Regulation of Corticotropin-Releasing Hormone Type 2 Receptors by ...

0888-8809/03/$15.00/0 Printed in U.S.A.

Molecular Endocrinology 17(3):395–410 Copyright © 2003 by The Endocrine Society doi: 10.1210/me.2002-0302

Regulation of Corticotropin-Releasing Hormone Type 2 Receptors by Multiple Promoters and Alternative Splicing: Identification of Multiple Splice Variants ROB D. CATALANO, THEODOSIOS KYRIAKOU, JING CHEN, ANDREW EASTON, EDWARD W. HILLHOUSE

AND

Department of Pathology (R.D.C.), University of Cambridge, Cambridge CB2 1QP, United Kingdom; Department of Biological Sciences (T.K., J.C., A.E.), University of Warwick, Coventry CV4 7AL, United Kingdom; and The Medical School (E.W.H.), University of Leeds, Leeds LS2 9NL, United Kingdom We demonstrate that multiple promoters and alternate splicing regulate expression of the human CRH receptor type 2 (CRHR2) gene. We show that flanking regions to the first exons drive promoter activity in both endogenously and nonendogenously expressing cell lines. Putative promoter elements have been identified that are conserved between species, including the comparison of CRHR2␥ in nonhuman primates that was previously known only in humans, which may be responsible for subtype tissue specific regulation. We have identified novel transcripts produced by alternate splicing of the first exon of CRHR2␤ (␤1a) with various combinations of the 5ⴕ exons including a novel exon (␤1c) spliced to the common exons. The 5ⴕ structure of the gene permits many other com-

binations of alternate splicing that may arise as part of a regulatory mechanism controlling functional receptor expression. The 5ⴕ-untranslated region of the first exons has been extended; and 3ⴕ acceptor sites identified within the 5ⴕ untranslated region of CRHR2␥ and CRHR2␣ are used during alternate splicing of CRHR2␤ upstream exons. This has important implications because various reports on the expression of CRHR2␥ and CRHR2␣ have been unable to discriminate between the functional receptor and CRHR2␤ alternate splice variants. Only the described sequences upstream of the 3ⴕ splice site are unique to CRHR2␥ and CRHR2␣. (Molecular Endocrinology 17: 395–410, 2003)

C

high affinity. The CRHR2 receptor binds urocortin with higher affinity than the other CRH-like peptides (10) and also binds the newly identified stresscopin and stresscopin-related peptides (11), suggesting that these peptides are the natural or preferred ligands. CRHR1 shares 70% homology with CRHR2 and both CRH receptors are present as structurally distinct isoforms. The CRHR1 gene expresses four known subtypes (1␣, 1␤, 1c, and 1d; Refs. 6, 12, and 13) produced by differential splicing of exons 3, 6, and 13. CRHR1 is abundantly expressed in the brain and pituitary (14) but also at low levels in the testis, ovary, and adrenals (15–17). The CRHR2 gene expresses three known subtypes (2␤, 2␥, and 2␣; Refs. 18–20) that are produced by the use of alternate 5⬘ exons. The CRHR2␣ and the CRHR2␤ are expressed in both the brain and periphery (21), although CRHR2␣ is mainly localized to the subcortical structures (21), whereas the CRHR2␥ appears to be predominantly in the brain (22). In addition, both the CRHR2␣ and CRHR2␤ subtypes are differentially expressed in heart, skeletal muscle, and myometrium (18, 23). Targeted disruption of CRH receptors in mice has provided insights into the importance of the different CRH receptors. These studies have implicated CRHR1

RH IS A 41-AMINO-ACID peptide (1) that plays a key role in the integration of the neuroendocrine, behavioral, autonomic, and immune responses to stress (2). The primary role of CRH is to activate the proopiomelanocortin gene and generate the release of ACTH and ␤-endorphin from the anterior pituitary (3). In addition, CRH has been shown to improve arousal and learning, cause anxiety, modulate food intake, disrupt sleep patterns, stimulate thermogenesis, alter blood pressure, and exert both antiinflamatory and proinflammatory effects (4, 5). This is coordinated by the expression of two receptors, CRH receptor type 1 (CRHR1) (6) and type 2 (CRHR2) (7) encoded by separate genes mapped to human chromosome 17 (8) and 7 (9), respectively. These receptors belong to the group II subfamily of G protein-coupled receptors (GPCRs), a distinct family of seven transmembrane spanning receptors, which includes among others, receptors for calcitonin, vasoactive intestinal peptide, and PTH. The CRHR1 binds CRH and CRH-related peptides (urocortin, urotensin, and sauvagine) with Abbreviations: CRHR1, CRH receptor type 1; CRHR2, CRH receptor type 2; GPCR, G protein-coupled receptor; GR, glucocorticoid receptor; RACE, rapid amplification of 5⬘-cDNA ends; UTR, untranslated region. 395

396 Mol Endocrinol, March 2003, 17(3):395–410

in mediating normal responses to stress (24), whereas CRHR2 appears to play important roles in fine tuning stress responses (25). Furthermore, CRHR1 mediates anxiogenic actions that are opposed by the anxiolytic properties of CRHR2 (26). In addition, CRHR2 mediates the haemodynamic effects of urocortin (27). The different distribution and pharmacology of the receptor subtypes suggests that they sub-serve different physiological roles. The understanding of the mechanisms involved in CRHR2 expression at transcriptional and translational levels and the physiological role of the CRHR2 gene would be facilitated greatly by elucidation of the structure and processing of its gene. Our studies present the characterization of the structure and function of the 5⬘ region of the human CRHR2 gene and describe mechanisms regulating receptor subtype expression.

RESULTS Isolation and Structural Organization of the Human CRHR2 Gene Genomic library screening yielded one positive plaque containing a 40-kb clone Jp1. Restriction digested fragments of Jp1 were analyzed by Southern blot and sequencing of these fragments revealed the organization of the 5⬘ exons of the CRHR2 gene (Fig. 1). Fragments Jp1-SstI (4.1 kb) and Jp1-SstI/SphI (3.0 kb) both contained the CRHR2␣ unique exon and the first common exon, these were separated by an intronic sequence of 137 bp. DNA fragment Jp1-SphI (3.2 kb), which overlapped with JpI-SstI (4.1 kb), contained the CRHR2␥ unique exon, which was separated from the CRHR2␣ exon by an intron of 4056 bp. A final fragment Jp1-NdeI (8.0 kb) contained the CRHR2␥ exon and 94 bp of CRHR2␤ (␤1b) separated by an intron of 2575 bp. This suggested that the unique amino terminus of CRHR2␤ results from fusion of two unique exons. Attempts to amplify the region between these two exons using NcoI digested-polyadenylated genomic DNA, were unsuccessful suggesting that the two exons

