Regulation of Pdha-2 Expression Is Mediated by Proximal Promoter ...

MOLECULAR AND CELLULAR BIOLOGY, Feb. 1997, p. 612–619 0270-7306/97/$04.0010 Copyright q 1997, American Society for Microbiology

Vol. 17, No. 2

Regulation of Pdha-2 Expression Is Mediated by Proximal Promoter Sequences and CpG Methylation ROCCO C. IANNELLO,1* JULIA YOUNG,1 SONY SUMARSONO,1 MARTIN J. TYMMS,1 HANS-HENRIK M. DAHL,2 JODEE GOULD,1 MARK HEDGER,1 AND ISMAIL KOLA1 Molecular Genetics and Development Laboratory, Institute of Reproduction and Development, Monash University, Clayton, Victoria 3168,1 and The Murdoch Institute, Royal Children’s Hospital, Melbourne, Victoria 3052,2 Australia Received 2 May 1996/Returned for modification 16 August 1996/Accepted 30 October 1996

Spermatogenesis is a complex process requiring the coordinate expression of a number of testis-specific genes. One of these, Pdha-2, codes for the murine spermatogenesis-specific isoform of the E1a subunit of the pyruvate dehydrogenase complex. To begin to delineate the mechanisms regulating its expression in vivo, we have generated transgenic mice lines carrying Pdha-2 promoter deletion constructs. Here we report that transgenic mice harboring a construct containing only 187 bp of promoter and upstream sequences (core promoter) is sufficient for directing the testis-specific expression of a chloramphenicol acetyltransferase (CAT) reporter gene. Like the endogenous Pdha-2, the CAT gene is expressed in testis in a stage-specific manner. Our studies also show a correlation between CpG methylation within the core promoter and its capacity to regulate transcription. In NIH 3T3 cell lines stably transfected with the Pdha-2 core promoter–CAT construct, high levels of CAT reporter expression are observed, whereas the endogenous Pdha-2 gene is repressed. In these cells, the CpG dinucleotides residing within the transfected promoter are hypomethylated whereas those residing in the endogenous promoter are methylated. Furthermore, promoter activity can be abated by the in vitro methylation of its CpG dinucleotides. DNase I footprint analysis indicates that at least one site for the methylation-mediated repression may occur through the ATF/cyclic AMP response element binding element located within the core promoter. Mutations within this element reduces activity to approximately 50% of the wild-type promoter activity. These results suggest that tissue-specific gene expression may be modulated by other mechanisms in addition to specific transcription factor availability and cooperativity. We propose that methylation may be a mechanism by which repression of the testis-specific Pdha-2 gene is established in somatic tissue.

germ cell lines to facilitate these studies. Instead, it has been necessary to generate transgenic animals or perform in vitro transcription assays using promoter deletion constructs to gain some insight. Despite the difficulties associated with both of these approaches, some progress is beginning to emerge (6, 9, 11, 12, 14, 15, 20–22, 24, 25, 27, 29, 31, 33, 35). To facilitate an understanding of the mechanisms which govern Pdha-2 promoter-directed transcription in vivo, we have generated transgenic mice harboring Pdha-2 promoter deletion constructs. We demonstrate that the 187-bp Pdha-2 core promoter harbors all of the cis elements necessary for both temporal stage- and testis-specific transcription. Furthermore, our data suggest that methylation contributes to the in vivo repression of Pdha-2 in somatic tissue.

An essential step in aerobic glucose metabolism is the oxidation of pyruvate and its conversion to acetyl coenzyme A in mitochondria. This reaction is catalyzed by pyruvate dehydrogenase, an enzyme complex consisting of a number of subunits, the most important of these being the E1a subunit (28). In human and murine somatic cells, the E1a subunit is coded for by an X-chromosome-linked gene (3, 4, 23). The somatic variant is not expressed during spermatogenesis at a time when X-chromosome inactivation occurs; instead, its expression in spermatogenic cells has been linked to an autosomal, intronless gene which encodes the testis-specific isoform (3, 8). Examination of various mouse tissues (19) demonstrated that transcriptional expression of the mouse autosomal gene (Pdha2) is tightly regulated. These studies demonstrated that Pdha-2 expression occurs specifically in testis and that expression is initiated at the meiotic prophase stage of spermatogenesis following birth (19, 32). Pdha-2 is one of a growing number of testis-specific genes which are coordinately expressed in a stage-specific manner during spermatogenesis (references 19 and 20 and references therein). Although such tight regulation of expression must involve specific molecular mechanisms, the events responsible for the stage-specific activation of such genes have not yet been delineated. The identification of promoter and upstream ciselements which participate in these events has been a particularly onerous task, as there are no suitable spermatogenic

MATERIALS AND METHODS Plasmid constructions. The Pdha-2 promoter–chloramphenicol acetyltransferase (CAT) constructs used in this study have been described elsewhere (20). Briefly, the core promoter construct contains a fragment of the Pdha-2 promoter spanning nucleotide positions 2187 to 122 relative to the transcriptional start site. This promoter cassette was cloned into the CAT reporter-containing vector pCAT Basic (Promega) and designated pt[2187/122]E1a-CAT (Fig. 1). Larger promoter cassettes, containing 386 bp, 1,000 bp, and approximately 3.0 kb of promoter/upstream nucleotide sequences, were also cloned into pCAT Basic and designated pt[2386/122]E1a-CAT, pt[21000/122]E1a-CAT, and pt[23000/ 122]E1a-CAT respectively. The ATF/cyclic AMP response element (CRE) mutation in the construct pQDATF was generated by PCR amplification of the core promoter, using primers which replaced the ATF/CRE binding site (CTGACG TAG) with a nonconsensus site (CTCTAGAAG). Cell culture and transfections. Mouse NIH 3T3 and F9 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% (vol/vol) fetal calf serum and 100 U each of penicillin and streptomycin per ml. Cells were plated

