Regulation of Multilineage Gene Expression and ... - GoeScholar

Original Paper Accepted after revision: January 22, 2010 Published online: April 20, 2010

Cells Tissues Organs 2010;192:211–220 DOI: 10.1159/000313417

Regulation of Multilineage Gene Expression and Apoptosis during in vitro Expansion of Human Bone Marrow Stromal Cells with Different Cell Culture Media Huiyong Zhu a, b Nicolai Miosge c Jutta Schulz b Henning Schliephake b

a

Department of Oral and Maxillofacial Surgery, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, PR China; Departments of b Oral and Maxillofacial Surgery and c Prosthodontics, Georg August University, Göttingen, Germany

Key Words Apoptosis ⴢ Bone marrow stromal cells ⴢ Expansion ⴢ Mesenchymal differentiation ⴢ Proliferation ⴢ Senescence

Abstract The aim of the present study was to analyze the effect of 3 different expansion media on the expression of marker genes of mesenchymal differentiation (bone, cartilage, fat) as well as apoptosis and senescence during repeated passaging in human bone marrow stromal cells (hBMSCs) in order to identify potential expansion strategies for the use of these cells into tissue-engineered growth of bone. Medium 1 (EGF, PDGF, low Glc, 2% FCS) was associated with the highest proliferation rate compared to medium 2 (␤-mercaptoethanol, high Glc DMEM, 15% FCS) and medium 3 (low Glc DMEM, 10% FCS). Real time RT-PCR indicated the lowest levels of expression of osteonectin, core binding factor- ␣ 1, lipoprotein lipase and cartilage oligo matrix protein in medium-1 cultures as compared to media 2 and 3. Early passages expressed higher levels of peroxisome proliferatoractivator receptor- ␥2 in medium 1 than in media 2 and 3, whereas no difference of Sox-9 expression was noticed among the 3 media. Expression of apoptosis- and senescence-related genes (Bax, BCL-2 and P16INK4a) exhibited the lowest level of Bax/BCL-2 ratio and P16INK4a gene expres-

© 2010 S. Karger AG, Basel 1422–6405/10/1924–0211$26.00/0 Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

Accessible online at: www.karger.com/cto

sion of hBMSC in medium 1. In conclusion, the replacement of FCS by recombinant EGF and PDGF promoted rapid proliferation of hBMSCs without inducing differentiation of hBMSCs. It also inhibited expression of apoptosis-related genes and limited replicative senescence during repeated passaging. Media with the lowest possible FCS content and replacement by EGF and PDGF thus should be used for 2D culturing during expansion of hBMSCs, whereas ␤-mercaptoethanol and high concentrations of FCS can help to commence osteogenic differentiation. Copyright © 2010 S. Karger AG, Basel

Abbreviations used in this paper

Bax BCL-2 BMSCs Cbf-␣ 1 COMP EGF FCS ␤-ME MSCs ON PDGF PPAR␥2

BCL-2-associated X protein B-cell leukemia/lymphoma 2 bone marrow stromal cells core binding factor-␣ 1 cartilage oligo matrix protein epidermal growth factor fetal calf serum ␤-mercaptoethanol mesenchymal stem cells osteonectin platelet-derived growth factor peroxisome proliferator-activator receptor-␥2

Dr. Henning Schliephake Department of Oral and Maxillofacial Surgery, Georg August University Robert-Koch-Strasse 40, DE–37075 Göttingen (Germany) Tel. +49 551 398 306, Fax +49 551 391 2653 E-Mail schliephake.henning @ med.uni-goettingen.de

Introduction

Mesenchymal stem cells (MSCs) are of great therapeutic potential because of their ability to self-renew and differentiate into multiple lineages [Pittenger et al., 1999]. They are defined as multipotent cells capable of replicating extensively and regenerating mesenchymal tissues such as bone, cartilage, muscle, ligaments, tendons, adipose tissue and stroma [Prockop, 1997; Tokalov et al., 2007]. Bone marrow stromal cells (BMSCs) are a frequently used source for MSCs. Friedenstein et al. [1982] first described MSCs in bone marrow as a very rare population, making up just 0.001–0.01%. However, previous studies have shown that extensive subculturing of BMSCs resulted in upregulation of apoptotic markers during later passages [Yang et al., 2007]. When human BMSCs were cultured in vitro, they displayed a tendency to lose their proliferation potential, homing capability and in vivo bone-forming efficiency over time [Banfi et al., 2000; Toyoda et al., 2007]. Moreover, it has been demonstrated that BMSCs exhibited growth characteristics typical of the Hayflick model of cellular senescence with a limited life span, telomere shortening and accumulation of galactosidase positive senescent cells [Stenderup et al., 2003]. Thus, concerns have been raised whether hBMSCs can be considered as stem cells at all or whether their potential cannot be identified under the established protocols for expansion [Derubeis and Cancedda, 2004]. Current ex vivo expansion strategies generally rely on the use of serum conditioned media, which not only carry possible inherent disease risks [Stute et al., 2004] but also hinder standardization that is critical to establish a broad clinical application. A variety of supplements have been postulated as alternatives to fetal bovine serum to provide nutrients, attachment factors and, especially, growth factors. Human platelet lysate was verified to be the optimal component, favoring not only very rapid but also long-term expansion while maintaining the immune phenotype, differentiation and immunomodulatory capacities [Zaky et al., 2008; Bieback et al., 2009]. The preparation of platelet lysate was complex owing to repeated freeze-thaw cycles and the effective substances were growth factors. In order to replace serum conditioning and increase the number of times the population doubled, several growth factors have been used for expansion of BMSCs. Fibroblast growth factor-2 has shown a high potential to increase expansion of BMSCs; however, gene expression showed a spontaneous tendency to differentiate into the osteoblastic lineage during in vitro expansion [Banfi et al., 2002]. Reyes et al. [Reyes et al., 2001] have 212