Catalano et al. • Regulation of the Human CRHR2 Gene

were interrupted by a large intron. Comparison of the above sequences and cDNA sequences for CRHR2 revealed 100% homology with that of human PAC clone DJ1143H19 (accession no. AC004976). Sequence analysis of this genomic clone enabled us to complete the structural organization of the CRHR2 gene and complete the exon arrangement for each CRHR2 subtype (Fig. 2). This revealed that CRHR2␤ contained two unique exons separated by a large 10,659-bp intron (Table 1). Characterization of 5ⴕ-Untranslated Regions (UTRs) of the CRHR2 Subtypes 5⬘-Rapid amplification of 5⬘-cDNA ends (RACE) experiments using CRHR2␣ specific primers identified two transcripts (Fig. 3A). The lower band contained the two unique CRHR2␤ exons (exons ␤1a and ␤1b) and the unique CRHR2␣ exon (exon ␣1). The upper band contained exons ␤1a and ␤1b, the unique CRHR2␥ exon (exon ␥1) and exon ␣1 (Fig. 3B). This also extended the 5⬘-UTR of the CRHR2␣ gene by 52 nucleotides to a consensus 3⬘ acceptor splice site used by the upstream exons. The average length of the 5⬘-UTR in eukaryotes is approximately 150 nucleotides (28), which suggested that the transcription start site for CRHR2␣ was further upstream. We therefore compared the rat CRHR2␣ 5⬘-UTR sequence (7) with mouse, rat, and human genomic sequences containing the CRHR2␣ unique exon and 5⬘ flanking sequences. The homology shared between these species in the 5⬘-UTR is over 60% and extends for over 200 nucleotides (Fig. 3C). Transcription start site prediction programs using 1500 bp of human, rat, and mouse CRHR2␣ genomic sequence upstream of the start codon, indicated transcription initiation in proximity (1–46 nucleotides) from the end of the known 5⬘-UTR of the rat. This suggested that the 5⬘-UTR in all three species are similar in length, approximately 225 bp, but more importantly extends approximately 150 bp 5⬘ to the 3⬘ acceptor site. To verify that the 5⬘-UTR extends beyond the 3⬘ acceptor site, CRHR2␣ was amplified by RT-PCR from human brain cDNA using a

Fig. 1. Organization of the 5⬘ End of the CRHR2 Gene by Analysis of Restriction Digested Fragments of Clone Jp1 Southern blot using CRHR2␣-specific (lanes 1 and 2) and CRHR2␥-specific (lane 3) probes (A). Positive restriction fragments were cloned and sequenced to reveal the 5⬘ organization of the CRHR2 gene. 5⬘ Exons are indicated by solid boxes, and 5⬘ and 3⬘-UTRs are indicated by hatched boxes. The distances between 5⬘ exons are drawn to scale but not in relation to exon size; hatched boxes indicate untranslated regions and solid boxes represent coding regions (B).


Mol Endocrinol, March 2003, 17(3):395–410

397

Fig. 2. Schematic Representation of the Structure of the Human CRHR2 Gene Exons coding for the N-terminal extracellular domain (ED), the seven transmembrane domains (7TM), and the C-terminal cytoplasmic domain (CD) are indicated. Functional transcripts are indicated below for the ␤, ␥, and ␣ receptors; 5⬘ and 3⬘-UTRs are indicated by hatched boxes, and solid boxes represent coding regions.

Table 1. Exon-Intron Organization of the Human CRHR2 Gene Exon Number

␤1a ␤1b ␥1 ␣1 2 3 4 5 6 7 8 9 10 11 12

Size (bp)

320 94 227 156 126 86 110 118 154 61 73 86 136 42 1,015

Intron Sequence

CTCCAATAC ACCTCTCAG TCTGCCAAG ACCCCGAGG ACACGACCC GATGACAAG GGCCCTGCG AGCAATGAG TCGGATGGT GAATGAACA GTGCTCCTG CCAGTACAG TCGTTCCAG AATGGAGAG GCCTCTTGG

Donor

gtaagtgca gtaggtacc gtatctgtc gtaggcggg gtgagtgcc gtgagtggc gtgagtctg gtcattgct gtgagggtc gtaagtgga gtaagccct gtatgtgag gtggggcct gtatgaagc

Number

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Size (bp)

10,659 2,575 4,056 137 14,601 1,588 342 2,222 477 1,510 4,560 211 499 1,438

Exon Acceptor

Gtcccctag Tttttgtag Ccctcgcag Cgccgccag Tttttgtag Tctgtccag Ctcccacag Tgcacacag Ttctttcag Tcttcacag Tccctccag Cgcccccag Cctttccag Tccccacag

Sequence

␤-GGCTGGCTG GCAGCCGGG ␥-GCTGGTCTT ␣-TCACGCCGG GTCCCTACT GGAATGCCT CAGAGGAAG GAGCATTCG GTCTGGTGC GCATCCCCT GTGCTGGTT ATCAATTTC GAAGGCAGT GGTTTCTTC GTGCGCTCA

Number

␤1a ␤1b ␥1 ␣1 2 3 4 5 6 7 8 9 10 11 12

The sequences of exon-intron junctions are indicated. Exon and intron sequences are in capital and lowercase letters, respectively. Unique exons for each receptor ␤, ␥, and ␣ are indicated.

5⬘ primer (␣-207) located close to the predicted transcription start sites. Amplification of CRHR2␣ clearly indicated that the transcription start site is upstream of the 3⬘ acceptor site and the 5⬘-UTR is over 207 bp (Fig. 3D). Using CRHR2␥ specific primers we identified two transcripts (Fig. 4A), the lower band containing exons ␤1a, ␤1b, and ␥1 and the upper band exons ␤1a and ␤1b together with a 195-bp intronic sequence (␤1c) and exon ␥1 (Fig. 4B). The 5⬘-UTR was extended by 15 nucleotides and, like CRHR2␣, contained a consensus 3⬘ splice site. The CRHR2␥ subtype was previously known only in humans. We have identified genomic clones from the GenBank database containing the CRHR2␥ subtype in olive baboon and chimpanzee. These species share over 85% homology to humans in

their 5⬘ sequence from the ATG for over 300 bp. The 3⬘ acceptor splice site is highly conserved between species despite an insertion in the olive baboon and the predicted transcription start site is located upstream of the splice site at the same nucleotide in all species (Fig. 4C). We identified two products using the CRHR2␤-specific primer. The largest extended the 5⬘UTR by 176 nucleotides to 226 bp, although the shorter fragment with a 5⬘-UTR of 201 bp was the major product (Fig. 5). Analysis of Promoter Activity Upstream of the Unique Exons for the CRHR2 Subtypes The promoter activity of the sequence 5⬘ to the unique CRHR2 ␤, ␥, and ␣ exons was studied by transient

398



Fig. 3. Characterization of the 5⬘-UTR for the CRHR2␣ Subtype 5⬘-RACE products using human hippocampus cDNA with CRHR2␣-specific primers; bands of the 1-kb DNA ladder are indicated on the right, and arrows indicate isolated bands referred in the text (A). Transcripts arising from alternate splicing; 5⬘ and 3⬘-UTRs are indicated by hatched boxes, and solid boxes represent coding region. Dashed lines indicate unverified 3⬘ sequences and exons, in frame stop codons are shown indicating receptor truncation if the transcript is translated (B). Comparison of CRHR2␣genomic sequences 5⬘ to the ATG start codon of human (clone Jp1), mouse (AC079243), rat (AC091712), and rat 5⬘-UTR cDNA sequence (U16253). Bold and underlined nucleotides indicate predicted transcriptional start sites, internal 3⬘ splice site and translational start site, respectively (C). RT-PCR using primer ␣-207 underlined in (C) and intron spanning primer IS1 on human brain cDNA (lane 1) and myometrium cDNA (lane 2) and 1 ng genomic DNA control (lane 3; D). Amplified products indicate that CRHR2␣ 5⬘-UTR extends upstream of the splice site as shown by the predicted transcriptional start sites.