* Corresponding author. Phone: 61-3-9550-5480. Fax: 61-3-95505568. 612

VOL. 17, 1997

FIG. 1. (A) Diagrammatic representation of the Pdha-2 promoter constructs used in this study. (B) Nucleotide sequence of the Pdha-2 core promoter between positions 2187 and 122. Regions identified by DNase I footprinting assays (20) as nuclear factor binding sites are shaded. The binding sites for known transcription factors are underlined.

at an initial density of 5 3 105 cells per 60-mm-diameter culture dish and maintained in a 5% CO2 atmosphere at 378C. The medium was changed 3 h prior to transfection. Transfection of plasmid DNA was mediated by DNA-calcium phosphate coprecipitation (13), using 15 mg of plasmid DNA/plate. Six hours following transfection, the medium was removed, and cells were washed twice with serum-free medium and then incubated with complete medium until ready for harvesting 48 h later. Preparation of spermatogonium-enriched cells. A spermatogonium-enriched cell fraction was collected by centrifugal elutriation of an isolated 10-day-old mouse germ cell preparation, using a modification of the method of Bucci et al. (5). Briefly, cells were loaded onto a Beckman JE 5.0 elutriation rotor with a 4-ml standard chamber (Beckman Instruments, Palo Alto, Calif.) at 2,650 rpm and a flow rate of 9.8 ml/min. The spermatogonial fraction was collected at flow rates of between 17.0 and 29.8 ml/min. The purity of the fraction was assessed by light microscopy; the fraction contained 20% type A spermatogonia, 59% type B spermatogonia, 3% leptotene spermatocytes, and 18% Sertoli cells (and other somatic cells). Pachytene (;80% purity) and haploid spermatids (;85% purity) were purified from adult male mouse testis by the STA-PUT unit gravity sedimentation procedure described by Romrell et al. (30). Generation of transgenic mice. The promoter-CAT constructs pt[23000/ 122]E1a-CAT and pt[2187/122]E1a-CAT were linearized following digestion with PstI and HindIII, respectively, and prepared for pronuclear microinjection using standard procedures (17). Fertilized eggs were obtained from superovulated 6-week-old (CBA 3 C57/6J)F1 female mice. RNA preparation and RNase protection. RNA was prepared as described by Chomczynski and Sacchi (7). RNase protection assays were performed by standard techniques (34). A 286-bp EcoRI/HindIII fragment containing a 59 portion of the bacterial CAT gene was excised from pCAT Basic and cloned into the EcoRI/HindIII sites of pGEM 11Zf(1). A protected fragment of 280 bp was generated. A b2-microglobulin probe which generated a 120-bp protected fragment was used as an internal control. CAT assays, DNase I footprinting, and nuclear extract preparation. CAT assays and the preparation of cell extracts were performed as previously described (13), using [14C]chloramphenicol. Activity (mean 6 standard error of the mean [SEM]) was determined by measuring acetylated and unreacted [14C] chloramphenicol products following ascending thin-layer chromatography and visualization with a Fujix BAS 1000 image analyzer. DNase I footprinting was performed as described by Iannello et al. (20), using nuclear extracts prepared from adult mouse testis. Pdha-2 core promoter probes used for DNase I footprinting analysis were generated by PCR as described by Iannello (18). Methylation of pt[2187/122]E1a-CAT and analysis of in vivo methylation patterns. In vitro methylation of the core promoter construct was performed following an overnight incubation at 378C in the presence of SssI methylase, using conditions recommended by the supplier (New England Biolabs). The CpG methylation status of the Pdha-2 promoter was determined by the bisulfite method developed by Frommer et al. (10). Briefly, genomic DNA was isolated from whole 10-day-old mouse testis, an enriched spermatogonial cell fraction, and an NIH 3T3 cell line containing a stably transfected pt[2187/ 122]E1a-CAT construct. Approximately 10 mg of DNA was linearized by EcoRI

TRANSGENIC MICE AND THE Pdha-2 PROMOTER

613

digestion. Sulfonation and deamination were done in 3.1 M sodium bisulfite–0.5 mM hydroquinone (pH 5.0) for 40 h at 508C. Desulfination was performed in 0.3 M NaOH at room temperature for 5 min. Primers used in subsequent PCR amplifications were mtmet-a2 (2182) (AGATATCTAGATGTTGTGTG), a1CAT (2383) (AAACAACTAACTAAAATACC), a1-CAT (2358) (AATATTC TCTAGAATACCAT), mtmet-A2 (2) (GTAGGTTATGTTTTTATTTT), mtmet-A2 (Xba) (GGGAAAAGATGTCTAGATGT), mtmet-A1 (2) (AACCA ATACAAATCACATTT), and mtmet-A1 (Xba) (AACTAACTTCTAGACCA TTC). PCR amplifications (40 cycles) were performed with nested primers in reaction mixtures containing 0.2 mM deoxynucleoside triphosphates, 1 mg of each primer, and 2 U of Taq polymerase (Boehringer Mannheim). Amplification conditions for the first reaction were 2 min at 958C, 2 min at 478C, and 2 min at 728C. Amplification conditions for the second PCR were 2 min at 958C, 2 min at 508C, and 2 min at 728C. For amplification of the transgene, reactions were performed in the first instance with primers a1-CAT (2383) and mtmet-a2 (2182). Two microliters of this reaction mixture was then used for the second amplification using primers, a1-CAT (2358) and mtmet-a2 (2182). For amplification of the endogenous Pdha-2 promoter, reactions were performed first with primers mtmet-A1 (2) and mtmet-A2 (2). Two microliters of this reaction mixture was then used for the second amplification using primers mtmet-A1 (Xba) and mtmet-A2 (Xba). PCR products were separated on agarose gels and isolated (Qiaex kit; Qiagen Inc.). The fragments were either sequenced (Sequenase; U.S. Biochemical) directly or after subcloning in M13mp19. Primers used for sequencing were mtmetA2 (Xba), mtmet-a2 (2182), a1-CAT(2358), and mtmet-A1 (Xba).

