5 was used as a loading control. Right: band densitometry quantification of the lipidated/unlipidated TgATG8 ratio. Data are mean from n = 3 independent blots ± SEM *p < 0.05 by Student’s t-test. (C) TgATG4 mutant and cosmid-complemented parasites preincubated for 4 d with ATc and made to invade new host fibroblasts for 24 h before being fixed and processed for IFA using an anti-TgATG8 antibody and with an apicoplast protein marker. Arrowheads indicate vesicular accumulation of TgATG8. Arrow indicates an example of TgATG8 localization at a remaining apicoplast. DNA was labeled with DAPI. Scale bar: 5 µm.

we have previously observed with a TgATG3 conditional mutant.11 Importantly, we found that the apicoplast was also affected in the TgATG4 mutant, as about 60% of these parasites strikingly lost apicoplast protein markers (Fig. 6A and B). During electron microscopic observations of these mutants, clearly recognizable apicoplasts were rarely seen after five days of incubation with ATc, suggesting a loss of the organelle (data not shown). This particular phenotype had not previously been noticed in the TgATG3 mutant, so we re-evaluated this mutant regarding the presence of apicoplast markers. We found that, although slightly less pronounced in the TgATG3-depleted parasites, a loss of apicoplast markers was also noticeable in these parasites (Fig. S6).

Overall, our data show that the loss of TgATG4 impedes the development of intracellular tachyzoites and that this appears to be linked to a loss of function of organelles such as the mitochondrion and the apicoplast, which are significantly affected. TgATG4 is capable of cleaving TgATG8, possibly to regulate its membrane association. TgATG4 is our candidate peptidase for mediating the TgATG8 cleavage that we demonstrated using the GFP-TgATG8-HA reporter construct. We thus attempted to express this construct transiently in the cKD TgATG4 mutant and its complemented cell line to assess its cleavage. We could show that the HA tag can be cleaved efficiently in the complemented cell line, as with the GFP-TgATG8-HA-expressing RH control,

1342 Autophagy

Volume 9 Issue 9

Figure 8. GFP-TgATG8 accumulates as a membrane-bound form in TgATG4-depleted parasites. (A) Transgenic parasites analyzed are the RH strain expressing GFP-TgATG8, or the TgATG4 mutant and complemented cell lines preincubated for 3 d with ATc and transfected to express the GFP-TgATG8 construct. They were subsequently left for an additional 24 h to invade host fibroblasts, still in the presence of ATc. A significant proportion of intracellular mutant parasites displayed a marked colocalization with the apicoplast, which appeared abnormally enlarged and was occasionally found to be expelled in the parasitophorous vacuole (whose boundaries are marked by the dashed line). Scale bar: 5 µm. (B) Western blot analysis of cell extracts from the RH strain expressing GFP-TgATG8 or the TgATG4 conditional knockdown mutant transiently expressing GFP-TgATG8, that were preincubated for 4 d with ATc and either unstarved or put in starvation medium for 8 h. Anti-ROP5 was used as a loading control. Right: band densitometry quantification of the lipidated/unlipidated GFP-TgATG8 ratio. Data are mean from n = 3 independent blots ± SEM *p < 0.05 by Student’s t-test.

and the cleavage is increased in the amino acid-starvation conditions that trigger autophagy (Fig. 7A). On the contrary, the TgATG4 mutant accumulates the uncleaved GFP-TgATG8-HA form, which is consequently not lipidated (Fig. 7A). Moreover, in parallel to the western blot analysis, we could verify by microscopy that in the TgATG4-depleted cell line, GFP-TgATG8-HA does not associate with autophagic vesicles upon induction of autophagy (Fig. S7). These data suggest that TgATG8 can be a substrate for TgATG4. To assess the effect of TgATG4 depletion on native TgATG8, we analyzed the lipidation status of this protein in the conditional mutant cell line using the anti-TgATG8 antibody. Western blot analyses were performed on cell extracts obtained from extracellular parasites that were exposed to amino acid-deprived or nondeprived, control conditions. While Ku80Δ control and

cosmid-complemented cell lines showed an increase in the lipidated form of TgATG8 following starvation, TgATG4-depleted parasites already displayed significantly high levels of lipidated TgATG4 in nutrient-rich conditions (Fig. 7B). We then assessed TgATG8 localization by IFA in intracellular parasites, which usually display very few autophagosomes.11 As described earlier, intracellular parasites of the complemented cell line displayed a cytosolic localization, or a dual cytosolic and apicoplast localization for TgATG8 (Fig. 7C). Interestingly, in TgATG4-depleted parasites, in addition to the apicoplast signal (when this one was still present), there was a marked localization of TgATG8 on vesicular structures that were distinct from fragmented mitochondria (Fig. 7C and data not shown). These vesicular structures were found in 25% of the tachyzoites (± 5% SEM, n = 3), while they were essentially absent from parasites of the complemented cell line.