399

Fig. 4. Characterization of the 5⬘-UTR for the CRHR2␥ Subtype 5⬘-RACE products using human hippocampus cDNA with CRHR2␥-specific primers; bands of the 1-kb DNA ladder are indicated on the right, and arrows indicate isolated bands referred to in the text (A). Transcripts arising from alternate splicing; 5⬘ and 3⬘-UTRs are indicated by hatched boxes, solid boxes represent coding region, and open box contains intronic sequence. Dashed lines indicate unverified 3⬘ sequences and exons; in-frame stop codons are shown indicating receptor truncation if the transcript is translated (B). Comparison of CRHR2␥ genomic sequences 5⬘ to the ATG start codon of human (clone Jp1), baboon (AC091714), and chimpanzee (AC091720). Bold and underlined nucleotides indicate predicted transcriptional start sites, internal 3⬘ splice site, and translational start site, respectively (C).

expression assay with the luciferase gene as a reporter, in several cell lines. By using a dual luciferase assay, differences in transfection efficiencies were corrected for and activity was measured as a ratio of the two luciferases. Reporter assays with the largest construct for each subtype in four different cell lines

indicated all constructs possessed promoter activity. This activity increased 10-fold in endogenously expressing cell lines (Fig. 6). Analysis of the CRHR2␤ promoter sequence suggested the minimal promoter is contained between nucleotides ⫺304 and ⫺251 (Fig. 7A). Analysis of the CRHR2␥ promoter sequence



Fig. 5. Characterization of the 5⬘-UTR for the CRHR2␤ Subtype 5⬘-RACE products using human hippocampus cDNA with CRHR2␤-specific primers. Bands of the 1-kb DNA ladder are indicated on the right, and arrows indicate isolated bands referred in the text (A). Transcripts arising from alternate splicing, 5⬘and 3⬘-UTRs are indicated by hatched boxes, and solid boxes represent coding region. Dashed lines indicate unverified 3⬘ sequences and exons, and in-frame stop codons are shown indicating receptor truncation if the transcript is translated (B).

Fig. 6. Transient Transfections Demonstrating Promoter Activity of the Sequence 5⬘ to the First Exons of CRHR2␤, CRHR2␥, and CRHR2␣ Constructs containing the largest 5⬘ sequences were transfected into four cell lines. CRHR2␣ is endogenously expressed in myometrial cells and A431 cells. Luciferase reporter constructs are labeled according to 5⬘ flanking sequences from the ATG start codon. Luciferase reporter activity is derived from the mean relative luciferase activity from three experiments ⫾SD.

indicated that the minimal promoter to be within ⫺237 nucleotides, but the putative TATA box was nonfunctional because mutating this element to TCTAC (pTATAmut) had no effect on promoter activity (Fig. 7B). Analysis of the CRHR2␣ promoter sequence suggested that the minimal promoter is contained between nucleotides ⫺350 and ⫺250 (Fig. 7C). This region is GC rich and contains multiple putative Sp1 elements that are also conserved within the same region on the mouse and rat CRHR2␣ promoters.

Sequence Analysis of the CRHR2 Promoters Figures 8–10 show the sequence 5⬘ to the unique exons for the CRHR2 ␣, ␥, and ␤. There is no typical TATA or CCAAT sequence in the promoter region of CRHR2␤ but several Sp1 binding elements (Fig. 8). Several putative transcription factor elements were identified, myogenic MEF-2 at ⫺195, E box elements at ⫺349 and ⫺217 capable of binding E12, MyoD, and myogenin. Elements for the ubiquitous and highly ex-



401

Fig. 7. Transient Transfections Demonstrating Promoter Activity of the Sequence 5⬘ to the First Exon of CRHR2␤, CRHR2␥, and CRHR2␣ Luciferase reporter constructs are labeled according to 5⬘ flanking sequences from the ATG start codon. Luciferase reporter activity after transfection in four cell lines are derived from the mean relative luciferase activity from three experiments ⫾SD. A, CRHR2␤. B, CRHR2␥. Construct p-TATAmut is identical to construct p-TATAnorm except for two mutations where A residues were switched to C residues producing a nonfunctional TATA box element. Luciferase activity is identical in these two constructs indicating the TATA box is nonfunctional. C, CRHR2␣.

pressed in brain Egr-1 factor (29) was identified at ⫺168, and two elements for retinoid X receptor at ⫺2479 and ⫺1393. Comparative promoter analysis of the CRHR2␤ promoter with genomic sequences from chimpanzee, baboon, pig, bovine, cat, rat, and mouse (accession nos. AC091720, AC091714, AC091723,

AC092193, AC091797, AC091712, and AC079243, respectively) indicated the region ⫺1 to ⫺200 to be highly conserved containing Sp1 elements and the myocyte specific enhancer MEF-2. The promoter region of CRHR2␥ contains a consensus TATA box element at ⫺214, although this was shown to be non-



Fig. 8. Genomic Sequence of CRHR2␤ Promoter 5⬘-UTR is in bold, transcription start sites are in black boxes, and splice element and putative transcription factor binding elements are in open boxes. Asterisk indicates elements conserved between species.

functional in the reporter assays (Fig. 9). Other elements present are Oct-1 at ⫺278, ⫺361 and ⫺1161, CCAAT/enhancer binding protein at ⫺358,

⫺568, ⫺639, ⫺1158, estrogen receptor at ⫺835, glucocorticoid receptor (GR) at ⫺1698 and Pit-1a at ⫺303, a pituitary transcription factor (30). Comparative



403

Fig. 9. Genomic Sequence of CRHR2␥ Promoter 5⬘-UTR is in bold, predicted transcription start sites are in gray boxes, and splice element and putative transcription factor binding elements are in open boxes. Asterisk indicates elements conserved between primates.

promoter analysis of the CRHR2␥ with genomic sequences from chimpanzee and baboon indicated many elements to be conserved including those for estrogen receptor, GR, and Pit-1a. Genomic sequences from pig, bovine, cat, rat, and mouse between the CRHR2␤ and CRHR2␣ failed to identify CRHR2␥ suggesting it is absent in these species. The CRHR2␣ promoter does not contain either a typical TATA or CCAAT motif. However, it is very GC rich and possesses several Sp1 binding elements upstream

from the transcription start site (Fig. 10). Other elements present include those for the ubiquitous serum response factor at ⫺326, Ap-2 at ⫺400 and ⫺1132, nuclear factor-␬B at ⫺1036, YY1 at ⫺1140, progesterone receptor at ⫺2756 and ⫺2344, GR at ⫺2755 and ⫺2243, upstream stimulating factor at ⫺1471 and the myogenic factor MRF4 at ⫺1101. Comparative promoter analysis of the CRHR2␣ promoter with genomic sequences from chimpanzee, baboon, pig, bovine, cat, rat, and mouse indicated certain elements



Fig. 10. Genomic Sequence of CRHR2␣ Promoter 5⬘-UTR is in bold, predicted transcription start sites are in gray boxes, and splice element and putative transcription factor binding elements are in open boxes. Asterisk indicates elements conserved between species.

are conserved especially the Sp1 sites around the transcription start site but also those for GR and progesterone receptor (Fig. 10).