RESULTS Sequences within the Pdha-2 core promoter confer both temporal and testis specificity in transgenic mice. There is very little understanding of the mechanisms which govern the expression of testis-specific genes during spermatogenesis. To begin to elucidate the regulatory regions important for the in vivo expression of Pdha-2, we generated transgenic mice harboring the Pdha-2 core promoter, the pt[2187/122]E1a-CAT construct (Fig. 1). This core promoter region encompasses nucleotide positions 122 to 2187 and has been shown to direct high levels of CAT reporter gene expression in HeLa cells (20). A number of founders which carried the transgene were identified, and lines from each of them were established. CAT activities in testes from all transgenic mice were measured and compared with those in testes of nontransgenic control mice (Table 1). Analysis of mice carrying pt[2187/122]E1a-CAT indicated that the core promoter is capable of directing low to moderate levels of expression in this tissue, on average, representing a 19-fold increase over the background levels observed in testes of control mice. Various somatic tissue were also examined. Analysis of spleens, hearts, kidneys, livers, and brains obtained from several transgenic lines reveals that in these tissues, the levels of CAT activity were comparable to the background levels exhibited in control mice (Table 2; Fig. 2). CAT activities in liver and kidney were slightly higher than those in other somatic organs. This small increase in activity was observed in both the control and transgenic mice and does not represent activity derived from the bacterial reporter gene. Finally, our results show that the levels of CAT activity seen in the testes of transgenic mice were 6- to 12-fold higher than those in somatic tissue, demonstrating that in vivo, the core promoter can direct expression in a tissue-specific manner. Concomitant with the progression of spermatogenesis is an increase in the levels of Pdha-2 mRNA (19). To establish whether the CAT reporter gene followed a similar pattern of temporal expression, we performed RNase protection assays using total RNA prepared from testes of 13- and 30-day-old transgenic mice (Fig. 3A). In these studies, a specific CAT probe hybridized to and protected CAT mRNA expressed in testes of both 13- and 30-day-old mice harboring pt[2187/ 122]E1a-CAT. The signal from the protected probe was barely detectable at day 13 but was increased significantly in testis RNA prepared from 30-day-old transgenic mice (Fig. 3A,

614

IANNELLO ET AL.

MOL. CELL. BIOL.

TABLE 1. CAT activities in testes of control mice and several transgenic lines carrying either pt[2187/122]E1a-CAT or pt[23000/122]E1a-CAT Constructa

Line

None (control) Mean 6 SEM

No. of mice/line

CAT activityb (mean 6 SEM)

7

Transgenic

No 0.12 6 0.04

pt[2187/122]E1a-CAT

8 13 19 20 22

Total no. of mice Mean 6 SEM of the 5 lines pt[23000/122]E1a-CAT

0.4 0.9 2.4 7.3 0.2

Yes Yes Yes Yes Yes

2.24 6 1.30 14 17 19 22 24 26

Total no. of mice Mean 6 SEM of the 6 lines

4 6 4 1 1 16

1 2 1 1 4 1 10

0.8 16.6 54.5 4.3 19.3 15.4

Yes Yes Yes Yes Yes Yes

18.48 6 7.80

FIG. 2. Histogram showing the mean CAT activities of various tissues calculated from all transgenic mice lines carrying pt[2187/122]E1a-CAT and nontransgenic control mice. Values are taken from Table 2. CAT activity is expressed as arbitrary units calculated as the percent conversion of chloramphenicol per hour per microgram of protein. L, liver; S, spleen; K, kidney; H, heart; B, brain; T, testis. CAT activity was measured as described in Materials and Methods. Vertical bars represent the SEM.

a

For each transgenic line, where multiple mice were examined, the CAT activity is shown as the mean activity for that line. The means from lines harboring either the pt[2187/122]E1a-CAT or pt[23000/122]E1a-CAT were then grouped, and the means 6 SEM for the respective groups were calculated. b Expressed as arbitrary units calculated as the percent conversion of chloramphenicol per hour per microgram of protein.

lanes c and d), correlating well with previous Northern blot hybridization data on the expression of Pdha-2 (19). No protection was observed with liver RNA prepared from adult transgenic mice (Fig. 3A, lane e) or from testis RNA prepared from control mice (Fig. 3A, lane b), confirming our previous data. In conclusion, our results demonstrate that all of the necessary elements responsible for conferring testis- and timespecific expression reside between positions 2187 and 122 of the Pdha-2 core promoter. Inclusion of sequences upstream of the core promoter augments testis-specific expression in vivo. Our data so far indicate that the core promoter is sufficient for directing expression in both a tissue- and a stage-specific manner. To investigate to what extent sequences upstream of nucleotide position 2187 contribute to the regulation of Pdha-2 in vivo, we generated transgenic mice harboring pt[23000/122]E1aCAT. CAT activities in testes from several lines of transgenic

TABLE 2. CAT activities in tissues of control and transgenic mice carrying either pt[2187/122]E1a-CAT or pt[23000/122]E1a-CAT CAT activity (mean 6 SEM)a Tissue

Testis Liver Spleen Kidney Heart Brain

Control

pt[2187/122] E1a-CAT

pt[23000/122] E1a-CAT

0.12 6 0.04 (7) 0.25 6 0.001 (3) 0.17 6 0.06 (3) 0.21 6 0.03 (3) 0.16 6 0.04 (3) 0.18 6 0.05 (3)

2.24 6 1.30 (16) 0.37 6 0.13 (5) 0.19 6 0.05 (5) 0.27 6 0.07 (5) 0.25 6 0.05 (5) 0.21 6 0.05 (5)