Cells Tissues Organs 2010;192:211–220

used epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) with a reduced fetal calf serum (FCS) content to culture a CD45+ and glycoforin A+ depleted human BMSC (hBMSC) population on fibronectin-coated dishes. Using a complex protocol, they have been able to isolate a highly purified population of progenitor cells that could be cultivated up to 50 population doublings, after which the cells still showed multilineage potential for mesenchymal cell types. BMSCs as a whole represent a heterogeneous population of cells in different stages of commitment [Caplan, 2007]. Thus, it is desirable to compare the effects of expansion media with and without growth factors on this mixed population in order to identify media conditions in a simplified protocol that maintains the proliferative activity and suppresses the spontaneous tendency of adherently growing cells to differentiate into specific lineages as well as inhibit the induction of apoptosis and senescence. The aim of the present study was, thus, to evaluate 3 different media for in vitro growth kinetics of hBMSCs during serial subculturing, their mesenchymal differentiation as well as the expression of apoptosis-related and cell senescence genes.

Materials and Methods hBMSC Culture hBMSCs were obtained from iliac crest marrow aspirates from 3 healthy donors for iliac crest bone transplantation. All donors gave informed consent and all procedures were approved by the hospital ethical committee. hBMSCs were isolated and cultured as previously described [Pittenger et al., 1999; Wolfe et al., 2008; Bieback et al., 2009]. Briefly, the mononuclear cells were isolated from the collected samples by Lymphoprep쏐 (Axis-Shield Poc AS, Oslo, Norway) density gradient centrifugation. Then mononuclear cells were washed with PBS (Gibco, Invitrogen) and resuspended at 2 ! 106 mononuclear cells/cm2 in 3 different media. Medium 1 (M1) consisted of 58% low-glucose (1 g/l) DMEM (Gibco), 40% MCDB-201 (Sigma), 1! insulin transferrin selenium (Sigma), 2 ! 10 –8 M dexamethasone (Sigma), 10 –4 M ascorbic acid 2-phosphate (Sigma), 2% gentamicin (PAN biotech GmbH, Germany), 2% FCS (Biochrom AG, Germany), and 10 ng/ml EGF (Strathmann Biotec AG, Hamburg, Germany), 10 ng/ml PDGFBB (Strathmann) and 100 U penicillin and 1,000 U streptomycin (Gibco) as described by Reyes et al. [2001]. Medium 2 (M2) was composed of high-glucose (4.5 g/l) DMEM, 15% FCS, 1% (5 ! 10 –5 M) ␤-mercaptoethanol (␤-ME; Serva, Heidelberg, Germany) and 1% non-essential amino acids (Gibco), 2% gentamicin as described by Guan et al. [1999] for the isolation and expansion of MSCs. Medium 3 (M3) contained low-glucose (1 g/l) DMEM, 10% FCS and 2% gentamicin. This medium is frequently used for expansion of BMSCs [Jaiswal et al., 1997; Bruder et al., 1998].

Zhu /Miosge /Schulz /Schliephake

Table 1. Primer sequences for target and housekeeping genes employed in the study

Gene

Primer sequence (5ⴕ]3ⴕ)

Product size, bp Accession number

ON

F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R:

126

BC072457

181

NM_004348

182

NM_000237

175

NM_015869

154

NM_000095

264

Z46629

168

NM_138761

161

NM_000633

165

AF115544

186

NM_002745

Cbf-␣ 1 LPL PPAR␥2 COMP Sox-9 Bax BCL-2 P16INK4a MAPK-1

CGAGCTGGATGAGAACAACA AAGTGGCAGGAAGAGTCGAA TTCCAGACCAGCAGCACTC CAGCGTCAACACCATCATT AGAGCCAAAAGAAGCAG GGCAGAGTGAATGGGAT CTTTTGGTGACTTTATGGA CTTGTAGCAGGTTGTCTTG AGGGAGATCGTGCAGACAA AGCTGGAGCTGTCCTGGTAG ATCTGAAGAAGGAGAGCGAG TCAGAAGTCTCCAGAGCTTG GCTGGACATTGGACTTCCTC GCCTCAGCCCATCTTCTTC TTGGATCAGGGAGTTGGAAG CCATGCTGATGTCTCTGGAA CCAGGTGGGTAGAAGGTCTG CCAGGAGGAGGTCTGTGATT CCACCCATATCTGGAGCAGT CAGTCCTCTGAGCCCTTGTC

LPL = Lipoprotein lipase; MAPK-1 = mitogen-activated protein kinase-1.