DISCUSSION We present the 5⬘ structural organization of the human CRHR2 gene and demonstrate that it is regulated by

multiple promoters and differential splicing. The human CRHR2 gene expresses three different subtypes, which are structurally distinct in their N-terminal extracellular domains and exhibit significant differences in their tissue distribution. The human CRHR2 gene spans 50 kb and consists of 15 exons. Exon ␤1a contains the 5⬘-UTR and start codon for CRHR2␤ and together with exon ␤1b, contributes to the N-terminal extracellular domain. Exons ␥1 and ␣1 contain the


5⬘-UTR and start codon for CRHR2␥ and CRHR2␣, respectively, which contributes to their unique Nterminal extracellular domain. Exons 2–12 code for the remainder of the N-terminal domain, the seven transmembrane domains (exons 7–11), and the C-terminal intracellular domain, which are common to all CRHR2 receptors. The group II members of the GPCR family are unique in this respect as the rest of the GPCR family are predominantly intronless, especially within the protein coding region (reviewed in Ref. 31). The exon-intron organization of group II GPCRs suggests a common evolutionary origin and unlike other GPCR subfamilies permits extensive alternate splicing. This has allowed the potential for members to produce diverse receptors with alternate domains, which in turn produce receptors with differing ligand specificity, binding, and G protein coupling. Luciferase reporter plasmids containing the 5⬘ flanking regions of exons ␤1a, ␥1, and ␣1 induced similar and significant levels of activity, indicating the presence of three functional promoters. Gene regulation by use of multiple promoters is well described (32) especially in genes that direct the expression of mRNAs with alternate 5⬘-UTRs. For example, the ␥-glutamyltransferase gene and the GH receptor gene, which direct expression of six and eight mRNAs respectively, with different 5⬘-UTRs by the use of five intronic promoters (33, 34). There are fewer examples of genes that use multiple promoters to express mRNAs that code for alternate N-terminal domains. The human phosphodiesterase 5A gene (35) and several PAR domain transcription factor genes each produce two such mRNAs by this mechanism (36–39). The emergence of multiple promoter regions has evolved to achieve differential and temporal expression of a gene with a specific capacity to respond to particular cellular or metabolic conditions. The 5⬘-flanking region of the CRHR2␤, CRHR2␥, and CRHR2␣ lack a functional TATA or CCAAT box, which is a feature typical of housekeeping genes. Heterogeneity of transcription initiation sites is also a common phenomenon in housekeeping genes, found associated with GC boxes. This is the case for the CRHR2␤ promoter and is likely to be the case for the CRHR2␣ promoter. The CRHR2␣ promoter is GC rich and contains several Sp1 binding elements, which suggests these elements constitute the minimal promoter. There are many potential upstream regulatory elements in the 5⬘ flanking regions although there are several notable features. The CRHR2␤ and CRHR2␣ are expressed in heart, myometrium, and skeletal muscle and contain elements for myogenic transcription factors, whereas CRHR2␥, which appears to be predominantly in the brain, contains none. CRHR2 has been demonstrated to be expressed in the pituitary, though the isoform has not been determined (40). CRHR2␥ may possibly be the isoform expressed here as it contains an element for the pituitary specific factor Pit-1a. Comparative promoter analysis from genomic clones containing the CRHR2 gene from six other


405

species (chimpanzee, baboon, bovine, pig, cat, mouse, and rat) indicate that the myocyte specific enhancer MEF-2 (41) in CRHR2␤, the Sp1-rich region in CRHR2␣ and the pituitary specific element Pit-1a are conserved in all species. The highly conserved myocyte specific enhancer in the CRHR2␤ promoter may play an important role in regulating expression in the heart where urocortin, the preferred ligand of this subtype is also expressed. Comparative promoter analysis also revealed a common presence of steroid response elements, for progesterone, estrogen, glucocorticoids, and retinoic acid in all receptor subtypes. CRHR2 has shown to be regulated in the heart and brain by glucocorticoids (42, 43). Putative glucocorticoid-responsive elements are present in CRHR2␣, and some of these elements are highly conserved between species. Clearly, further analysis of the promoter sequences to establish which transcription factors are involved will reveal the mechanism of tissue specific regulation. Identification of full-length 5⬘-UTR using hippocampus cDNA revealed two transcripts with a 5⬘-UTR of 201 bp and 226 bp for the CRHR2␤, suggesting alternate transcriptional start sites. Identification of fulllength 5⬘-UTR for the CRHR2␥ and CRHR2␣ were unsuccessful as only alternate splice forms containing ␤ exons were amplified. We have attempted to identify the transcriptional start sites by ribonuclease protection assay and primer extension, but both were unsuccessful. This may be due to the low expression of these transcripts (detection of CRHR2␣ by PCR requires 35–40 cycles) but also that the size of the product for CRHR2␥ may be too small for these assays. The distance from the splice site to the transcriptional start site (which encompasses the CRHR2␥ unique sequence) may be only from 60–20 bp. Alternate splice forms of CRHR2 have been reported previously (18), which contain exons ␤1a-2 and ␤1a-1b-␥1–2 (Figs. 5 and 4, respectively). We identified three novel alternate splice forms that were highly expressed (Figs. 3B and 4B). This suggests that CRHR2␤ pre-mRNA is differentially spliced producing five alternate splice forms, although if any permutation of exons between ␤1a and 2 occurs at least 12 alternate splice forms could be produced. Indeed, we consistently detected several fainter bands that we were unable to isolate. Sequencing of the 5⬘-RACE products extended the known 5⬘UTR of CRHR2␥ and CRHR2␣ and revealed a consensus 3⬘ splice site to which 5⬘ exons are spliced. As we did not detect CRHR2␥ or CRHR2␣ transcripts with 5⬘-UTR extending beyond the 3⬘ splice site, it suggests that they are not, or are only weakly expressed relative to alternate transcripts in the hippocampus. This emphasizes the problem of determining expression of functional CRHR2 subtypes in different tissues especially CRHR2␥ and CRHR2␣ when alternate splice forms are present and more highly expressed. Primers designed to the published unique sequences for CRHR2␥ and CRHR2␣ are unable to distinguish between functional transcripts and alternately spliced