As the native protein is already significantly present as a lipidated form in basal conditions, we sought to evaluate the effect of TgATG4 depletion when parasites are overexpressing the GFPTgATG8 construct, which is mainly present as a soluble form in these conditions. Moreover, the GFP-TgATG8 is generally brighter and more amenable to quantification by fluorescence microscopy than native TgATG8. Thus, we transiently expressed GFP-TgATG8 in the TgATG4-depleted parasites, complemented cell line or RH strain. Parasites were classified and quantified according to the type of GFP-TgATG8 localization and the presence or absence of apicoplast (Fig. S8A). In contrast with the GFP-TgATG8-expressing RH or complemented control cell lines in which GFP-TgATG8 showed a cytosolic or faint apicoplast signal, in TgATG4-depleted parasites GFP-TgATG8 localized prominently to the apicoplast when this one was still present (Fig. 8A). The organelle often appeared swollen or was even found to be expelled in the parasitophorous vacuole. In addition, quantifications of the GFP-TgATG8 localization showed that, as with native TgATG8, a significant proportion of TgATG4depleted parasites displayed a vesicular GFP-TgATG8 signal (Fig. S8B). It should be noted that these experiments were performed on parasites that had one day less of ATc incubation compared with the experimental conditions corresponding to the results displayed on Figure 6. This was done for the purpose of having enough viable parasites prior to transfection. Consequently, more parasites had retained the apicoplast at this stage (Fig. S8B), which possibly allowed us to visualize an accumulation of TgATG8 at this organelle, and the progressive elimination of the organelle in the residual body. In any case, the marked GFPTgATG8 apicoplast and vesicular signals in TgATG4-depleted parasites suggested that important proportions of TgATG8 associates with membranes and are thus potentially lipidated in basal conditions. To assess this, western blot analyses were also performed on cell extracts obtained from extracellular parasites transiently expressing GFP-TgATG8, that were exposed to amino acid-deprived or nondeprived, control conditions (Fig. 8B). Strikingly, even before the induction of autophagy by amino acid starvation, the GFP-TgATG8-PE form was present amounts that were significantly higher than the control, consistent with the signals we observed by IFA. In conclusion, in the absence of TgATG4, TgATG8 accumulates as a lipidated form that appears to be localized to a membrane of the apicoplast or on vesicular structures. Discussion Autophagy is still not well characterized in parasitic protists and is particularly poorly described at the molecular level in apicomplexan parasites. These divergent eukaryotes possess a reduced set of autophagy proteins, as predicted by homology searches in genomic databases.12,22 This either suggests a more limited range of regulation for the autophagic function in these parasites, or the presence of parasite-specific proteins to perform similar tasks. We know that in Toxoplasma, autophagosomes can be induced by amino acid starvation in a regulated manner, although prolonged stimulation of this pathway might also be involved in cell

death. This has led to the establishment of speculative models as to which roles autophagy might play in these parasites, which is complicated by the fact that they have complex life cycles, with several developmental forms where autophagy may have different functions.12,13 Functional studies are thus needed to better characterize this machinery in the parasites and we have previously generated the first conditional mutant for a Toxoplasma ATG protein, TgATG3, which is involved in the conjugation of TgATG8.11 The data we have obtained, expanded with the current study, show that TgATG3 and TgATG4 (whose functions are linked to TgATG8) and, apparently, TgATG8 itself, are important for parasite growth. TgATG3 and TgATG4 conditional mutants have converging phenotypes: they are both altered in the regulation of TgATG8 lipidation, and both display significant damage on specific organelles. The machinery regulating TgATG8 membrane association is important for growth of T. gondii tachyzoites. When depleted of TgATG3 or of TgATG4, T. gondii tachyzoites show a significant alteration of the mitochondrial network and of the apicoplast. These two organelles are rather peculiar in apicomplexan parasites. First, T. gondii tachyzoites typically have a single mitochondrion, which forms a reticulated network extending through most of the parasite. As for the apicoplast, it is a plastid of secondary endosymbiotic origin, meaning that one eukaryotic ancestor of apicomplexan parasites has engulfed and retained another eukaryote containing a plastid obtained by primary endosymbiosis of a prokaryote. It is involved in several important metabolic pathways such as the biosynthesis of fatty acids, of isoprenoids, of iron–sulfur clusters and of haem. The apicoplast and the mitochondrial network are in close proximity within the parasites and they seem to be metabolically interdependent.23 It is thus difficult to decipher a phenotype that affects both the mitochondrion and the apicoplast, as disturbing one of these organelles might also have some significant effects on the other. The phenotypes we observed with our TgATG mutants could mean that autophagy, through the action of TgATG8, is directly involved in maintaining the basal homeostasis of these organelles during cell division, or for recycling damaged organelles. However, it is also possible that this effect is indirect. In fact, the origin of the autophagosomal membrane appears to be multiple and is still a matter of debate for other eukaryotes.24 After depletion of TgATG3 or TgATG4, we observe by electron microscopy an accumulation of membranous structures, usually at the apical part of the parasites and in the vicinity of the mitochondrial network. Thus, it is also possible that in Toxoplasma tachyzoites the mitochondrion and the apicoplast can act as a source of membranes for building autophagosomes, and that interfering with autophagosome biogenesis leads to an accumulation of membranes that would indirectly perturb the homeostasis of these organelles. TgATG8 and the apicoplast. The apicoplast localization of TgATG8 is particularly intriguing. However, recently published data have shown that in intracellular T. gondii tachyzoites treated with the ionophore monensin, GFP-TgATG8 also localizes to the apicoplast.16 It is yet unclear whether this is part of a specific response to a stress resulting from the ionophore treatment, or if that

1344 Autophagy

Volume 9 Issue 9

would be rather due to monensin (a known inhibitor of lysosomal function in mammalian cells) affecting the lysosomal turnover of GFP-TgATG8. Moreover, in the related apicomplexan parasite P. falciparum, it has been recently reported that PfATG8 localizes to the apicoplast during normal intra-erythrocytic development of the parasites, probably as a membrane-bound form, which would thus require the PE-conjugating machinery.17 We also found that the association of TgATG8 to the autophagosome is probably largely dependent on its lipidation. Consistent with this, lipidomic analysis of apicoplast-enriched fractions of Plasmodium reveals that membranes of this organelle seem to contain relatively high amounts of PE (Botté C, McFadden G, personal communication). Another interesting feature is that the outermost membrane of the apicoplast is thought to derive from the host endomembrane system and segregation of the lipid phosphatidylinositol 3-phosphate severely affects the integrity of this organelle.25 This lipid is a key regulator of autophagy in yeast and mammalian cells, especially for the nucleation of autophagosomal membranes.26 The fact that interfering with TgATG8-regulating proteins induces an effect on the apicoplast also reinforces the link between this protein and the organelle. The question now is whether autophagy is necessary for maintaining the homeostasis of the apicoplast, or if this organelle is important for the autophagic function. On the one hand, in plants, ATG4-dependent autophagy has been shown to be important for chloroplast degradation during senescence.27 On the other hand, as stated above, it might be that the apicoplast can act as a source of membranes to generate autophagosomes. To investigate this, we tried to disturb apicoplast biogenesis using clindamycin, an inhibitor of prokaryotic translation that specifically affects this organelle in Toxoplasma,28,29 in order to see whether that would be affecting the regulation of TgATG8 lipidation. A 5-d clindamycin treatment led to a loss of apicoplast markers, but did not abolish the presence of the TgATG8-PE form, suggesting that it can bind to other membranes in the parasite (data not shown). It nevertheless appears that long-term treatment with clindamycin affects the ability of TgATG8 to be lipidated following starvation, but in these conditions, growth of the parasites is already significantly affected and one could wonder whether these parasites are viable enough to draw any significant conclusion. A TgATG8 function unrelated to autophagy? Microscopic observation has shown that autophagosomes induced by starvation, or occasional autophagosomes found in intracellular parasites, are clearly distinct from the apicoplast, both by their location and the intensity of their fluorescent signal. Besides, TgATG8 does not appear to be systematically localized to the apicoplast in intracellular parasites, but rather in dividing parasites or, more precisely, in parasites where the apicoplast itself is dividing. It is thus possible that TgATG8 has a dual function in Toxoplasma. One is in the establishment of a canonical, starvation-induced autophagy, like we have previously described in these parasites.11 The other could be related to the biogenesis of the apicoplast. There are recent evidences that Atg8 (or LC3, a well-described mammalian ortholog) can be involved in noncanonical autophagy-related structures.30 LC3/ Atg8 is important for the membrane expansion step during