18.48 6 7.80 (10) 0.11 6 0.02 (5) 0.15 6 0.05 (5) 0.17 6 0.04 (5) 0.22 6 0.10 (5) 0.17 6 0.05 (5)

a Expressed as arbitrary units calculated as the percent conversion of chloramphenicol per hour per microgram of protein. Numbers in parentheses show the number of mice used for each determination. All transgenic mice lines are represented. For somatic tissue, one transgenic mouse from each line was assayed. For testis, every transgenic mouse from each line was assayed.

mice were measured and compared with those in testes of both nontransgenic mice and mice carrying the pt[2187/122]E1aCAT construct (Table 1). With the exception of lines 14 and 22, which exhibit moderate activity, all other transgenic lines carrying pt[23000/122]E1a-CAT display high levels of CAT activity. As expected, the 3.0-kb promoter also directs reporter gene activity in a testis-specific manner, with testes from transgenic mice exhibiting 84- to 168-fold-higher CAT activity than somatic tissue (Table 2). In addition, the level of CAT activity directed by the 3.0-kb promoter is at least eightfold higher than the activity directed by the core promoter (Table 2). Testis specificity was also confirmed by RNase protection assays, as was the ability of the 3.0-kb promoter to direct expression in a temporal stage-specific manner. Results represented in Fig. 3B show protection of CAT mRNA in testis RNA prepared from a 30-day-old transgenic mouse but not in liver RNA prepared from the same mouse or in RNA prepared from the testis of a nontransgenic mouse. Furthermore, CAT mRNA was not detectable in 8-day-old transgenic mouse testis, correlating well with previous Northern blot hybridization data showing no detectable levels of Pdha-2 expression in 8-day-old mouse testis but significant levels of expression by 30 days (19). In vitro analysis of the Pdha-2 promoter reveals a constitutively active core promoter. Data from our in vivo studies as well as observations made from the pattern of endogenous Pdha-2 expression (19) indicate that the Pdha-2 promoter functions as a testis-specific promoter. However, in vitro, the Pdha-2 core promoter was previously found to be highly active when transiently transfected in somatic cell lines such as HeLa (20). One possible explanation is that regulatory constraints which govern the transcriptional repression of the endogenous gene in somatic cells do not operate on the transgene when introduced into the same cells following transient transfection. A remote but alternative possibility is that potential speciesspecific differences account for this result, since previous studies were carried out with human cell lines. To distinguish between these possibilities, we transiently transfected a number of Pdha-2 promoter deletion constructs (Fig. 1) into mouse NIH 3T3 cells and assayed their abilities to direct expression of the CAT gene. As in the previous study (20), the core promoter construct (pt[2187/122]E1a-CAT) was the most active


VOL. 17, 1997

615

FIG. 3. (A) Representative RNase protection assay performed on total testis RNA obtained from the transgenic mouse line which harbors the pt[2187/122]E1aCAT construct. Lanes: a, DNA molecular weight markers (positions are indicated in nucleotides); b to e, total RNA from 30-day-old control mouse testis, 13-day-old transgenic mouse testis, 30-day-old transgenic mouse testis, and 30-day-old transgenic mouse liver. The protected fragments for CAT and b2-microglobulin (b2MG) are indicated. (B) Representative RNase protection assay performed on total testis RNA obtained from a transgenic mouse line which harbors the pt[23000/122]E1aCAT construct. Lanes: a, DNA molecular weight markers; b to e, total RNA from 8-day-old transgenic mouse testis, 30-day-old transgenic mouse testis, 30-day-old transgenic mouse liver, and 30-day-old control mouse testis. The protected fragments for CAT and b2-microglobulin are indicated.

of all constructs tested (Table 3). Inclusion of sequences upstream of position 2187 resulted in a reduction in activity, with two regions exhibiting repressor-like activity. The first was observed with pt[2368/122]E1a-CAT, in which an additional 181 nucleotides upstream of position 2187 resulted in an approximately 54% reduction in activity. No further change was observed when pt[21000/122]E1a-CAT was used. However, an approximately 90% decrease in CAT activity was seen when a construct containing 3.0 kb of the Pdha-2 promoter/upstream sequences was tested. Our results demonstrate that the transiently transfected core promoter is constitutively expressed in vitro. This result appeared inconsistent with the in vivo data since endogenous Pdha-2 expression is strictly testis specific, as is the CAT reporter gene activity directed by the core promoter in our transgenic mice. To reconcile this apparent paradox, we investigated the possibility that integration of the transgene into the genome is required for correct promoter function. Analysis of NIH 3T3 cell lines containing stably transfected pt[2187/122] E1a-CAT shows that seven of the eight clones isolated exhibit various levels of CAT activity (Fig. 4). This result demonstrates that genomic integration alone is not sufficient to restore the

appropriate cues for conferring correct tissue specificity to the core promoter and that other mechanisms of regulation are required. CpG methylation represses the Pdha-2 core promoter activity in somatic cells in vitro. Analysis of the sequences residing within the core promoter revealed several CpG dinucleotides. To investigate this further, the in vivo cytosine methylation patterns of both the endogenous and the stably transfected Pdha-2 core promoters were analyzed following sulfonation and deamination (10) of genomic DNA isolated from one of our stably transfected NIH 3T3 cells clones. Under appropriate conditions, bisulfite-induced modification of genomic DNA results in cytosine being converted to uracil, but 5-methylcytosine remains unreactive. Following PCR amplification and sequencing of the region of interest, all uracil and thymine residues are amplified and appear as thymine, whereas only 5-methylcytosine residues are amplified as cytosine. Figure 5 shows the results of the sequence analysis of both promoters in a region encompassing nucleotide positions 2182 to 122 following sodium bisulfite treatment. The results show the analysis of only one strand. The pattern of the homologous strand has been determined and found to be equivalent (data not shown). Analysis of our data indicates that all of the CpG