transcripts producing data that do not relate to the presence or quantity of functional receptor subtype (18, 22, 44, 45). Therefore, primers or probes need to be designed to sequences upstream of the 3⬘ acceptor splice sites that contain sequences unique to these subtypes. The 5⬘-UTR of the human CRHR2␣ shows high homology to that of the rat CRHR2␣ in which the 5⬘-UTR has been shown to extend beyond the 3⬘ acceptor splice site for a further 163 nucleotides. We have determined the structure of the mouse CRHR2␣ gene by analysis of the mouse genome database (data not shown) and compared the predicted transcriptional start sites of both mouse and human to show they are similar to that of the rat. This was shown experimentally by amplifying the human CRHR2␣ with a primer upstream of the 3⬘ acceptor splice site, using cDNA from both brain and myometrium, this extended the 5⬘-UTR to 207 nucleotides. An increasing number of GPCR subtypes are expressed in the form of spliced variants with variable parts of the amino acid sequence modified (reviewed in Ref. 46). Most of these variant isoforms such as the somatostatin receptor 2b subtype (47) remain functional by keeping the basic seven transmembrane domains structures of the receptor molecule intact that are necessary for receptor activity. The physiological and pharmacological relevance of these splice variants depends on where alterations are situated. The largest number of splice variants are situated at the C terminus, e.g. the ␤-adrenoceptor variant B1S (48). Variants in the N terminus and the putative cytoplasmic loops are also relatively numerous, e.g. CRHR2 variants 2␤, 2␥, and 2␣ and the dopamine variant D2S (49), respectively. Splice variants in the putative extracellular loops or TMs are less frequent, e.g. the orphanin receptor variant OFQ1E (50) and PAC receptor variant PAC1TM4 (51), respectively. By contrast, there are reports of an increasing number of aberrant or truncated variants that have lost their ability to bind the natural ligand either because they have lost typical transmembrane-spanning domains as described for the nonfunctional dopamine D3 receptor (52) or because several transmembrane-spanning domains have been deleted. As observed for variants of the human GHRH receptor (53), and the CRHR2␤ variants (18), which have the introduction of premature stop codons. Some of these aberrant forms are reported to be present in a tissue-specific manner as demonstrated by the neurotensin receptor (54), the rat CRHR2␣ receptor variants, which are differentially expressed in specific regions of the brain (55), and CRHR1 receptor variants in the skin (56). These variant forms are also conserved between species. An example of this is the short nonfunctional variant of the 5-hydroxy-tryptamine 2c receptor, which is produced by alternate splicing in rat, mouse, and human brain (57). The variant receptor can be transiently expressed but has not been detected in vivo suggesting that it may be conserved due to regulation at the level of pre-mRNA processing rather than at the metabolic level. To our knowledge, none of the aberrant or truncated forms reported are expressed in vivo, suggesting that


they may play a regulatory role not at the physiological level but at the level of transcript processing. Regardless of whether or not these aberrant transcripts are significantly expressed as protein products, the dominant expression of the aberrant transcripts at the expense of the wild-type receptor at transcription would have the end result of reducing levels of functional receptor. These variants are often dismissed as being a result of leaky transcription, although some of these transcripts are highly expressed such as the aberrant transcripts of CRHR2␤ (18) and CRHR2␣ (58). The tissue specificity of these transcripts needs to be determined if a correlation between expression of aberrant transcripts and functional receptor transcripts is to be linked to a regulatory splicing event. These aberrant transcripts are all too often ignored, and it is clear that more work is necessary particularly in the area of physiological and pathophysiological relevance, especially as there are several reports linking splice variants with disease (59–61). The arrangement and function of the 5⬘ end of the CRHR2 gene with multiple promoters regulating receptor subtype expression will provide valuable information for further functional studies and interpreting past analyses. We can now determine which tissues and cell lines contain functional receptor and not confuse them with splice variants. This is essential for stimulation studies that examine expression of a specific receptor subtype and its relation to the expression of specific ligands for CRH receptors. The characterization of the three promoters can now direct functional studies on the individual receptor subtypes. Little is known about the function of the CRHR2␥, although putative binding elements suggest an important role in the pituitary and regulation by glucocorticoids and estrogen. The CRHR2␤ has been shown to be expressed in both the human and rodent cardiovascular system and, in the rodent at least, is regulated by glucocorticoids (42, 62). Interestingly, the human CRHR2␤ promoter contains putative binding elements for myogenic binding factors, which are highly conserved between species, but none for the GR. CRHR2 expression in the heart differs between human and rodents where in humans CRHR2␣ is predominant, in rodents it is the CRHR2␤ subtype. CRHR2␣ also contains a putative myogenic binding element, which is not conserved in rodents and contains binding elements for the GR; this may well explain the discrepancies between species. Identification of the CRHR2 promoters will now allow a more focused approach to subtype regulation by mutational analysis of specific elements and direct novel stimulation studies such as a possible role of retinoic acid in CRH receptor regulation. All the features of the CRHR2 gene are common throughout group II GPCRs, such as alternate splicing, multiple promoters, truncated receptors, alternate 5⬘UTR, etc. It is evident that a common mode of transcriptional control has evolved, involving both promoter and splicing regulation to control the expression of functional and variant receptors. The evolutionary relevance of multiple promoters and alternate splicing serve as a molecular tool to introduce more diversity



407

Table 2. Primer Sequences Used in Producing Constructs for Promoter Analysis Name

5⬘-3⬘ Sequence

p-␤2940 p-␤2430 p-␤1958 p-␤1438 p-␤597 p-␤485 p-␤391 p-␤344 p-␤304 p-␤251 p-␤Reverse

␤ Constructs CAGGAGCGACTGGTAAGA GCAAGAAGGTGCCACCTA GTTATGGATGCCAGGTCT GACCTGTGAGATTTCACAGGAG TACCCACAGTACAGTATC GCTCCTCAGATAGGTGTTAG TGCCTGTCTCAATTCCTCTC CAATGCTGGCAGCCGATAGA CAGGCTGGATGGAGAGCATA GGGACCAGCTATAAATAACC GGTGTGGGACGTAGAGGAGG

p-␥1714 p-␥1490 p-␥1133 p-␥704 p-TATAnorm p-TATAmut p-␥Reverse

␥ Constructs GCTGGTAGGCCAAGATCA GGCCACATTCTGAGGTACTG CTCTGAGTGCAGCGGATAGG CGGATGGTGGATGTAGAG ATAAATAGTCCATTTGGATTTTTATATCAT ATAAATAGTCCATTTGGATTTGTAGATCAT GGTAGGCAGATTGCTTGA

p-␣2790 p-␣1193 p-␣698 p-␣450 p-␣350 p-␣250 p-␣Reverse

␣ Constructs CTCTGCTGCTCATGGTACAC CACCAAGGAGGCATTCTG CAGCTTCCACGGTCTGAT CCGCACAGAGCATTCCGTCA GAGCTGCGAACTGAGAAG CTGTACCCGCAGCTCCGT GGAGTGGACGCGAGAGTG

into gene expression. The fact that group II GPCRs have multiple coding exons in comparison to other GPCR family members may be due to them being generated as an alternative to gene duplication during evolution. The increasing complexity seen within the subfamily seems to have evolved by divergence from a simpler regulated gene with increasing complexity of the organism. The CRH receptors are a good example, CRHR2 appears to have diverged from CRHR1 by duplication and then by increasing complexity to produce three subtypes with different pharmacology and differential expression. CRHR2␣ is present in amphibians, whereas in rodents a second variant CRHR2␤ is also present and in primates a third variant CRHR2␥. As more members of the group II GPCR family are extensively studied the trend for increasing complexity using multiple promoters and alternate splicing may become more apparent.