autophagosome formation.31 Moreover, it has been shown in vitro that Atg8 can tether liposomes and is thus a membrane fusogen.5 It thus seems reasonable to hypothesize that TgATG8 might have a specific function in the biogenesis of a four-membrane organelle such as the apicoplast that would be independent of its function in autophagy. Regarding this, it is interesting to note that both TgATG3- and TgATG4-depleted parasites accumulate multimembrane structures. Particularly, we have shown that in the TgATG4 mutant, TgATG8 is mostly present in the lipidated form and localizes to unidentified vesicular structures by IFA. In yeast, interfering with Atg8 deconjugation results in the mislocalization of Atg8 to the membrane of subcellular compartments other than autophagosomes, such as the ER, endosomes or the vacuole (yeast lysosomal compartment).32-34 Depletion of TgATG4 leads to an increase in membraneassociated TgATG8, which potentially accumulates at the apicoplast prior to the loss of this organelle, or can be also found at vesicular structures that are devoid of apicoplast markers and could represent abnormal autophagic vesicles. It would be tempting to speculate that the multimembrane structures we observed by electron microscopy in TgATG4-depleted parasites are TgATG8-enriched, but we have not been able to demonstrate this by immuno-electron microscopy. TgATG4-regulated membrane association of TgATG8. In mammals, it has been shown that Atg4 is essential for the biogenesis of autophagosomes, more particularly the membrane closure step.35 In Toxoplasma, because of the peculiar C-terminal glycine constitutively expressed at the C terminus of TgATG8, TgATG4 function is supposedly not directly involved in regulating TgATG8 association to the autophagosomal membrane. However, it is interesting to note that we have obtained a similar phenotype with a mutant for a protein (TgATG3) involved in the lipidation of TgATG8 for its conjugation to the nascent autophagosome, and with a mutant for a protein (TgATG4) whose function is potentially for the recycling of TgATG8 of this membrane. This suggests that the delipidation step of TgATG8 is equally important for an efficient function, as suggested for its role in forming autophagosomes in yeast.32,33 TgATG4 is a very unusual enzyme with very large sequence insertions compared with most eukaryotic orthologs. As a consequence, we cannot use the structure information of the Atg4B–LC3 complex,36 for example, to predict how it is interacting with TgATG8. Yet, we have shown unambiguously that it was able to recognize and cleave the C-terminal end of TgATG8 and we have demonstrated that a mutation in the P2 site of this substrate prevents cleavage. A now widespread strategy for developing cysteine peptidase inhibitors is to add ketones, aldehydes, or other “warheads” to short peptide sequences derived from their native substrate.37 As the function of TgATG4 appears to be crucial for the development of the parasites, such a strategy could be at the basis of a future drug design approach to fight these pathogens. Materials and Methods Ethics statement. The immunization protocol for antibody production in rabbits was conducted at the CRBM animal house


(Montpellier) and approved by the Committee on the Ethics of Animal Experiments (Languedoc-Roussillon, Montpellier; permit number: D34-172-4, delivered on 20/09/2009). These experiments were conducted according to European Union guidelines for the handling of laboratory animals. Host cells and parasite culture. Tachyzoites of the RH and Ku80Δ T. gondii strains,15 as well as derived transgenic parasites generated in this study, were routinely propagated in vitro under standard procedures by serial passage in human foreskin fibroblast (HFF) monolayers in Dulbecco’s modified Eagle medium (DMEM, Invitrogen, 21969-035) supplemented with 10% fetal bovine serum. cDNA sequencing. TgATG4 cDNA sequence from the RH strain was obtained thanks to a conventional primer walking strategy, based on the scaffold that was available on the ToxoDB genomic database (www.toxodb.org).38 Fragments were obtained by RT-PCR using the Superscript III first-strand synthesis kit (Invitrogen, 18080-051) and subcloned in the TOPO vector (Invitrogen, K2800-20) for sequencing. Mapping of the 5´ of the cDNA was done using the SmartRace cDNA amplification kit (Clontech, 634923). The assembled TgATG4 cDNA sequence was deposited in GenBank with accession number KC175547. Construct for inactivating TgATG8 by a knock-in strategy. A 1,036 bp fragment corresponding to the 5´ of the TgATG8 gene (starting within an intron, 99 bp after the start codon), was amplified by PCR from genomic DNA with primers ML1063/ML1064 (all primers used for molecular clonings and PCR verifications are listed in Table S1) and cloned into the pTUB8MycGFPPfMyoAtail3Ty-HX vector.14 The resulting p5´TgATG8-3Ty plasmid was linearized with BsiWI and 60 µg were transfected in the Ku80Δ T. gondii cell line.15 Correct integration of the plasmid has been verified by PCR using a sequential seminested approach. A first PCR using primers ML1113/ML673 was used and 1/50th of the product was used as a template for a second round of PCR amplification using primers ML1504/ ML673. A similar approach was used to amplify the genomic locus, using primers ML1113/ML1114 for the first round of PCR and ML1504/ML673 for the second. Generation of TgATG4-deficient mutant and complemented cell lines. A 1,076 bp fragment corresponding to the promoter region of TgATG4 (upstream of the codon corresponding to the first predicted in-frame methionine residue) and a 1,001 bp fragment corresponding to the 5´ of the coding region (downstream of the codon corresponding to the first predicted in-frame methionine residue) were amplified by PCR from T. gondii genomic DNA using primers ML704/ML705 and ML706/ML707, respectively. The promoter region was cloned in the pTUB8TATi-1-HX-TetO7-SAG1 plasmid (Daher W, Soldati-Favre D, unpublished), upstream of a cassette containing TATi-1(trans-activator trap identified 1), HxGPRT selection marker (hypoxanthine guanine phosphoribosyl transferase), tetO7 tetracyclin operator and pSAG1 minimal promoter. The fragment corresponding to the 5´ of TgATG4 was then cloned downstream of this cassette, to yield the final construct containing the two TgATG4 regions flanking both the selection marker cassette and the ATc-regulated promoter cassette. This construct