TABLE 3. CAT activities in mouse NIH 3T3 cells transiently transfected with various Pdha-2 promoter deletion constructs and the promoterless reporter construct, pCAT Basic Construct

CAT activity (mean 6 SEM)a

% Relative activityb

pt[2187/122]E1a-CAT pt[2368/122]E1a-CAT pt[21000/122]E1a-CAT pt[23000/122]E1a-CAT pCAT Basic

2.34 6 0.43 1.21 6 0.20 1.37 6 0.50 0.51 6 0.17 0.23 6 0.04

100.0 46.4 54.0 13.2

a Expressed as arbitrary units calculated as the percent conversion of chloramphenicol per hour per percent extract. b CAT activity adjusted for background activity (measured by using pCAT Basic) and then expressed as a percent activity relative to that of pt[2187/ 122]E1a-CAT.

FIG. 4. Representative CAT assay performed on a number of NIH 3T3 cell line clones which have been stably transfected with pt[2187/122]E1a-CAT. Stable cell clones are individually numbered.

616

IANNELLO ET AL.

FIG. 5. Nucleotide sequence of PCR-amplified Pdha-2 core promoter from sodium bisulfite-treated genomic DNA isolated from an NIH 3T3 cell line clone stably transfected with pt[2187/122]E1a-CAT. The endogenous promoter fragment is designated Pdha-2; the promoter fragment from the transfected construct is designated pE1a-CAT. In this experiment, methylated cytosine residues appear as guanines following PCR amplification and sequencing of this DNA strand. Note the disappearance of the guanine residues in pE1a-CAT and the appearance of adenine residues indicating that the cytosines within the transfected core promoter are unmethylated.

dinucleotides present in the endogenous core promoter are methylated, whereas those present in the transfected Pdha-2 core promoter are not (Table 4). To establish a correlation between the methylation status of the endogenous promoter and Pdha-2 expression, we monitored the patterns of both in mice. In whole testes from 10day-old mice, the endogenous promoter was predominately hypermethylated and not expressed in detectable amounts (Table 4). Hypermethylation of the promoter was also observed in spermatogonia and in the spermatids and somatic tissue of

MOL. CELL. BIOL.

adult mice. With the exception of spermatids, no detectable level of Pdha-2 was observed. In spermatids, it is unclear whether the message detected in these cells represents stored message derived from pachytene precursors or transcribed from an active promoter. By contrast, the endogenous promoter was found to be hypomethylated in pachytene spermatocytes, where Pdha-2 expression is high. Examination of both the endogenous and the transgene core promoters in 30-dayold transgenic mice showed that they exhibited the same pattern of expression and methylation status (Table 4). To gain some functional insight as to whether methylation of the CpG dinucleotides in the Pdha-2 core promoter could culminate in the in vitro repression of its activity, we treated the pt[2187/122]E1a-CAT construct with SssI methylase (26) and compared it with a control CAT reporter construct driven by the simian virus (SV40) promoter (Fig. 6). These constructs were transiently transfected into cell lines, and cell lysates were prepared 48 h following transfection. Results of these experiments demonstrate that CAT activity directed by the core promoter is not only significantly reduced following methylase treatment but also more sensitive to methylation effects compared with the SV40 promoter (Fig. 6B). Increasing the concentration of S-adenosylmethionine in the assay from 4.8 to 160 mM results in the reduction of CAT activity to approximately 20% of that seen with the untreated pt[2187/122]E1aCAT construct (Fig. 6A). The ATF/CRE binding site is a target for methylation effects. Within the Pdha-2 promoter, a number of CpG dinucleotides are found centered within and around transcription factor binding sites. Therefore, a possible mechanism by which methylation may confer repression is through potential inhibition of binding of transcription factors to their cognate sites. In these studies, the Pdha-2 core promoter was methylated by SssI methylase and compared to an untreated control in a DNase I footprint assay using adult testis nuclear extracts (Fig. 7A). Our results show that methylation of CpG dinucleotides perturbs binding of a factor(s) to the ATF/CRE binding site, whereas the Sp1, YY1, and the MEP-2 binding sites are unaffected. Interestingly, a hypersensitive site located between the ATF/CRE and MEP-2 binding sites is lost following methylation of the core promoter. The hypersensitive site lies within a pair of CpG dinucleotides, suggesting that methylation also affects the conformational organization of the promoter. It would therefore seem reasonable to suggest that methylation may contribute to the silencing of the Pdha-2 promoter in two ways: first, in blocking binding of factors to the ATF/CRE site, and second, by inhibiting protein-protein cooperativity of transcription factors through conformational changes in the core promoter. To gauge the contribution of the ATF/CRE binding site to promoter activity, we directly measured the effects of perturbing this site by generating mutations which destroyed the consensus ATF/CRE binding element. This construct was transfected into NIH 3T3 cells, and promoter activity was compared with that of the wild type. As shown in Fig. 7B, ablating the ATF/CRE binding site results in an approximately 50% reduction in CAT activity. Therefore, inaccessibility of ATF/ CRE factors to this site together with additional effects of methylation may account for the silencing of Pdha-2 in somatic tissue. These results suggest a strong functional correlation between transcriptional inactivity and CpG methylation of the Pdha-2 promoter. DISCUSSION Central to our understanding of the process of germ cell differentiation in testis is the elucidation of the mechanisms by