MATERIALS AND METHODS

0.5 ⫻ 106 plaques were screened using the plaque hybridization method with a 32P-labeled DNA probe containing nucleotides 1–97 of CRHR2␣ (U34587). Positive phage clones were isolated and analyzed by Southern blot with 32 P-end-labeled oligonucleotides specific to CRHR2␤, CRHR2␥, and CRHR2␣. Subclones were sequenced using an ABI 373A (PE Applied Biosystems, Warrington, UK) automated fluorescent sequencer. 5ⴕ-RACE To determine the 5⬘ end of the CRHR2 subtypes, 5⬘-RACE was performed using Marathon Ready human hippocampus cDNA (CLONTECH Laboratories, Inc.) according to the manufacturer’s instructions. Primary PCR was carried out using a gene specific primer (CRHR2␤: 5⬘-GAGGAGGTGTGGGACGTAGAGGAG, CRHR2␥: 5⬘-GCAGAAGAGCTGAGGAAAGCCCAGGTC, CRHR2␣: 5⬘-CAGCCGTCCAAGAGCAGCTCTTCAG) and the anchor primer AP1. Secondary PCR was carried out using a nested gene specific primer (CRHR2␤: 5⬘-GGTATTCTCCACCCACTTCTTCCAC, CRHR2␥: 5⬘- AAAGCCCAGGTCCCTGTCTTCAGGC, CRHR2␣: 5⬘-CTTCAGCCAGCGCCAGGCTGCAGTTG) and the anchor primer AP2 with 2.0 ␮l of primary PCR product as template. The PCR products were analyzed on a 1% agarose gel, extracted and subcloned into the pGEM-T vector (Promega Corp., Southampton, UK) for sequencing.

Isolation of Genomic Clones by Genomic Library Screening and Southern Blotting

Luciferase Plasmid Construction

A human placental cosmid library was purchased from CLONTECH Laboratories, Inc. (Oxford, UK). Approximately

Flanking sequences 5⬘ to the translational start site of ␤, ␥, and ␣ receptor genes were PCR amplified from genomic


DNA, cloned into the pGL-3 basic vector (Promega Corp.) and sequence verified. Primers used for this PCR had a 5⬘ KpnI restriction site in the 5⬘ primer and a XhoI or BglII site in the 3⬘ primer to facilitate cloning. Constructs were designed using the primers described in Table 2. Amplification of CRHR2␣ by PCR PCR was performed using 20 ng of human brain cDNA (CLONTECH Laboratories, Inc.) with 0.5 ␮M of each primer, forward primer ␣-207: 5⬘-CACTCGGCGGCTCCTCTC-3⬘, reverse primer IS1 5⬘-TAGGAGTAGGGACCCTCGG-3⬘, which hybridizes with the end of exon ␣1 and the start of exon 2, this prevents amplification from genomic template. The PCR mixture contained 1.3 M Betaine (Sigma, Gillingham, UK) and 1.3% dimethylsulfoxide, after 5 min at 95 C, 1 U of KlenTaq (Sigma) was added. PCR parameters: 94 C for 30 sec, 66 C for 30 sec, 72 C for 30 sec, 37 cycles, and a final extension at 72 C for 5 min. Products were analyzed by electrophoreses on a 1.5% agarose gel. Transient Transfection and Reporter Gene Analysis Human cell lines (myometrium primary myocytes, A431 skin epithelial, A549 lung epithelial, HEK293 kidney epithelial, MCF7 mammary gland epithelial) were seeded in six-well plates and cultured according to the American Type Culture Collection (Manassas, VA) recommendations until they were around 60% confluent. The cells were transfected with 1 ␮g of plasmid DNA using Lipofectamine Plus (Life Technologies, Inc., Paisley, UK) in 1 ml of serum-free medium Optimem (Life Technologies, Inc.) for 3 h. All plasmid constructs were cotransfected with 1 ␮g of the pRL-TK vector (Promega Corp.) to determine the transfection efficiency. Medium was replaced with 2 ml of fresh culture medium 3 h after transfection and cells were grown until 90% confluent. Cell extracts were prepared 24–36 h after transfection and assayed using a dual-luciferase reporter assay system (Promega Corp.). Luciferase activity was measured for 10 sec using a Luminoskan RS luminometer (Labsystems, Helsinki, Finland). Database Sequence Analysis Gene structure and exon mapping was determined using the DNA Star SeqMan tool, comparative promoter analysis using TRES and sequence alignments were performed using Multalign. The Transfac database was searched using AliBaba 2.1 for promoter elements and transcription start site prediction was determined using the 5⬘ flanking sequence from the ATG start codon with NNPP (63), TSSG (64), and TSSW (65) programs.

Acknowledgments We would like to thank Dr. E. Karteris for the myometrial cDNA used in these studies.

Received August 29, 2002. Accepted November 20, 2002. Address all correspondence and requests for reprints to: Edward W. Hillhouse, Office of the Dean, Worsley Building, The Medical School, The University of Leeds, Leeds, LS2 9NL, United Kingdom. E-mail: [email protected]. This work was supported by funding obtained from Coventry General Charities and the Diabetes Medical Research Fund, UK. Sequences reported in this paper have been deposited in the GenBank database (accession nos. AF361106, AF361107, and AF361108).