No conditioning supplements for osteogenic, chondrogenic or adipogenic differentiation were used. Cell culture plates were incubated at 37 ° C in a humidified atmosphere of 5% CO2 and fed by complete medium replacement every 3–4 days. When all cultures reached 80% confluence, the hBMSCs were trypsinized using 0.05% trypsin 5-mM EDTA (Biochrom AG, Germany) and counted using a CASY cell counter system (Schaerfe-System GmbH, Germany). Then 1 ! 105 cells were replated, and the remainder was used for the analysis of genes expressed during differentiation, apoptosis and senescence. All cells in 3 different media were cultured until the fifth passage.

Flow Cytometry Analysis To analyze cell surface expression of typical markers, BMSCs were harvested from primary passage in culture medium with DMEM and 10% FCS. 106 cells were re-suspended in 100 ␮l DMEM containing 10% FCS, and were incubated with PE (phycoerythrin)-labeled CD44, FITC (fluorescein isothiocyanate)labeled CD34 antibody (eBioscience) at 4 ° C for 30 min. Samples were washed with PBS and analyzed using flow cytometry with FACS (Beckman Coulter).

Proliferation Assay and Morphological Characteristics To evaluate the proliferation rate among different media, the cells were detached and counted at each passage and the mean confluence time was calculated. To determine the population doubling after primary passage, the cells were seeded at 1 ! 104/ cm2 and the cell number was counted in each passage. The num-

Gene Expression and Apoptosis in Expansion of Bone Marrow Stromal Cells

ber of times the population doubled was calculated using the formula logN/log2 [Stenderup et al., 2003], where N is the cell number in the confluent monolayer divided by the initial number of cells seeded. This procedure was repeated in every passage. To study the morphological characteristics, cell culture plates were observed using invert phase-contrast microscopy (Axiovert 200M, Zeiss, Germany), to recognize differences among the different media. Real-Time PCR Analysis Total RNA was extracted from cell lysates in RLT buffer, using an RNeasy mini kit (Qiagen, Germany). Quantification and purity of RNA was determined by Biophotometer (Eppendorf, Germany). Starting with 100 ng RNA, 100 ␮l cDNA were synthesized using QuantiTect Reverse Transcription Qiagen, Germany) according to the manufacturer’s recommendation. Realtime PCR was performed in a gradient cycler (Master-Cycler, Eppendorf, Germany) using QuantiTect SYBR Green PCR kit (Qiagen, Germany). In each reaction, 1 ␮l cDNA probe was added into 4.5 ␮l Real Master Mix/SYBR solution (Eppendorf, Germany), 1 ␮l primer forward, 1 ␮l primer reverse, 2.5 ␮l RNasefree water. The gene-specific primer sets are listed in table 1. These genes included: – Osteogenic genes: osteonectin (ON), core binding factor-␣ 1 (Cbf- ␣ 1). – Chondrogenic genes: cartilage oligo matrix protein (COMP) and Sox-9.


213

1,800,000 1,400,000

1,400,000

Harvested cells, n

Harvested cells, n

1,600,000

MSC medium-1 MSC medium-2 MSC medium-3

*#

1,600,000 1,200,000 1,000,000 800,000 600,000 400,000

1,200,000

*

1,000,000

*

800,000 600,000

*

400,000 200,000

200,000

0

0 Culture medium

P1

P2

b 18

16

16

14

14

12

12

Cumulative PDs

Confluence time (days)

a

*

10 8 6

P4

P5

10 8 6

4

4

2

2

0

P3 Passage

0 P1

c

P2

P3 Passage

P4

P5

0

10

20 Days of culture

d

30

40

Fig. 1. Growth kinetic of hBMSC culture in 3 media (M1, M2 and M3). a Primary cultured (P0) cell number in different media. * p ! 0.01 vs. M3; # p ! 0.01 vs. M2. b Harvested cell number in passages from different media. * p ! 0.05 vs. M3. c Comparison of confluence time among the 3 different media. * p ! 0.05 vs. M3. d Cumula-

tive number of PDs plotted against time in culture among different media.

– Adipogenic genes: lipoprotein lipase, peroxisome proliferatoractivator receptor-␥2 (PPAR␥2). – Apoptosis-related genes: B-cell leukemia/lymphoma 2 (BCL2) and BCL-2-associated X protein (Bax). – Senescence-related genes: cyclin-dependent kinase inhibitor (P16INK4a). Mitogen-activated protein kinase-1 was used as the housekeeping gene for internal control to compensate for the variability among the different donors and different DNA contents in the samples. The cells at passage 0 (P0) in DMEM medium were used as non-stimulated baseline for the analysis of different marker gene expressions. Forty cycles were used for all genes and consisted of a 2-min activation for HotstarTaq DNA polymerase at 95 ° C, 15-second denaturation at 95 ° C, 15-second annealing at 62 ° C (ON, Bax, P16INK4a), 63 ° C (Cbf- ␣ 1, BCL-2), 59 ° C (lipoprotein lipase, mitogen-activated protein kinase-1), 57 ° C (PPAR␥2), 61 ° C (COMP), 56 ° C (Sox-9), and a final 20-second extension at 68 ° C. The threshold cycle (Ct) and melting curves were analyzed for all samples. Amplification efficiency of target and housekeeping genes was determined by performing standard curves of all these genes. The

214


relative ratio between the amount of target gene and a housekeeping gene was calculated as described by Pfaffl [2001]. There were multiple RT-PCR measurements on each sample. Statistical Analysis Differences between the groups were tested for statistical significance by 1-way analysis of variance (ANOVA) at a significance level of p ! 0.05.