VOL. 17, 1997

617

TABLE 4. Methylation and activation status of the Pdha-2 promoter under various conditions and in various cell types Pdha-2 promoter (cell type[s])

pt[2187/122]CATc (NIH 3T3 and F9 cells) Methylated pt[2187/122]CATd (NIH 3T3 or F9 cells) Endogenous Pdha-2 promoter NIH 3T3 or F9 cells 10-day-old mouse testis 30-day-old mouse testis Transgenic Pdha-2 promoter (30-day-old mouse testis) Endogenous Pdha-2 promoter (30-day-old mouse somatic tissue) Transgenic Pdha-2 promoter (30-day-old mouse somatic tissue) Endogenous Pdha-2 promoter Spermatogonia Pachytene spermatocytes Spermatids

Methylation status of Pdha-2 promotera

Activation statusb

Hypomethylated Hypermethylated

Active Repressed

Hypermethylated $70% hypermethylatede 100% hypomethylated 100% hypomethylated 100% hypermethylated 100% hypermethylated

Repressed Repressed Active Active Repressed Repressed

$60% hypomethylated f Hypomethylated Hypermethylated

Repressed Active ND

a

Methylation status of the promoter as assayed by the sodium bisulfite procedure described in Materials and Methods. Activation status of the Pdha-2 promoter as measured either by CAT assays (for the reporter gene) or by Northern blot analysis (for endogenous Pdha-2). ND, not determined. c The core Pdha-2 promoter construct either stably or transiently transfected in NIH 3T3 and F9 cells. d The core Pdha-2 promoter construct methylated in vitro by treatment with SssI methylase followed by transfection in NIH 3T3 and F9 cells as described in Materials and Methods. e The percentage of Pdha-2 core promoters analyzed which were found to be hypermethylated from a mixed population of cells derived from 10-day-old mouse testis. f The percentage of Pdha-2 core promoters analyzed which were found to be hypomethylated from a spermatogonium-enriched population of cells derived from 10-day-old mouse testis. b

which spermatogenesis-specific genes are coordinately and temporally regulated during spermatogenesis. To define some of these mechanisms, we have focused on the events governing the regulation of Pdha-2, a gene which is expressed during the meiotic prophase stage of spermatogenesis. In this study, an in vivo analysis of this gene’s promoter through the generation of transgenic mice demonstrated that the cis-regulatory elements between nucleotide positions 2187 and 122 are sufficient for directing expression in a tissue- and time-specific manner. Enhanced activity was also observed when sequences upstream of nucleotide position 2187 were present. An earlier analysis of potential transcription factor binding sites within the core promoter by DNase I footprinting assays revealed four regions rich in nuclear protein binding activity spanning nucleotide positions 290 to 11 (20). These regions contain binding sites for Sp1, ATF/CREB, YY1, and as yet an undefined transcription factor(s), MEP-2, which interacts with a testis-specific binding complex. Interestingly, the appearance of this complex coincides with the temporal appearance of both pachytene spermatocytes and Pdha-2 expression and therefore may be important in defining the temporal regulation of Pdha-2 in vivo. Analysis of the Pdha-2 core promoter in vitro led to an unexpected observation. It has been established that expression of Pdha-2 is repressed in both somatic tissues and somatic cell lines (19, 20). Similarly, we have shown that the Pdha-2 core promoter drives the expression of the CAT reporter gene in transgenic mice in a manner comparable to the endogenous Pdha-2 pattern of expression. However, when introduced in vitro into somatic cell lines such as NIH 3T3 cells, the Pdha-2 core promoter directed high levels of reporter gene activity. Furthermore, this occurred irrespective of whether the transgene was introduced in a stable or a transient fashion. Since a strong correlation exists between transcriptional activity and the methylation status of other testis-specific genes (1, 2, 6a), we investigated the methylation patterns of both the endogenous and transfected Pdha-2 promoters in our stable cell lines. The core promoter sequences encompassing nucleotide positions 2182 to 122 contain eight CpG dinucleotides. Our analysis demonstrated that all of these sites were methylated in the

endogenous Pdha-2 promoter, whereas the transfected promoter showed no evidence of CpG methylation. Furthermore, a strong correlation existed between the methylation status of the Pdha-2 promoter (both endogenous and transgene) and the expression profiles of either Pdha-2 or the CAT reporter gene in transgenic mice. Evidence that methylation may be a functional mechanism for repression was derived from data

FIG. 6. (A) Histogram showing the relative CAT activities in F9 cell lysates following transfection with either pt[2187/122]E1a-CAT preincubated with SssI methylase reaction buffer only (a) or pt[2187/122]E1a-CAT treated with SssI methylase and 160 mM S-adenosylmethionine (b). (B) Histogram showing the relative CAT activities in F9 cell lysates following transfection with either pt [2187/122]E1a-CAT (a) or pCAT-Control (an SV40 promoter-driven CAT reporter gene construct; Promega) (b). Constructs were treated either in the absence or in the presence of SssI methylase and 4.8 mM S-adenosylmethionine (SAM).

618

IANNELLO ET AL.

FIG. 7. (A) DNase I footprinting of the Pdha-2 core promoter, using testis nuclear extracts. Analysis was performed on either an untreated or an SssItreated PCR-generated promoter probe. Lanes: a, untreated naked DNA; b, SssI-treated naked DNA; c, untreated DNA incubated with testis nuclear extract; d, SssI-treated DNA incubated with testis nuclear extract. Vertical bars represent protected regions. The sequence surrounding the ATF/CRE binding site is shown. CpG dinucleotides are underlined, and those residing within the hypersensitive site are indicated by arrows. The hypersensitive site is indicated by an asterisk. (B) Histogram showing CAT activities assayed from cell lysates prepared from NIH 3T3 cells transfected with pCAT-Control (a), pQDATF (b), and pt[2187/122]E1a-CAT (c) promoter constructs. CAT activities are expressed as percentage activities relative to pt[2187/122]E1a-CAT and are indicated in parentheses as the mean 6 SEM calculated for eight separate transfections.