was linearized by Stu I/BssH II prior to transfection. Transfected parasites were selected with mycophenolic acid and xanthine and cloned by limit dilution. Positive clones were verified by PCR using primers ML555/ML753 to detect the native locus, ML749/ ML750 for 5´ integration and ML751/ML752 for 3´ integration. Four clones were checked and were all found to be displaying growth phenotype in plaques assay in the presence of ATc. One (clone I9) was chosen for subsequent phenotypic analyses. For depletion of TgATG4, parasites were usually grown intracellularly in the presence of 1 µg/ml ATc for up to four days and used to invade new host fibroblasts for 24 h, still in the presence of ATc, before being processed for analysis. To obtain a complemented cell line, we used the ToxoDB genomic database to look for a cosmid clone from the ToxoSuperCos library39 that would be overlapping the TgAtg4 locus and we found clone ToxPG30. Clone I9 tachyzoites were transfected with 100 µg of the ToxPG30 cosmid. The cosmid contains the dihydrofolate reductase gene, which allowed selection of positive clones with pyrimethamine. Clones were obtained by limiting dilution and verified for the presence of the wild-type locus by PCR using primers ML555/ML753. Two clones were chosen and both were found to complement the growth phenotype on plaques assay. One (clone I9I3) was chosen for subsequent analyses. Generation of GFP-TgATG8-C and GFP-TgATG8-HAexpressing T. gondii cell lines. Plasmid pGFP-TgATG811 was modified using site directed mutagenesis to either insert a sequence coding for an additional cysteine or a HA tag. The QuikChange site-directed mutagenesis kit (Agilent, 200515) was used with primers ML310/ML311 and ML932/ML933, respectively, to insert the corresponding sequences. Site-directed mutagenesis was also subsequently used with primers ML1019/ ML1020 on the pGFP-TgATG8-HA plasmid to modify the sequence corresponding to the ‘P2’ recognition site amino acid (leucine replaced by a proline). Generation of a TgATG4-Ty cell line. A 1,665 bp fragment corresponding to the 3´ of TgATG4 was amplified from genomic DNA using primers ML1233/ML1234 and cloned into pTUB8MycGFPPfMyoAtail3Ty-HX vector14 to yield the p3´-TgATG4-3Ty plasmid. 60 µg of this plasmid were digested by SphI prior to transfection. Correct integration in transgenic parasites was checked by PCR using primers ML673/ML1082. Semiquantitative RT-PCR. Total RNA was extracted from T. gondii tachyzoites using the Nucleospin RNA II kit (MachereyNagel, 740955.10). RT-PCR were performed with the Superscript III first-strand synthesis kit (Invitrogen, 18080-051). 800 ng of RNA as a template were used per RT-PCR reaction and specific primers of TgATG4 (ML845/ML846) or TUB2/Tubulin β chain (ML841/ML842) were used. Twenty-four cycles of PCR were performed. Induction, modulation and monitoring of autophagy. These analyses were performed as described previously.11 To induce autophagy, extracellular tachyzoites were put in starvation conditions. Extracellular parasites were obtained from freshly lysed HFFs, sedimented by centrifugation and washed twice in Hank’s Balanced Salt Solution (HBSS, Invitrogen, 14170-088)

1346 Autophagy

Volume 9 Issue 9

before being resuspended in prewarmed HBSS and incubated at 37°C for up to 8 h. Autophagosomes were quantified in live or paraformaldehyde-fixed GFP-TgATG8 expressing parasites, by microscopic observation and counting of the punctate GFP signals. At least 200 cells were counted in each experimental set. Western blot analysis. Alternatively, the presence of the lipidated, membrane-associated, form of GFP-TgATG8 or TgATG8 was assessed by western blotting with anti-GFP antibody after separation by 6M urea SDS-PAGE. Parasite extracts were normalized on counts of viable parasites (by trypan blue assay) at the end of the incubation time in starvation medium. For detection of TgATG4, NuPAGE Novex 3–8% acrylamide gradient Tris-Acetate gels (Invitrogen, EA0375BOX) were used for protein separation prior to detection. The primary antibodies used for detection and their respective dilutions were: mouse monoclonal anti-GFP antibody (Roche, 11 814 460 001) at 1/500, rat monoclonal anti-HA antibody (Roche, 11 867 423 001) at 1/300, rabbit polyclonal anti-TgATG811 at 1/1,000, rabbit polyclonal anti-TgATG4 at 1/500, mouse monoclonal anti-Ty epitope tag40 at 1/200, mouse monoclonal anti-SAG141 at 1/2,000 and mouse monoclonal anti-ROP542 at 1/1,000. Fluorescent staining of cells. IFAs were performed either on intracellular parasites at their various stages of development. They were fixed in 4% (w/v) paraformaldehyde in PBS and processed for immunofluorescent labeling as described previously.43 The following antibodies were used at 1/1,000 dilution unless mentioned: anti-mitochondrial F1 β ATPase (Bradley P, unpublished), anti-ATrx1 apicoplast-associated thioredoxin,44 anti-TgATG4, anti-TgATG8, anti-MIC3,45 anti-ROP5,42 antiIMC1,46 anti-GRA2,47 anti-Ty epitope tag40 at 1/200, anti-c-myc epitope tag at 1/250 (Santa Cruz, sc-40). Electron microscopy. Infected cell monolayers on coverslips were fixed for 2 h with 2.5% glutaraldehyde in 0.1 M Na References 1.