Results

Flow Cytometry Analysis Isolated and expanded cells from mononuclear cells were highly positive for CD44 which is a typical surface antigen of BMSCs. In contrast, cells were nearly negative for CD34, the marker of the hematopoietic lineage (online suppl. figure 1, www. karger.comdoi/10.1159/000313417).


a

b

Fig. 2. Morphology of hBMSCs cultured in different media. a hBMSCs appeared in spindle shape and more concentrated in M1 in passage 1 after 3 days’ culture. b hBMSCs appeared in wider shape in M2 in passage 1 after 3 days’ culture. c hBMSCs

showed spindle shape and sparse distribution in M3 in passage 1 after 3 days’ culture. Images are phase-contrast pictures. Scale bar = 100 ␮m.

c

Proliferation and Morphology of hBMSCs The mean counts of harvested cells from primary culture and subsequent passages from the 3 media are shown in figure 1a and b. hBMSCs in M1 produced significantly higher numbers of harvested cells than the other 2 media, both in the primary passage and during the subsequent 3 passages (pM1 vs. M3 = 0.015 in P1, pM1 vs. M3 = 0.0121 in P2, pM1 vs. M3 = 0.0179 in P3) whereas there was no significant difference between M2 and M3 from the primary passage (pM2 vs. M3 = 0.115) to P5. The difference was not significant anymore in P4 and P5. The average confluence time and the cumulative population doublings in the various passages were also different (fig. 1c, d). hBMSCs in M1 reached earlier confluence whereas M2 and M3 showed an obvious lag for confluence, espe-

cially in late passages (p 1 0.05 from P1–P4, p = 0.044 in P5). In addition, the population doublings in M1 increased sharply with time in culture compared with gradual increase of population doublings in M2. After nearly 3 weeks there was a stable or flat tendency for proliferation until the fifth passage. This tendency was due to a progressively declining growth rate during further passages. Interestingly, hBMSCs in M3 showed negative proliferation after 10 days of culture until cells in culture ceased to replicate at 25 days. With the same initial cell seeding density (1 ! 104/ cm2) in different media, hBMSCs cultured in M1 with 2% FCS preserved the spindle-type shape (fig. 2a), whereas hBMSCs cultured in M2 with 15% FCS exhibited a wider and flatter shape (fig. 2b) and hBMSCs cultured in M3



215

1.04

*

*

Relative ratio

Relative ratio

1.02 1.00 0.98 0.96 0.94 0.92 P0

P1

P2 P3 Passage

2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0

P4

P5

*

P2 P3 Passage

P4

P5

P0

P1

P2 P3 Passage

P4

P5

P0

P1

P2 P3 Passage

P4

P5

1.00 0.98 0.96 0.94 0.92 0.90

P1

P2 P3 Passage

P4

P5

d

1.2

*

** Relative ratio

#

Relative ratio

P1

1.02

c

0.8 0.6 0.4 0.2 0 P0

e

P0

1.04

P0

1.0


b

Relative ratio

Relative ratio

a

2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0

P1

P2 P3 Passage

P4

P5

2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0

f

Fig. 3. The relative level of differentiation-related gene expression of hBMSCs in M1, M2 and M3. a ON. * p ! 0.05 vs. M2. b Cbf- ␣1. c COMP. * p ! 0.05 vs. M2 and M3. d Sox-9. e Lipoprotein lipase. * p ! 0.05 vs. M2; # p ! 0.01 vs. M2; ** p ! 0.01 vs. M3. f PPAR␥2.

showed very scattered cells of both morphologies with the lowest density growth (fig. 2c). Real Time RT-PCR Assays Differentiation From the 2 osteogenic genes ON expression was significantly increased in the first two passages in cultures with M2 compared to the other 2 media while cells cultured in M1 exhibited the lowest levels of expression 216


(pp1 = 0.048 in passage 1, pp2 = 0.029 in passage 2). This difference was not found in later passages. Concurrently, Cbf-␣ 1 was expressed at higher levels in P1 and P2 in M2 and was lowest in M1; however, this was without statistical significance (fig. 3a, b). Chondrogenic gene expression exhibited a less clear picture in that only COMP exhibited a significantly higher expression in cultures using M2 and lowest expression in M1 only during the second passage (pp2 = 0.026), whereas Sox-9 did not show signifZhu /Miosge /Schulz /Schliephake