obtained from in vitro assays in which the Pdha-2 core promoter was methylated in vitro and then introduced into F9 cells. In those experiments, activity of the Pdha-2 core promoter was preferentially and significantly reduced. These studies demonstrate that CpG methylation is capable of overriding transcription factor-mediated activation of the Pdha-2 promoter and suggest that it may have a functional role in vivo, in conferring tissue specificity through the transcriptional repres-

MOL. CELL. BIOL.

sion of Pdha-2 in somatic tissue. To investigate this further, we are currently generating transgenic mice that harbor the Pdha-2 core promoter containing CpG mutations. Although the mode of action by which CpG methylation confers inactivity to the Pdha-2 promoter in vivo is uncertain, one possibility is that it alters the conformational arrangement of DNA by increasing the helical pitch of DNA (16), thereby affecting transcription factor binding to its cognate site. This suggestion is consistent with our DNase I footprinting data, which showed that CpG methylation both specifically blocked ATF/CRE binding to the Pdha-2 core promoter and abolished a hypersensitive site located within a region containing a pair of CpG dinucleotides. The significance of abolishing transcription factor binding to the ATF/CRE site can be demonstrated by the introduction of an ATF/CRE mutation into the Pdha-2 promoter. Disruption of the ATF/CRE site resulted in a significant reduction in Pdha-2 promoter activity. While the mutation of the ATF/CRE site represents a local perturbation, the effects of methylation along the length of the promoter would have a more broad effect, including conformational alterations in the DNA. In vivo, this site-specific and broad effect of methylation on the Pdha-2 promoter may be responsible for its silencing in somatic tissue. During spermatogenesis, the pattern of CpG methylation in the Pdha-2 promoter varied according to the spermatogenic cell type. We have shown that in pachytene spermatocytes, the Pdha-2 promoter is hypomethylated, correlating well with the observed levels of Pdha-2 expression seen in this cell type. In 10-day-old mouse testis, 30% of the total Pdha-2 core promoter fragments analyzed were shown to be hypomethylated. However, Pdha-2 expression is absent or not detectable at this stage (19). The cells from which the hypomethylated promoter was derived appear to be spermatogonia. An analysis of an enriched spermatogonial cell fraction indicated that in these cells, approximately 60% of all Pdha-2 core promoter fragments appeared in the hypomethylated state. Since significant levels of Pdha-2 expression are not detected until after spermatogonia differentiate into pachytene spermatocytes, our data suggest that hypomethylation alone is not sufficient to activate the promoter but may be required as an event prior to Pdha-2 expression. The notion that hypomethylation precedes transcription is in agreement with a recent study that demonstrated that demethylation of other testis-specific genes, including Pgk-2, occurred at the time of birth in prespermatogonia, well before the onset of transcription (2). Therefore, one model for gene activation during spermatogenesis may involve both hypomethylation and the availability of specific transcription factors. In a previous study, we identified a factor which bound to the MEP-2 cis element in the Pdha-2 promoter (20). This factor forms a testis-specific protein-DNA complex, and its appearance correlates with the initial appearance of Pdha-2 in testis. Hypomethylation may be an essential step prior to the availability of transcription factors (Sp1, YY1, MEP-2 binding factor, and ATF/CRE factors) in order for Pdha-2 expression to occur. In conclusion, methylation appears to be an important mechanism by which transcriptional repression of Pdha-2 in somatic tissue is achieved. Activation of testis-specific genes, in particular those which are temporally expressed during spermatogenesis, such as Pdha-2, is likely to require various of levels of regulation such as hypomethylation, DNA conformational alterations, and accessibility or availability of specific transcription factors. We are currently addressing these issues through a number of studies involving the generation of transgenic mice harboring functionally active but methylation-in-


VOL. 17, 1997

sensitive Pdha-2 promoter constructs created through mutations of various CpG dinucleotides. ACKNOWLEDGMENTS We thank Wendy Hutchison for technical assistance. This project was supported partly by grants from the National Health and Medical Research Committee and the Australian Research Council. R.C.I. and J.Y. contributed equally to this work. REFERENCES 1. Ariel, M., J. McCarrey, and H. Cedar. 1991. Methylation patterns of testisspecific genes. Proc. Natl. Acad. Sci. USA 88:2317–2323. 2. Ariel, M., H. Cedar, and J. McCarrey. 1994. Developmental changes in methylation of spermatogenesis-specific genes include reprogramming in the epididymis. Nat. Genet. 7:59–63. 3. Brown, R. M., H. Dahl, and G. K. Brown. 1990. Pyruvate dehydrogenase E1 alpha subunit genes in the mouse: mapping and comparison with human homologs. Somatic Cell Mol. Genet. 16:487–492. 4. Brown, R. M., H. H. Dahl, and G. K. Brown. 1989. X-chromosome localization of the functional gene for the E1 alpha subunit of the human pyruvate dehydrogenase complex. Genomics 4:174–181. 5. Bucci, L. R., W. A. Brock, T. S. Johnson, and M. L. Meistrich. 1986. Isolation and biochemical studies of enriched populations of spermatogonia and early primary spermatocytes from rat testes. Biol. Reprod. 34:195–206. 6. Bunick, D., P. A. Johnson, T. R. Johnson, and N. B. Hecht. 1990. Transcription of the testis-specific mouse protamine 2 gene in a homologous in vitro transcription system. Proc. Natl. Acad. Sci. USA 87:891–895. 6a.Choi, Y. C., and C. B. Chae. 1991. DNA hypomethylation and germ cellspecific expression of testis-specific H2B histone gene. J. Biol. Chem. 266: 20504–20511. 7. Chomczynski, P., and N. Sacchi. 1987. Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159. 8. Dahl, H., R. M. Brown, W. M. Hutchison, C. Maragos, and G. K. Brown. 1990. A testis-specific form of the human pyruvate dehydrogenase E1 alpha subunit is coded for by an intronless gene on chromosome 4. Genomics 8:225–232. 9. Foulkes, N. S., B. Mellstrom, E. Benusiglio, and P. Sassone-Corsi. 1992. Developmental switch of CREM function during spermatogenesis: from antagonist to activator. Nature 355:80–84. 10. Frommer, M., L. E. McDonald, D. S. Miller, C. M. Collins, F. Watt, G. W. Grigg, P. L. Molloy, and C. L. Paul. 1992. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA 89:1827–1831. 11. Gebara, M. M., and J. R. McCarrey. 1992. protein-DNA interactions associated with the onset of testis-specific expression of the mammalian Pgk-2 gene. Mol. Cell. Biol. 12:1422–1431. 12. Goldsborough, A., A. Ashworth, and K. Willison. 1990. Cloning and sequencing of POU-boxes expressed in mouse testis. Nucleic Acids Res. 18:1634. 13. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044–1051. 14. Goto, M., T. Tamura, K. Mikoshiba, Y. Masamune, and Y. Nakanishi. 1991. Transcription inhibition of the somatic-type phosphoglycerate kinase 1 gene in vitro by a testis-specific factor that recognizes a sequence similar to the binding site for Ets oncoproteins. Nucleic Acids Res. 19:3959–3963.