2.

3.

4.

5.

6.

Yang Z, Klionsky DJ. An overview of the molecular mechanism of autophagy. Curr Top Microbiol Immunol 2009; 335:1-32; PMID:19802558; http:// dx.doi.org/10.1007/978-3-642-00302-8_1 Rubinsztein DC, Codogno P, Levine B. Autophagy modulation as a potential therapeutic target for diverse diseases. Nat Rev Drug Discov 2012; 11:70930; PMID:22935804; http://dx.doi.org/10.1038/ nrd3802 Mizushima N, Yoshimori T, Ohsumi Y. The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol 2011; 27:107-32; PMID:21801009; http:// dx.doi.org/10.1146/annurev-cellbio-092910-154005 Shpilka T, Weidberg H, Pietrokovski S, Elazar Z. Atg8: an autophagy-related ubiquitin-like protein family. Genome Biol 2011; 12:226; PMID:21867568; http://dx.doi.org/10.1186/gb-2011-12-7-226 Nakatogawa H, Ichimura Y, Ohsumi Y. Atg8, a ubiquitin-like protein required for autophagosome formation, mediates membrane tethering and hemifusion. Cell 2007; 130:16578; PMID:17632063; http://dx.doi.org/10.1016/j. cell.2007.05.021 Xie Z, Nair U, Klionsky DJ. Atg8 controls phagophore expansion during autophagosome formation. Mol Biol Cell 2008; 19:3290-8; PMID:18508918; http:// dx.doi.org/10.1091/mbc.E07-12-1292

7.

8.

9.

10.

11.

12.

13.

cacodylate buffer pH 7.2, washed in buffer, post fixed in 1% OsO4 in the same buffer for 2 h. After dehydration with graded ethanol series, they were embedded in Epon. Ultrathin sections were prepared with a Leica ultracut E microtome (Leica SAS), stained with uranyl acetate and lead citrate and observed with a JEOL 1200E electron microscope (JEOL SAS). Plaque assays. Confluent monolayers of HFF grown in 6-well plates were infected with ~50 tachyzoites per well and incubated for 6 to 7 d at 37°C. They were then fixed in cold methanol for 20 min and stained with Giemsa stain. Images were obtained with an Olympus MVX10 macro zoom microscope equipped with an Olympus XC50 camera (Olympus SA). Plaque area measurements were performed with cellSens software (Olympus). Statistical analyses. Values were expressed as means ± standard error of the mean (SEM). When necessary, data were analyzed for comparison using Student’s t-test with equal variance (homoscedastic). A p value of < 0.05 was used as the level of significance. Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed. Acknowledgments

We are grateful to D. Soldati-Favre, P. Bradley, C. Brooks, B. Striepen, C. Beckers for providing plasmids and antibodies. Thanks to C. Botté and G. MacFadden for sharing data prior to publication. Thanks to the Montpellier Rio Imaging platform for access to their facility. This work was supported by a grant from the Fondation pour la Recherche Médicale and by the Labex Parafrap (ANR-11-LABX-0024). M.L., W.D. and S.B. are Inserm researchers. Supplemental Materials

Supplemental materials may be found here: www.landesbioscience.com/journals/autophagy/article/25189

Weidberg H, Shvets E, Elazar Z. Biogenesis and cargo selectivity of autophagosomes. Annu Rev Biochem 2011; 80:125-56; PMID:21548784; http://dx.doi. org/10.1146/annurev-biochem-052709-094552 Geng J, Klionsky DJ. The Atg8 and Atg12 ubiquitinlike conjugation systems in macroautophagy. ‘Protein modifications: beyond the usual suspects’ review series. EMBO Rep 2008; 9:859-64; PMID:18704115; http://dx.doi.org/10.1038/embor.2008.163 Montoya JG, Liesenfeld O. Toxoplasmosis. Lancet 2004; 363:1965-76; PMID:15194258; http://dx.doi. org/10.1016/S0140-6736(04)16412-X Striepen B. The apicoplast: a red alga in human parasites. Essays Biochem 2011; 51:111-25; PMID:22023445 Besteiro S, Brooks CF, Striepen B, Dubremetz J-F. Autophagy protein Atg3 is essential for maintaining mitochondrial integrity and for normal intracellular development of Toxoplasma gondii tachyzoites. PLoS Pathog 2011; 7:e1002416; PMID:22144900; http:// dx.doi.org/10.1371/journal.ppat.1002416 Besteiro S. Which roles for autophagy in Toxoplasma gondii and related apicomplexan parasites? Mol Biochem Parasitol 2012; 184:1-8; PMID:22515957; http://dx.doi.org/10.1016/j.molbiopara.2012.04.001 Sinai AP, Roepe PD. Autophagy in Apicomplexa: a life sustaining death mechanism? Trends Parasitol 2012; 28:358-64; PMID:22819059; http://dx.doi. org/10.1016/j.pt.2012.06.006

14. Daher W, Klages N, Carlier MF, Soldati-Favre D. Molecular characterization of Toxoplasma gondii formin 3, an actin nucleator dispensable for tachyzoite growth and motility. Eukaryot Cell 2012; 11:34352; PMID:22210829; http://dx.doi.org/10.1128/ EC.05192-11 15. Huynh MH, Carruthers VB. Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryot Cell 2009; 8:530-9; PMID:19218426; http://dx.doi.org/10.1128/EC.00358-08 16. Lavine MD, Arrizabalaga G. Analysis of monensin sensitivity in Toxoplasma gondii reveals autophagy as a mechanism for drug induced death. PLoS One 2012; 7:e42107; PMID:22848721; http://dx.doi. org/10.1371/journal.pone.0042107 17. Kitamura K, Kishi-Itakura C, Tsuboi T, Sato S, Kita K, Ohta N, et al. Autophagy-related Atg8 localizes to the apicoplast of the human malaria parasite Plasmodium falciparum. PLoS One 2012; 7:e42977; PMID:22900071; http://dx.doi.org/10.1371/ journal.pone.0042977 18. Eickel N, Kaiser G, Prado M, Burda P-C, Roelli M, Stanway RR, et al. Features of autophagic cell death in Plasmodium liver-stage parasites. Autophagy 2013; 9:568-80; PMID:23388496; http://dx.doi. org/10.4161/auto.23689