6

2.0

Relative ratio

Relative ratio


**

5 4 3 2

1.5

* *

1.0

# #

0.5 1 0

0 P0

P1

a

P2 P3 Passage

P4

P5

P0

14

P4

P5

8

10

Relative ratio

Bax/BCL-2 ratio

P2 P3 Passage

10

12

8 6 4 2

P1

b

#

* **

**

P1

P2 P3 Passage

**

#

6

* 4 2

0

0 P0

c

*

P4

P5

a P0

d

P1

P2 P3 Passage

P4

P5

Fig. 4. The relative level of apoptosis- and senescence-related gene expression of hBMSCs in M1, M2 and M3. a Bax. p ! 0.01 among passages in the same medium. b BCL-2. * p ! 0.05 vs. M2; # p ! 0.01 vs. M2; ** p ! 0.01 vs. P1–P5. c Bax/BCL-2 ratio. * p ! 0.05 vs. M3 in the same passage; ** p ! 0.01 vs. M1 and M3; # p ! 0.01 vs. M2 and M3. d P16INK4a. * p ! 0.05 vs. M3 in the same passage. a No gene expression in primary cultures (P0)

in M1.

icant differences between the 3 media during sequential passaging (fig. 3c, d). Adipogenic differentiation exhibited the least pronounced differences. Only during culturing in passage 0 and in passage 5 did lipoprotein lipase show significantly different expression with lower levels in M1 and higher levels in M2 (pp0 = 0.041, pp5 = 0.002). PPAR␥2 was expressed at higher levels in M1 during primary culture (P0) and M2 during p5 but this was not statistically significant (fig. 3e, f). Apoptosis- and Senescence-Related Gene Expression After serial subculturing to passage 5, the apoptosisrelated genes Bax and BCL-2 showed higher levels of gene expression in most of passages in M2 cultures as compared with M1 and M3 (fig. 4a, b). This was significant for BCL-2 expression in passage 1 and 2 (pp1 = 0.028, pp2 = 0.010). Expression of Bax in general increased during passaging whereas BCL-2 decreased. Hence, the ratio Gene Expression and Apoptosis in Expansion of Bone Marrow Stromal Cells

of Bax/BCL-2 was increased sharply towards later passages and was significantly different among the media in all passages (pP0 = 0.001, pP1 = 0.001, pP3 = 0.011, pP4 = 0.006, pP5 = 0.003) except for P2 (p = 0.593). Medium 3 was the medium that exhibited the highest ratios of Bax/ BCL-2 (fig. 4c). The senescence-related gene P16INK4a could not be detected in P0 in M1 and gradually increased during the subsequent passages until the difference was significant in P5 for M1 and M2 compared to cultures with M3 (pM1P5 = 0.046, pM2P5 = 0.044; fig. 4d). Discussion

The large number of mesenchymal stromal cells necessary for therapeutic applications in bone tissue engineering and their low frequency in bone marrow aspirates require consistent protocols for in vitro expansion Cells Tissues Organs 2010;192:211–220

217

that take into consideration the implications for cell biology during expansion. hBMSCs are limited to the mesenchymal pathway in their ability to differentiate into different cell types. Recent studies have shown that while subpopulations of human MSCs can retain multipotential capacity through a number of passages, most human MSC cultures tend to progressively lose this ability [Rombouts and Ploemacher, 2003; Kotobuki et al., 2005] as they preferably commit to the osteoblastic lineage and undergo senescence after long-term culture [Deans and Moseley, 2000]. The ingredients and media supplements evaluated here are not new in expansion and serial subculturing of hBMSCs. However, to the knowledge of the authors this report is the first to assess the effects of the culture media on hBMSCs with respect to proliferation, differentiation and apoptosis during expansion in a comprehensive approach. The present data suggest that hBMSCs in media replacing the major part of FCS by recombinant EGF and PDGF showed the highest proliferation capacity compared to media using 10–15% FCS, as the number of hBMSCs was significantly higher and confluence occurred earlier in M1 than in the other 2 media. During the first 3 weeks, the cumulative population doubling of hBMSCs was twice as high in M1 compared to M2. In addition, the difference in behavior was associated with the 2 morphologically distinct cell types with the spindleshaped fibroblastoid type that occurred in M1 cultures growing rapidly with the largest potential to expand in culture, whereas the flat, broad polygonal cell type associated with increasing osteogenic differentiation and a low proliferation rate [Colter et al., 2001] was seen in cultures with higher FCS content. These differences are likely to result from the addition of EGF and PDGF. Recent reports have shown that hBMSCs express receptors for PDGF and EGF and that proliferation can be stimulated by heparin-binding EGF-like growth factor (HB-EGF), which interacts with erbB4 and EGFR [Hofer et al., 2005; Krampera et al., 2005; Kratchmarova et al., 2005]. The receptors for EGF and PDGF are prototypical tyrosine kinase receptors present on most adherent cells, including MSCs [Ingram and Bonner, 2006], and are expressed on human MSCs as demonstrated by reported cellular responses [Hofer et al., 2005; Krampera et al., 2005]. Upon binding of EGF and PDGF, EGFR and PDGFR activate ERK (extracellular signal-regulated protein kinase), AKT (protein kinase B/akt) and PLC-␥ (phospholipase C-␥) which promote cell proliferation. hBMSCs in M2 still exhibited an improved proliferation rate compared to cells cultured in M3. This may be 218