619

15. Grimes, S. R., S. A. Wolfe, and D. A. Koppel. 1992. Tissue-specific binding of testis nuclear proteins to a sequence element within the promoter of the testis-specific histone H1t gene. Arch. Biochem. Biophys. 296:402–409. 16. Gruenbaum, Y., H. Cedar, and A. Razin. 1982. Substrate and sequence specificity of a eukaryotic DNA methylase. Nature 295:620–622. 17. Hogan, B., F. Constantini, and E. Lacy. 1986. Manipulating the mouse embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 18. Iannello, R. C. 1995. DNase I footprinting using PCR-generated end-labeled DNA probes. Methods Mol. Biol. 37:379–391. 19. Iannello, R. C., and H.-H. M. Dahl. 1992. Transcriptional expression of a testis-specific variant of the mouse pyruvate dehydrogenase E1 alpha subunit. Biol. Reprod. 47:48–58. 20. Iannello, R. C., I. Kola, and H. H.-M. Dahl. 1993. Temporal and tissuespecific interactions involving novel transcription factors and the proximal promoter of the mouse Pdha-2 gene. J. Biol. Chem. 268:22581–22590. 21. Johnson, P. A., D. Bunick, and N. B. Hecht. 1991. Protein binding regions in the mouse and rat protamine-2 genes. Biol. Reprod. 44:127–134. 22. Lim, K., and C.-B. Chae. 1992. Presence of a repressor protein for testisspecific H2B (TH2B) histone gene in early stages of spermatogenesis. J. Biol. Chem. 267:15271–15273. 23. Maragos, C., W. M. Hutchison, K. Hayasaka, G. K. Brown, and H. H. Dahl. 1989. Structural organization of the gene for the E1 alpha subunit of the human pyruvate dehydrogenase complex. J. Biol. Chem. 264:12294–12298. 24. Nayernia, K., E. Burkhardt, S. Beimesche, S. Keime, and W. Engel. 1992. Germ cell-specific expression of a proacrosin-CAT fusion gene in transgenic mouse testis. Mol. Reprod. Dev. 31:241–248. 25. Nelki, D., K. Dudley, P. Cunningham, and M. Akhavan. 1990. Cloning and sequencing of a zinc finger cDNA expressed in mouse testis. Nucleic Acids Res. 18:3655. 26. Ngoˆ, V. M., J. N. Laverriere, and D. Gourdji. 1995. CpG methylation represses the activity of the rat prolactin promoter in rat GH3 pituitary cell lines. Mol. Cell. Endocrinol. 1085:95–105. 27. Peschon, J. J., R. R. Behringer, R. L. Brinster, and R. D. Palmiter. 1987. Spermatid-specific expression of protamine 1 in transgenic mice. Proc. Natl. Acad. Sci. USA 84:5316–5319. 28. Reed, L. J., and S. J. Yeaman. 1987. Pyruvate dehydrogenase, p. 77–95. In P. D. Boyer and E. G. Krebs (ed.), The enzymes, vol. 18. Academic Press, New York. 29. Robinson, M. O., J. R. McCarrey, and M. I. Simon. 1989. Transcriptional regulatory regions of testis-specific PGK2 defined in transgenic mice. Proc. Natl. Acad. Sci. USA 86:8437–8441. 30. Romrell, L. J., A. R. Bellve, and D. W. Fawcett. 1976. Separation of mouse spermatogenic cells by sedimentation velocity. A morphological characterization. Dev. Biol. 49:119–131. 31. Stewart, T. A., N. B. Hecht, P. G. Hollingshead, P. A. Johnson, J. C. Leong, and S. L. Pitts. 1988. Haploid-specific transcription of protamine-myc and protamine-T-antigen fusion genes in transgenic mice. Mol. Cell. Biol. 8:1748–1755. 32. Takakubo, F., and H. H. Dahl. 1992. The expression pattern of the pyruvate dehydrogenase E1 alpha subunit genes during spermatogenesis in adult mouse. Exp. Cell Res. 199:39–49. 33. Tamura, T., Y. Makino, K. Mikoshiba, and M. Muramatsu. 1992. Demonstration of a testis-specific trans-acting factor Tet-1 in vitro that binds to the promoter of the mouse protamine 1 gene. J. Biol. Chem. 267:4327–4332. 34. Tymms, M. J. 1995. Quantitative measurement of mRNA using the RNase protection assay. Methods Mol. Biol. 37:31–46. 35. Widen, S. G., and S. H. Wilson. 1991. Mammalian beta-polymerase promoter: large-scale purification and properties of ATF/CREB palindrome binding protein from bovine testes. Biochemistry 30:6296–305.