19. Kim J, Huang WP, Klionsky DJ. Membrane recruitment of Aut7p in the autophagy and cytoplasm to vacuole targeting pathways requires Aut1p, Aut2p, and the autophagy conjugation complex. J Cell Biol 2001; 152:51-64; PMID:11149920; http://dx.doi. org/10.1083/jcb.152.1.51 20. Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, et al. The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol 2000; 151:263-76; PMID:11038174; http://dx.doi. org/10.1083/jcb.151.2.263 21. Brooks CF, Johnsen H, van Dooren GG, Muthalagi M, Lin SS, Bohne W, et al. The Toxoplasma apicoplast phosphate translocator links cytosolic and apicoplast metabolism and is essential for parasite survival. Cell Host Microbe 2010; 7:62-73; PMID:20036630; http://dx.doi.org/10.1016/j.chom.2009.12.002 22. Duszenko M, Ginger ML, Brennand A, GualdrónLópez M, Colombo MI, Coombs GH, et al. Autophagy in protists. Autophagy 2011; 7:12758; PMID:20962583; http://dx.doi.org/10.4161/ auto.7.2.13310 23. Lim L, McFadden GI. The evolution, metabolism and functions of the apicoplast. Philos Trans R Soc Lond B Biol Sci 2010; 365:749-63; PMID:20124342; http://dx.doi.org/10.1098/rstb.2009.0273 24. Mari M, Tooze SA, Reggiori F. The puzzling origin of the autophagosomal membrane. F1000 Biol Rep 2011; 3:25; PMID:22162728; http://dx.doi. org/10.3410/B3-25 25. Tawk L, Dubremetz JF, Montcourrier P, Chicanne G, Merezegue F, Richard V, et al. Phosphatidylinositol 3-monophosphate is involved in Toxoplasma apicoplast biogenesis. PLoS Pathog 2011; 7:e1001286; PMID:21379336; http://dx.doi.org/10.1371/journal. ppat.1001286 26. Noda T, Matsunaga K, Taguchi-Atarashi N, Yoshimori T. Regulation of membrane biogenesis in autophagy via PI3P dynamics. Semin Cell Dev Biol 2010; 21:671-6; PMID:20403452; http://dx.doi. org/10.1016/j.semcdb.2010.04.002 27. Wada S, Ishida H, Izumi M, Yoshimoto K, Ohsumi Y, Mae T, et al. Autophagy plays a role in chloroplast degradation during senescence in individually darkened leaves. Plant Physiol 2009; 149:88593; PMID:19074627; http://dx.doi.org/10.1104/ pp.108.130013 28. Camps M, Arrizabalaga G, Boothroyd J. An rRNA mutation identifies the apicoplast as the target for clindamycin in Toxoplasma gondii. Mol Microbiol 2002; 43:1309-18; PMID:11918815; http://dx.doi. org/10.1046/j.1365-2958.2002.02825.x

29. Fichera ME, Bhopale MK, Roos DS. In vitro assays elucidate peculiar kinetics of clindamycin action against Toxoplasma gondii. Antimicrob Agents Chemother 1995; 39:1530-7; PMID:7492099; http://dx.doi.org/10.1128/AAC.39.7.1530 30. Codogno P, Mehrpour M, Proikas-Cezanne T. Canonical and non-canonical autophagy: variations on a common theme of self-eating? Nat Rev Mol Cell Biol 2012; 13:7-12; PMID:22166994 31. Weidberg H, Shvets E, Shpilka T, Shimron F, Shinder V, Elazar Z. LC3 and GATE-16/GABARAP subfamilies are both essential yet act differently in autophagosome biogenesis. EMBO J 2010; 29:1792802; PMID:20418806; http://dx.doi.org/10.1038/ emboj.2010.74 32. Yu ZQ, Ni T, Hong B, Wang HY, Jiang FJ, Zou S, et al. Dual roles of Atg8-PE deconjugation by Atg4 in autophagy. Autophagy 2012; 8:883-92; PMID:22652539; http://dx.doi.org/10.4161/ auto.19652 33. Nair U, Yen WL, Mari M, Cao Y, Xie Z, Baba M, et al. A role for Atg8-PE deconjugation in autophagosome biogenesis. Autophagy 2012; 8:78093; PMID:22622160; http://dx.doi.org/10.4161/ auto.19385 34. Nakatogawa H, Ishii J, Asai E, Ohsumi Y. Atg4 recycles inappropriately lipidated Atg8 to promote autophagosome biogenesis. Autophagy 2012; 8:17786; PMID:22240591; http://dx.doi.org/10.4161/ auto.8.2.18373 35. Fujita N, Hayashi-Nishino M, Fukumoto H, Omori H, Yamamoto A, Noda T, et al. An Atg4B mutant hampers the lipidation of LC3 paralogues and causes defects in autophagosome closure. Mol Biol Cell 2008; 19:4651-9; PMID:18768752; http://dx.doi. org/10.1091/mbc.E08-03-0312 36. Satoo K, Noda NN, Kumeta H, Fujioka Y, Mizushima N, Ohsumi Y, et al. The structure of Atg4B-LC3 complex reveals the mechanism of LC3 processing and delipidation during autophagy. EMBO J 2009; 28:1341-50; PMID:19322194; http://dx.doi. org/10.1038/emboj.2009.80 37. Leung-Toung R, Zhao Y, Li W, Tam TF, Karimian K, Spino M. Thiol proteases: inhibitors and potential therapeutic targets. Curr Med Chem 2006; 13:547-81; PMID:16515521; http://dx.doi. org/10.2174/092986706776055733 38. Gajria B, Bahl A, Brestelli J, Dommer J, Fischer S, Gao X, et al. ToxoDB: an integrated Toxoplasma gondii database resource. Nucleic Acids Res 2008; 36(Database issue):D553-6; PMID:18003657; http://dx.doi.org/10.1093/nar/gkm981