accounted for by the addition of ␤-ME in M2 and the fact that this medium contained high glucose DMEM. Inui et al. [1997] reported a positive effect of ␤-ME on human osteoprogenitor cells derived from bone marrow fibroblasts, suggesting a beneficial role of ␤-ME for the optimal maintenance of colony formation, cell proliferation and differentiation of marrow osteoprogenitors in primary bone marrow culture [Inui et al., 1997]. ␤-ME is known to act as an antioxidant which can protect cells from oxidative damage and promote cell survival in cell culture systems. However, high glucose concentrations could impair cellular functions and induce apoptosis. Exposition of MSC to high glucose concentrations was reported to reduce colony-forming activity and induce premature senescence. Moreover, MSC treatment with high glucose concentrations favored proliferation and osteogenic differentiation [Li et al., 2007]. Our results also showed that BMSCs underwent osteogenic differentiation more readily in M2 compared to cells cultured in M1. The effects of growth factors during expansion of stem cells on differentiation have been controversial. Banfi et al. [2002] showed that BMSCs underwent progressively spontaneous osteogenic differentiation after long-term culture until the fifth passage in fibroblast growth factor-2 containing medium. On the contrary, Tuli et al. [2003] introduced a system of culturing mesenchymal progenitor cells derived from human trabecular bone that maintained their optimal differentiation potential during long-term culture expansion. The present data indicate that replacement of FCS by EGF and PDGF (M1) promoted not only rapid proliferation but also inhibited premature differentiation of human BMSCs. This confirms the results of Reyes et al. [2001] showing that it is not only a highly selected population of CD45 and glyophorin-A negative cells that benefit from this protocol but also the mixed population of human BMSCs as a whole. From the analysis of differential gene expression by real time RT-PCR, M1 had exhibited the lowest level of expression of osteogenic and chondrogenic genes (ON and COMP) during early passages. These results are also in line with those of Tamama et al. [2006] who reported that EGFR ligands did not interfere with pluripotency of BMSCs or drive these cells into specific lineages. EGF and PDGF have been shown to inhibit collagen synthesis and alkaline phosphatase activity, and EGFR signaling was proposed as a negative regulator of osteogenic differentiation on BMSCs and preosteoblastic MC3T3 E1 cells [Chien et al., 2000; Gruber et al., 2004; Hofer et al., 2005]. The lack of significance in expression of Cbf-␣ 1 may be Zhu /Miosge /Schulz /Schliephake

explained by the fact that the type I transcript of this transcription factor is also constitutively expressed in non-osseous mesenchymal tissues and plays a regulatory role in early stages of mesenchymal cell development [Banerjee et al., 2001]. The exchange of FCS by EGF and PDGF also inhibited apoptosis in that the lowest Bax/BCL-2 ratio was observed in cultures using M1. The BCL-2 family includes a growing number of genes that serve as critical regulators of pathways involved in apoptosis, acting to either inhibit or promote programmed cell death. Bax is a proapoptotic marker which is the most characteristic deathpromoting member of the BCL-2 family whereas BCL-2 inhibits apoptosis [Xiang et al., 2006]. Therefore, the balance between Bax and BCL-2 is critical for the regulation of cell survival. Replacement of FCS in expansion of BMSCs has been discussed controversially. Positive effects on the formation of fibroblast colony-forming units and proliferation rates have been reported when human serum was used with and without additional mitogenic growth factors [Anselme et al., 2002; Stute et al., 2004], whereas Koller et al. [1998] found decreased support for expansion of human MSCs when both autogenous and allogenic human serum were used. Koller et al. [1998] and Kuznetsov et al. [2000] reported a reduction in bone formation by human MSCs cultivated using human serum. In general, serum deprivation or low serum content in culture media has been shown to induce apoptosis in MSCs [Zhu et al., 2006] but the present results suggest that the combination of EGF and PDGF could protect hBMSCs from these negative effects of low serum concentrations. The anti-apoptotic effect of these growth factors is assumed to be mediated through tyrosine kinase activity, which activates mitogen-activated protein kinases as well as increases in BCL-XL mRNA and protein levels [Ethier et al., 2003].

The inhibition of apoptosis by EGF and PDGF obviously also went along with retardation of cell aging in culture as is shown by the low expression of P16INK4a, which is a cyclin-dependent kinase inhibitor associated with replicative senescence in cell lines including human MSCs [Janzen et al., 2006]. From a practical point of view, the present results can help to improve the in vitro production of tissue-engineered scaffolds for bone replacement. Media with the lowest possible FCS content and replacement by EGF and PDGF are recommendable for the 2D culturing during expansion of hBMSCs, whereas after seeding of the harvested cells into the scaffolds, a change to ␤-ME-containing media can help to allow for commencing osteogenic differentiation while at the same time maintaining a rather high level of proliferation to promote cell outgrowth in the seeded scaffold.

Conclusion

The present study has shown that the replacement of FCS by EGF and PDGF in culture media of whole cultures of hBMSCs was associated with the highest rate of proliferation and population doublings as well as the shortest confluence time. This was combined with the lowest tendency for spontaneous osteogenic and chondrogenic differentiation in serial subculturing. At the same time, markers of apoptosis and cell senescence exhibited the lowest expression under these conditions. Addition of ␤-ME and high concentrations of FCS contributed to maintenance of cell proliferation but did not prevent early induction of osteogenic differentiation.