REFERENCES 1. Vale, W, Spiess J, Rivier, C, Rivier J 1981 Characterization of 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and ␤-endorphin. Science 213:1394–1397 2. Orth DN 1992 Corticotropin-releasing hormone in humans. Endocr Rev 13:164–191 3. Rivier C, Vale W 1983 Modulation of stress-induced ACTH release by corticotropin-releasing factor, catecholamines and vasopressin. Nature 305:325–327 4. Dunn AJ, Berridge CW 1990 Physiological and behavioral responses to corticotropin-releasing factor administration: is CRF a mediator of anxiety or stress responses? Brain Res Rev 15:71–100 5. Owens MJ, Nemeroff CB 1991 Physiology and pharmacology of corticotropin-releasing factor. Pharmacol Rev 43:425–473 6. Chen R, Lewis KA, Perrin MH, Vale W 1993 Expression cloning of a human corticotropin-releasing-factor receptor. Proc Natl Acad Sci USA 90:8967–8971 7. Lovenberg TW, Liaw CW, Grigoriadis DE, Clevenger W, Chalmers DT, DeSouza EB, Oltersdorf T 1995 Cloning and characterisation of a functionally distinct corticotropin-releasing factor receptor subtype from rat brain. Proc Natl Acad Sci USA 92:836–840 8. Polymeropoulos MH, Torres R, Yanovski JA, Chandrasekharappa SC, Ledbetter DH 1995 The human corticotropin-releasing factor receptor (CRHR) gene maps to chromosome 17q12–q22. Genomics 28:123–124 9. Meyer AH, Ullmer C, Schmuck K, Morel C, Wishart W, Lubbert H, Engels P 1997 Localization of the human CRF2 receptor to 7p21–p15 by radiation hybrid mapping and FISH analysis. Genomics 40:189–190 10. Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C 1995 Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378:287–292 11. Hsu SY, Hsueh AJ 2001 Human stresscopin and stresscopin-related peptide are selective ligands for the type 2 corticotropin-releasing hormone receptor. Nat Med 7:605–611 12. Ross PC, Kostas CM, Ramabhadran TV 1994 A variant of the human corticotropin-releasing factor (CRF) receptor, expression and pharmacology. Biochem Biophys Res Commun 205:1836–1842 13. Grammatopoulos DK, Dai Y, Randeva HS, Levine MA, Karteris E, Easton AJ, Hillhouse EW 1999 A novel spliced variant of the type 1 corticotropin-releasing hormone receptor with a deletion in the seventh transmembrane domain present in the human pregnant term myometrium and fetal membranes. Mol Endocrinol 13: 2189–2202 14. Chalmers DT, Lovenberg TW, DeSouza EB 1995 Localization of novel corticotropin-releasing factor receptor (CRF2) mRNA expression to specific subcortical nuclei in rat brain. J Neurosci 15:6340–6350 15. Vita N, Laurent P, Lefort S, Chalon P, Lelias JM, Kaghad M, Le Fur G, Caput D, Ferrara P 1993 Primary structure and functional expression of mouse pituitary and human brain corticotrophin releasing factor receptors. FEBS Lett 335:1–5 16. Nappi RE, Rivest S 1995 Stress induced genetic expression of a selective corticotropin-releasing factor-receptor subtype within the rat ovaries: an effect dependent on the ovulatory cycle. Biol Reprod 53:1417–1428 17. Smith R, Mesiano S, Chan EC, Brown S, Jaffe RB 1995 Corticotropin-releasing hormone directly and preferentially stimulates dehydroepiandrosterone sulfate secretion by human fetal adrenal cortical cells. J Clin Endocrinol Metab 83:2916–2929


18. Vladenaire O, Giller T, Breu V, Gottowik J, Kilpatrick G 1997 A new functional isoform of the human CRF2 receptor for corticotropin-releasing hormone. Biochim Biophys Acta 1352:129–132 19. Kishimoto T, Pearse RV, Lin CR, Rosenfeld MG 1995 A sauvagine/corticotropin-releasing factor receptor expressed in heart and skeletal muscle. Proc Natl Acad Sci USA 92:1108–1112 20. Potter E, Sutton C, Donaldson C, Chen R, Perrin M, Lewis K, Sawchenko PE, Vale W 1994 Distribution of corticotropin-releasing factor receptor mRNA expression in the rat brain and pituitary. Proc Natl Acad Sci USA 92:2969–2973 21. Lovenberg TW, Chalmers DT, Liu C, DeSouza EB 1995 CRF2 ␣ and CRF2 ␤ receptor mRNAs are differentially distributed between the rat central nervous system and peripheral tissues. Endocrinology 136:4139–4142 22. Kostich WA, Chen A, Sperle K, Largent BL 1998 Molecular identification and analysis of a novel human corticotropin-releasing factor (CRF) receptor: the CRF2␥ receptor. Mol Endocrinol 12:1077–1085 23. Grammatopoulos D, Dai Y, Chen J, Karteris E, Papadopoulou N, Easton AJ, Hillhouse EW 1998 Human corticotropin-releasing hormone receptor: differences in subtype expression between pregnant and nonpregnant myometria. J Clin Endocrinol Metab 83:2539–2544 24. Timpl P, Spanagel R, Sillaber I, Kresse A, Reul JMHM, Stalla GK, Blanquet V, Steckler T, Holsboer F, Wurst W 1998 Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor. Nat Genet 19:162–166 25. Coste, SC, Kesterson RA, Heldwein KA, Stevens SL, Heard AD, Hollis JH, Murray SE, Hill JK, Pantely GA, Hohimer AR, Hatton DC, Philips TJ, Finn DA, Low MJ, Rittenberg MB, Stenzel P, Stenzel-Poore MP 2000 Abnormal adaptations to stress and impaired cardiovascular function in mice lacking corticotropin-releasing hormone receptor-2. Nat Genet 24:403–409 26. Kishimoto T, Radulovic J, Radulovic M, Lin CR, Schrick C, Hooshmand F, Hermanson O, Rosenfeld MG, Spiess J 2000 Deletion of crhr2 reveals an anxiolytic role for corticotropin-releasing hormone receptor-2. Nat Genet 24:415–419 27. Bale TL, Contarino A, Smith GW, Chan R, Gold LH, Sawchenko PE, Koob GF, Vale WW, Lee KF 2000 Mice deficient for corticotropin-releasing hormone receptor-2 display anxiety-like behaviour and are hypersensitive to stress. Nat Genet 24:410–414 28. Kozak M 1989 The scanning model for translation: an update. J Cell Biol 108:229–241 29. Cao X, Koski RA, Gashler A, McKieman M, Morris CF, Gaffney R, Hay RV, Sukhatme VP 1990 Identification and characterisation of the Egr-1 gene product, a DNA-binding zinc finger protein induced by differentiation and growth signals. Mol Cell Biol 10:1931–1939 30. Bodner M, Castrillo JL, Theill LE, Deemick T, Ellisman M Karin M 1988 The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 55: 505–518 31. Gentles A, Karlin S 1999 Why are human G-proteincoupled receptors predominantly intronless? Trends Genet 15:47–49 32. Schibler U, Sierra F 1987 Alternative promoters in developmental gene expression. Annu Rev Genet 21:237–257 33. Rajagopalan S, Wan DF, Habib GM, Sepulveda AR, McLeod MR, Lebovitz RM, Lieberman MW 1993 Six mRNAs with different 5⬘ends are encoded by a single ␥glutamyltransferase gene in mouse. Proc Natl Acad Sci USA 90:6179–6183 34. Zou L, Burmeister LA, Sperling MA 1997 Isolation of a liver-specific promoter for human growth hormone receptor gene. Endocrinology 138:1771–1774