1348 Autophagy

39. Gubbels MJ, Lehmann M, Muthalagi M, Jerome ME, Brooks CF, Szatanek T, et al. Forward genetic analysis of the apicomplexan cell division cycle in Toxoplasma gondii. PLoS Pathog 2008; 4:e36; PMID:18282098; http://dx.doi.org/10.1371/journal.ppat.0040036 40. Bastin P, Bagherzadeh Z, Matthews KR, Gull K. A novel epitope tag system to study protein targeting and organelle biogenesis in Trypanosoma brucei. Mol Biochem Parasitol 1996; 77:235-9; PMID:8813669; http://dx.doi.org/10.1016/0166-6851(96)02598-4 41. Couvreur G, Sadak A, Fortier B, Dubremetz JF. Surface antigens of Toxoplasma gondii. Parasitology 1988; 97:1-10; PMID:3174230; http://dx.doi. org/10.1017/S0031182000066695 42. Leriche MA, Dubremetz JF. Characterization of the protein contents of rhoptries and dense granules of Toxoplasma gondii tachyzoites by subcellular fractionation and monoclonal antibodies. Mol Biochem Parasitol 1991; 45:249-59; PMID:2038358; http://dx.doi.org/10.1016/0166-6851(91)90092-K 43. Besteiro S, Bertrand-Michel J, Lebrun M, Vial H, Dubremetz JF. Lipidomic analysis of Toxoplasma gondii tachyzoites rhoptries: further insights into the role of cholesterol. Biochem J 2008; 415:8796; PMID:18564055; http://dx.doi.org/10.1042/ BJ20080795 44. DeRocher AE, Coppens I, Karnataki A, Gilbert LA, Rome ME, Feagin JE, et al. A thioredoxin family protein of the apicoplast periphery identifies abundant candidate transport vesicles in Toxoplasma gondii. Eukaryot Cell 2008; 7:1518-29; PMID:18586952; http://dx.doi.org/10.1128/EC.00081-08 45. Garcia-Réguet N, Lebrun M, Fourmaux MN, Mercereau-Puijalon O, Mann T, Beckers CJ, et al. The microneme protein MIC3 of Toxoplasma gondii is a secretory adhesin that binds to both the surface of the host cells and the surface of the parasite. Cell Microbiol 2000; 2:353-64; PMID:11207591; http:// dx.doi.org/10.1046/j.1462-5822.2000.00064.x 46. Mann T, Beckers C. Characterization of the subpellicular network, a filamentous membrane skeletal component in the parasite Toxoplasma gondii. Mol Biochem Parasitol 2001; 115:25768; PMID:11420112; http://dx.doi.org/10.1016/ S0166-6851(01)00289-4 47. Achbarou A, Mercereau-Puijalon O, Sadak A, Fortier B, Leriche MA, Camus D, et al. Differential targeting of dense granule proteins in the parasitophorous vacuole of Toxoplasma gondii. Parasitology 1991; 103:321-9; PMID:1780169; http://dx.doi. org/10.1017/S0031182000059837

Volume 9 Issue 9

Landes Bioscience

www.landesbioscience.com

Supplemental Material to: Marie A. Kong-Hap, Annabelle Mouammine, Wassim Daher, Laurence Berry, Maryse Lebrun, Jean-François Dubremetz and Sébastien Besteiro Regulation of ATG8 membrane association by ATG4 in the parasitic protist Toxoplasma gondii Autophagy 2013; 9(9) http://dx.doi.org/10.4161/auto.25189 www.landesbioscience.com/journals/autophagy/article/25189

Figure S1. TgATG8 is important for efficient growth of T. gondii tachyzoites. (A) Schematic representation of the knock-in strategy for disrupting the TgATG8 gene. ATG marks the start codon. Arrows represent primers used for PCR detections presented in (B) and expected sizes of the fragments shown in italics. (B) Verification of the population of transfected parasites by nested PCR. Genomic DNA from parasites transfected with the construct for TgATG8 disruption was extracted at various times post-transfection and submitted to a first round of PCR with the following couple of primers: ML1113/ML1114 and ML1113/ML673 for the endogenous and recombined loci, respectively. A second round of amplification was performed using primers ML1063/ML1064 and ML1504/ML673 to detect the endogenous and recombined loci, respectively. Ku80Δ is the parental cell line control. Main PCR products have been subcloned and sequenced to verify their identity.

A 1,036 bp

1,246 bp

B

ML1063-ML1064

endogenous

ML1504-ML673

recombined

Days after transfection: bp 2,000 1,500 1,000 800

Figure S2. An endogenous peptidase cleaves an extra amino acid at the C terminus of TgATG8. (A) Fluorescence microscopy analysis of extracellular tachyzoites expressing GFP-TgATG8, its glycine mutant version (GFP-TgATG8G124A), or a version with an extra cysteine (GFPTgATG8X125C). Proportion of parasites bearing GFP-TgATG8-labeled autophagosomes (arrowhead) was quantified after induction of autophagy for up to 8 h in HBSS. Data are mean from n = 3 independent experiments ±SEM. (B) Protein extracts corresponding to tachyzoites expressing GFP-TgATG8 and glycine mutant version incubated in or not in HBSS for 8 h, were separated by urea SDS-PAGE and analyzed with an anti-GFP antibody to detect GFP-TgATG8 and lipidated GFP-TgATG8–PE forms. Anti-ROP5 was used as a loading control.

Figure S3. Alignment of amino acid sequences from yeast Atg4 (A6ZRL7.1), human ATG4B (Q9Y4P1.2) and T. gondii TgATG4 using the MUSCLE algorithm. Amino acids of the catalytic triad (C, H, D) are labeled in yellow. Peptides identified in mass spectrometry analyses are underlined with arrow bars.