References Anselme, K., O. Broux, B. Noel, B. Bouxin, G. Bascoulergue, A.F. Duderme, F. Bianchi, J. Jeanfils, P. Hardouin (2002) In vitro control of human bone marrow stromal cells for bone tissue engineering. Tissue Eng 8: 941– 953. Banerjee, C., A. Javed, J.Y. Choi, J. Green, V. Rosen, A.J. van Wijnen, J.L. Stein, J.B. Lian, G.S. Stein (2001) Differential regulation of the two principal Runx2/Cbf␣-1 N-terminal isoforms in response to bone morphogenetic protein-2 during development of the osteoblast phenotype. Endocrinology 142: 4026– 4039.


Banfi, A., A. Muraglia, B. Dozin, M. Mastrogiacomo, R. Cancedda, R. Quarto (2000) Proliferation kinetics and differentiation potential of ex vivo expanded human bone marrow stromal cells: implication for their use in cell therapy. Exp Hematol 28: 707–715. Banfi, A., G. Bianchi, R. Notaro, L. Luzzatto, R. Cancedda, R. Quarto (2002) Replicative aging and gene expression in long-term cultures of human bone marrow stromal cells. Tissue Eng 8: 901–910.

Bieback, K., A. Hecker, A. Kocaömer, H. Lannert, K. Schallmoser, D. Strunk, H. Klüter (2009) Human alternatives to fetal bovine serum for the expansion of mesenchymal stromal cells from bone marrow. Stem Cells 27: 2331–2341. Bruder, S.P., A.A. Kurth, M. Shea, W.C. Hayes, N. Jaiswal, S. Kadiyala (1998) Bone regeneration by implantation of purified, culture-expanded human mesenchymal stem cells. J Orthop Res 16: 155–162. Caplan, A.I. (2007) Adult mesenchymal stem cells for tissue engineering versus regenerative medicine. J Cell Physiol 213: 341–347.


219

Chien, H.H., W.L. Lin, M.I. Cho (2000) Downregulation of osteoblastic cell differentiation by epidermal growth factor receptor. Calcif Tissue Int 67: 141–150. Colter, D.C., I. Sekiva, D.J. Prockop (2001) Identification of subpopulation of rapidly selfrenewing and multipotential adult stem cells in colonies of human marrow stromal cells. Proc Natl Acad Sci USA 98: 7841–7845. Deans, R.J., A.B. Moseley (2000) Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 28: 875–884. Derubeis, A.R., R. Cancedda (2004) Bone marrow stromal cells (BMSCs) in bone engineering: limitations and recent advances. Ann Biomed Eng 32: 160–165. Ethier, C., V.A. Raymond, L. Musallam, R. Houle, M. Bilodeau (2003) Antiapoptotic effect of EGF on mouse hepatocytes associated with downregulation of proapoptotic Bid protein. Am J Physiol Gastrointest Liver Physiol 285: G298–G308. Friedenstein, A.J., N.W. Latzinik, A.G. Grosheva, U.F. Gorskaya (1982) Marrow microenvironment transfer by heterotopic transplantation of freshly isolated and cultured cells in porous sponges. Exp Hematol 10: 217–227. Gruber, R., F. Karreth, B. Kandler, G. Fuerst, A. Rot, M.B. Fischer, G. Watzek (2004) Plateletreleased supernatants increase migration and proliferation, and decrease osteogenic differentiation of bone marrow-derived mesenchymal progenitor cells under in vitro conditions. Platelets 15: 29–35. Guan, K., J. Rohwedel, A. Wobus (1999) Embryonic stem cell differentiation models: cardiogenesis, myogenesis, neurogenesis, epithelial and vascular smooth muscle cell differentiation in vitro. Cytotechnology 30: 211–226. Hofer, E.L., V. La Russa, A.E. Honegger, E.O. Bullorsky, R.H. Bordenave, N.A. Chasseing (2005) Alteration on the expression of IL-1, PDGF, TGF-beta, EGF, and FGF receptors and c-Fos and c-Myc proteins in bone marrow mesenchymal stroma cells from advanced untreated lung and breast cancer patients. Stem Cells Dev 14: 587–594. Ingram, J.L., J.C. Bonner (2006) EGF and PDGF receptor tyrosine kinases as therapeutic targets for chronic lung diseases. Curr Mol Med 6: 409–421. Inui, K., R.O.C. Oreffo, JT. Triffitt (1997) Effects of beta mercaptoethanol on the proliferation and differentiation of human osteoprogenitor cells. Cell Biol Int 21: 419–425. Jaiswal, N., S.E. Haynesworth, A.I. Caplan, S.P. Bruder (1997) Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J Cell Biochem 64: 295–312.