409

35. Lin CS, Lau A, Tu R, Lue TF 2000 Identification of three alternative first exons and an intronic promoter of human PDE5A gene. Biochem Biophys Res Commun 16: 628–635 36. Burch JB, Davis DL 1994 Alternative promoter usage and splicing options result in the differential expression of mRNAs encoding four isoforms of chicken VBP, a member of the PAR subfamily of bZIP transcription factors. Nucleic Acids Res 22:4733–4741 37. Reddy KL, Wohlwill A, Dzitoeva S, Lin MH, Holbrook S, Storti RV 2000 The Drosophila PAR domain protein (Pdp 1) gene encodes multiple differentially expressed mRNAs and proteins through the use of multiple enhancers and promoters. Dev Biol 224:401–414 38. Xu X, Liu L, Wong KC, Ge R 1998 Cloning and characterisation of two isoforms of the zebrafish thyrotroph embryonic factor (tef␣ and tef␤). Biochim Biophys Acta 1395:13–20 39. Falvey E, Fleury-Olela F, Schibler U 1995 The rat hepatic leukemia factor (HLF) gene encodes two transcriptional activators with distinct circadian rhythms, tissue distributions and target preferences. EMBO J 14:4307–4317 40. Muller MB, Preil J, Renner U, Zimmermann S, Kresse AE, Stalla GK, Keck ME, Holsboer F, Wurst W 2001 Expression of CRHR1 and CRHR2 in mouse pituitary and adrenal gland: implications for HPA system regulation. Endocrinology 142:4150–4153 41. Gossett LA, Kelvin DJ, Sternberg EA, Olson EN 1989 A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mol Cell Biol 9:5022–5033 42. Kageyama K, Gaudriault GE, Bradbury MJ, Vale WW 2000 Regulation of corticotropin-releasing factor receptor type 2␤ messenger ribonucleic acid in the rat cardiovascular system by urocortin, glucocorticoids, and cytokines. Endocrinology 141:2285–2293 43. Makino S, Nishiyama M, Asaba K, Gold PW, Hashimoto K 1998 Altered expression of type 2 CRH receptor mRNA in the VMH by glucocorticoids and starvation. Am J Physiol 275:R1138–R1145 44. Muramatsu Y, Sugino N, Suzuki T, Takahashi K, Tashiro A, Hongo M, Oki Y, Sasano 2001 Urocortin and corticotropin-releasing factor receptor expression in normal cycling human ovaries. J Clin Endocrinol Metab 86: 1362–1369 45. Rodrigues-Linares B, Linton EA, Phaneuf S 1998 Expression of corticotrophin-releasing hormone receptor mRNA and protein in the human myometrium. J Endocrinol 156: 15–21 46. Kilpatrick GJ, Dautzenberg FM, Martin GR, Eglen RM 1999 7TM receptors: the splicing on the cake. Trends Pharmacol Sci 20:294–301 47. Vanetti M, Kouba M, Wang X, Vogt G, Hollt V 1992 Cloning and expression of a novel mouse somatostatin receptor (SSTR2B). FEBS Lett 311:290–294 48. Wang J, Ross EM 1995 The carboxyl-terminal anchorage domain of the turkey ␤1-adrenergic receptor is encoded by an alternatively spliced exon. J Biol Chem 270: 6488–6495 49. Monsma FJ, McVittie LD, Gerfen CR, Mahan LC, Sibley DR 1989 Multiple D2 dopamine receptors produced by alternative splicing. Nature 342:926–929 50. Wang JB, Johnson PS, Imai Y, Persico AM, Ozenberger BA, Eppler CM, Uhl GR 1994 cDNA cloning of an orphan opiate receptor gene fanily member and its splice variant. FEBS Lett 348:75–79 51. Chatterjee TK, Sharma RV, Fisher RA 1996 Molecular cloning of a novel variant of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor that stimulates calcium influx by activation of L-type calcium channels. J Biol Chem 271:32226–32232 52. Schmauss C, Haroutunian V, Davis KL Davidson M 1993 Selective loss of dopamine D3-type receptor mRNA ex-


53.

54.

55.

56.

57.

58.

pression in parietal and motor cortices of patients with chronic schizophrenia. Proc Natl Acad Sci USA 90: 8942–8946 Tang J, Lagace G, Castagne J, Collou R 1995 Identification of human growth hormone-releasing hormone receptor splicing variants. J Clin Endocrinol Metab 80: 2381–2388 Botto JM, Sarret P, Vincent JP, Mazella J 1997 Identification and expression of a variant isoform of the levocabastine-sensitive neurotensin receptor in the mouse central nervous system. FEBS Lett 400:211–214 Miyata I, Shiota C, Chaki S, Okuyama S, Inagami T 2001 Localization and characterisation of a short isoform of the corticotropin-releasing factor receptor type 2␣ (CRF(2)␣-tr) in the rat brain. Biochem Biophys Res Commun 280:553–557 Pisarchik A, Slominski AT 2001 Alternative splicing of CRH-R1 receptors in human and mouse skin identification of new variants and their differential expression. FASEB J 15:2754–2756 Canton H, Emeson RB, Barker EL, Backstrom JR, Lu JT, Chang MS, Sanders-Bush E 1996 Identification, molecular cloning, and distribution of a short variant of the 5-hydroxytrptamine2C receptor produced by alternative splicing. Mol Pharmacol 50:799–807 Miyata I, Shiota C, Ikeda Y, Oshida Y, Chaki S, Okuyama S, Inagami T 1999 Cloning and characterization of a short


59. 60.

61.

62.

63. 64. 65.

variant of the corticotropin-releasing factor receptor subtype from rat amygdala. Biochem Biophys Res Commun 256:692–696 Schmauss C 1996 Enhanced cleavage of an atypical intron of dopamine D3-receptor pre-mRNA in chronic schizophrenia. J Neurosci 16:7902–7909 Miller LJ, Holicky EL, Ulrich CD, Wieben ED 1995 Abnormal processing of the human cholecystokinin receptor gene in association with gallstones and obesity. Gastroenterology 109:1375–1380 Autelitano DJ, van den Buuse M 1995 Altered expression of dopamine D2 receptor mRNA splice variants in brain and pituitary of spontaneously hypersensitive rats. Neurosci Lett 195:1–4 Kimura Y, Takahashi K, Totsune K, Muramatsu Y, Kaneko C, Darnel AD, Suzuki T, Ebina M, Nukiwa T, Sasano H 2002 Expression of urocortin and corticotropin-releasing factor receptor subtype in the human heart. J Clin Endocrinol Metab 87:340–346 Ohler U, Harbeck S, Niemann H, Noth E, Reese MG 1999 Interpolated markov chains for eukaryotic promoter recognition. Bioinformatics 15:362–369 Prestridge DS 1995 Predicting Pol II promoter sequences using transcription factor binding sites. J Mol Biol 249: 923–932 Wingender E 1994 Recognition of regulatory regions in genomic sequences. J Biotechnol 35:273–280

American Association for the Study of Liver Diseases Henry M. and Lillian Stratton Basic Research Single Topic Conference— Nuclear Receptor Regulation of Hepatobiliary Function May 29–June 1, 2003, Warrenton, VA Go to http://www.aasld.org/meetings or call 703-299-9766