Figure S4. Local conservation of the amino acid sequence in the yeast, human and Toxoplasma ATG4 orthologs. Seven boxes chosen along the ATG4 alignment highlight local amino acid conservation. The green arrows in boxes 2 and 6 indicate the amino acids of the catalytic triad.

Figure S5. Depletion of TgATG4 does not modify several of the subcellular organelles in tachyzoites. TgATG4 mutant and cosmid-complemented parasites preincubated for 4 days with ATc and made to invade new host fibroblasts for 24 h before being fixed and processed for IFA using (A) an anti-IMC1 and GRA2 antibodies to assess for the inner membrane complex and dense granules secretion and (B) anti-MIC3 and ROP5 antibodies to assess for secretory organelles rhoptries and micronemes. DNA was labeled with DAPI. Scale bar = 5 µm.

DIC

DAPI

IMC1

GRA2

Merge

cKD TgATG4 comp

cKD TgATG4

A

DIC

DAPI

IMC1

DAPI

GRA2

MIC3

Merge

ROP5

Merge

cKD TgATG4 comp

cKD TgATG4

B

DIC

DIC

DAPI

MIC3

ROP5

Merge

Figure S6. Depletion of TgATG3 affects the apicoplast. (A) Intracellular conditional TgATG3 mutants were incubated in the presence of ATc for 4 days before being fixed and processed for IFA. The apicoplast was detected with an anti-ATrx1 antibody and TgATG3 depletion was verified by detecting myc-tagged regulatable extra-copy with a specific antibody. DNA was labeled with DAPI. Scale bar = 5 µm. (B) Quantification of the percentage of parasites with missing apicoplast after incubation of TgATG3 mutant parasites with ATc or not. At least 200 parasites were counted per experiment. Data are mean from n = 3 independent experiments ±SEM.

Percentage of parasites with missing apicoplast

cKD TgATG3 +ATc

cKD TgATG3 no ATc

A

B 60%

50%

40%

30% +ATc

no ATc

20%

10%

0% iKDTgATG3 TgATG3 cKD

Figure S7. GFP-TgATG8-HA does not associate with autophagic vesicles in the absence of TgATG4. TgATG4 mutant and complemented extracellular tachyzoites transiently expressing GFP-TgATG8-HA and preincubated with ATc for 4 days, were starved for 8 h. Only the complemented cell line and the GFP-TgATG8-HA expressing RH control were found to display GFP-decorated autophagosomes (arrowheads). Shapes of the extracellular parasites are delineated by dashed lines.

1

Figure S8. TgATG8 accumulates to vesicular and apicoplast membrane structures in

2

TgATG4-depleted intracellular parasites. (A) Types of localization of GFP-TgATG8 in

3

TgATG4-depleted intracellular parasites. Costaining was performed with apicoplast marker

4

ATrx1. The parasitophorous vacuole membrane is delineated by the dashed line. (B)

5

quantification of the parasites displaying the types of signals described in (A). Analysis for

6

TgATG4 mutant and complemented cell lines transiently expressing GFP-TgATG8 that were

7

preincubated for 3 days with ATc and made to invade new host fibroblasts for 24 h before

8

being fixed and processed for IFA. GFP-TgATG8-expressing RH was used as control. Data

9

are mean from n = 3 independent experiments ±SEM, except for the complemented cell line

10

for which the experiment was performed only once.

1

GFP-TgATG8

Vesicles different from apicoplast

Merge

Apico

A

Cytosolic or faint apicoplast Strong apicoplast

B Percentage of GFP-TgATG8 signal

100%

80%

60%

40%

20%

0% cKD TgATG4 cKD TgATG4 GFP-TgATG8 comp GFP-TgATG8 GFP-TgATG8

Vesicles, no more apicoplast

Cytosolic, no more apicoplast

Table S1. List of primers used in this study.

Primer name ML310 ML311 ML555 ML673 ML704 ML705 ML706 ML707 ML749 ML750 ML751 ML752 ML753 ML841 ML842 ML845 ML846 ML932 ML933 ML1019 ML1020 ML1063 ML1064 ML1082 ML1113 ML1114 ML1233 ML1234 ML1504

Sequence CACTCTGGGGTGCTAATTAATTAATCACC GGTGATTAATTAATTAGCACCCCAGAGTG GCGGGTCGTCCTGAACGC ATCGAGCGGGTCCTGGTTCGTGTGGACCTC ATTCCATGGCCTGCAGGATTGGAACTTCGGGAATTGG CGGGATATCTCGATACCGACTTCATTGAGTAATTCCAGAGCAGAGTTGATGACTTTGCTCTTGTCCAGGCGCGACATGCGTGAAGAAGAGTGGGACGGACAGACAGG GGCAGATCTCTAGTGTCTAAATACCTGGC CGGACTAGTTTGTTGGACTGTAGGCACTC CAGGCAATCAGTCTCAGC GTAGGCTGCTCAACTCCC AGAGGAGCTATCTGGTGC TCATCTCCGAGGAGGACC CATCGATCGAGCGCCGCG ATGTTCCGTGGTCGCATGT TTCATGTTGTTGGGAATCCAC GAAGAGGTCGACTCGTTTTCC CCTTCCTCGACTTCCTCCAT GAGAACACTCTGGGGTACCCATACGATGTTCCAGATTACGCTTAAATTAATCACCGTTGTG CACAACGGTGATTAATTTAAGCGTAATCTGGAACATCGTATGGGTACCCCAGAGTGTTCTC TTCAGAGAACACTCCGGGGTACCCATACG CGTATGGGTACCCCGGAGTGTTCTCTGAA CCGGGTACCCGTCCCATTGACTCTCGC GGGATGCATGCCATGTGCATTATGTGC AAGGCGCTGCTGTATCTCG GATTCGCGACGAAGTG CCTGAGAGTGAAACGC TTAGGTACCTGCGCTTCAGCTCCCTGC TTTATGCATTCCGGTCTGTGCCGCTCTC ATTCAGTCTGCAAACGGGCG