220

Janzen, V., R. Forkert, H.E. Fleming, Y. Saito, M.T. Waring, D.M. Dombkowski, T. Cheng, R.A. DePinho, N.E. Sharpless, D.T. Scadden (2006) Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a. Nature 443: 421–426. Koller, M.R., R.J. Maher, I. Manchel, M. Oxender, A.K. Smith (1998) Alternatives to animal sera for human bone marrow cell expansion: human serum and serum-free media. J Hematother 7: 413–423. Kotobuki, N., M. Hirose, H. Machida, Y. Katou, K. Muraki, Y. Takakura, H. Ohgushi (2005) Viability and osteogenic potential of cryopreserved human bone marrow-derived mesenchymal cells. Tissue Eng 11: 663–673. Krampera, M., A. Pasini, A. Rigo, M.T. Scupoli, C. Tecchio, G. Malpeli, A. Scarpa, F. Dazzi, G. Pizzolo, F. Vinante (2005) HB-EGF/HER1 signaling in bone marrow mesenchymal stem cells: inducing cell expansion and reversibly preventing multilineage differentiation. Blood 106: 59–66. Kratchmarova, I., B. Blagoev, M. Haack-Sorensen, M. Kassem, M. Mann (2005) Mechanism of divergent growth factor effects in mesenchymal stem cell differentiation. Science 308: 1472–1477. Kuznetsov, S.A., M.H. Mankani, P.G. Robey (2000) Effect of serum on human bone marrow stromal cells: ex vivo expansion and in vivo bone formation. Transplantation 70: 1780–1787. Li, Y.M., T. Schilling, P. Benisch, S. Zeck, J. Meissner-Weigl, D. Schneider, C. Limbert, J. Seufert, M. Kassem, N. Schütze, F. Jakob, R. Ebert (2007) Effects of high glucose on mesenchymal stem cell proliferation and differentiation. Biochem Biophys Res Commun 363: 209–215. Mehlhorn, A.T., P. Niemeyer, S. Kaiser, G. Finkenzeller, G.B. Stark, N.P. Suedkamp, H. Schmal (2006) Differential expression pattern of extracellular matrix molecules during chondrogenesis of mesenchymal stem cells from bone marrow and adipose tissue. Tissue Eng 12: 2853–2862. Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res 29: 2002–2007. Pittenger, M.F., A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, S. Craig, D.R. Marshak (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284: 143–147. Prockop, D.J. (1997) Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 276: 71–74. Reyes, M., T. Lund, T. Lenvik, D. Aguiar, L. Koodie, C.M. Verfaillie (2001) Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 98: 2615–2625.


Rombouts, W.J.C., R.E. Ploemacher (2003) Primary murine MSC show highly efficient homing to the bone marrow but lose homing ability following culture. Leukemia 17: 160– 170. Stenderup, K., J. Justesen, C. Clausen, M. Kassem (2003) Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells. Bone 33: 919–926. Stute, N., K. Holtz, M. Bubenheim, C. Lange, F. Blake, A.R. Zander (2004) Autologous serum for isolation and expansion of human mesenchymal stem cells for clinical use. Exp Hematol 32: 1212–1225. Tamama, K., V.H. Fan, L.G. Griffith, H.C. Blai, A. Wells (2006) Epidermal growth factor as a candidate for ex vivo expansion of bone marrow-derived mesenchymal stem cells. Stem Cells 24: 686–695. Tokalov, S.V., S. Gruener, S. Schindler, G. Wolf, M. Baumann, N. Abolmaali (2007) Age-related changes in the frequency of mesenchymal stem cells in the bone marrow of rats. Stem Cells Dev 16: 439–446. Toyoda, M., H. Takahashi, A. Umezawa (2007) Ways for a mesenchymal stem cell to live on its own: maintaining an undifferentiated state ex vivo. Int J Hematol 86: 1–4. Tuli, R., S. Tuli, S. Nandi, M.L. Wang, P.G. Alexander, H. Haleem-Smith, W.J. Hozack, P.A. Manner, K.G. Danielson, R.S. Tuan (2003) Characterization of multipotential mesenchymal progenitor cells derived from human trabecular bone. Stem Cells 21: 681–693. Wolfe, M., R. Pochampally, W. Swaney, R.L. Reger (2008) Isolation and culture of bone marrow-derived human multipotent stromal cells (hMSCs). Methods Mol Biol 449: 23–25. Xiang, M., J. Wang, E. Kaplan, P. Oettgen, L. Lipsitz, J.P. Morgan, J.Y. Min (2006) Antiapoptotic effect of implanted embryonic stem cell-derivedearly- differentiated cells in aging rats after myocardial infarction. J Gerontol A Biol Sci Med Sci 61: 1219–1227. Yang, Y., F.M. Rossi, E.E. Putnins (2007) Ex vivo expansion of rat bone marrow mesenchymal stromal cells on microcarrier beads in spin culture. Biomaterials 28: 3110–3120. Zaky S.H., A. Ottonello, P. Strada, R. Cancedda, M. Mastrogiacomo (2008) Platelet lysate favours in vitro expansion of human bone marrow stromal cells for bone and cartilage engineering. J Tissue Eng Regen Med 2: 472– 481. Zhu, W., J. Chen, X. Cong, S. Hu, X. Chen (2006) Hypoxia and serum deprivation-induced apoptosis in mesenchymal stem cells. Stem Cells 24: 416–425.
