The FASEB Journal • Research Communication
Regulation of phosphoglucose isomerase/autocrine motility factor expression by hypoxia Tatsuyoshi Funasaka, Takashi Yanagawa, Victor Hogan, and Avraham Raz1 Tumor Progression and Metastasis Program, Barbara Ann Karmanos Cancer Institute, Wayne State University, School of Medicine, Detroit, Michigan, USA Phosphoglucose isomerase (PGI; EC 5.3.1.9) is a housekeeping cytosolic enzyme of the sugar metabolism pathways that plays a key role in glycolysis and gluconeogenesis. PGI is a multifunctional dimeric protein that extracellularly acts as a cytokine with properties that include autocrine motility factor (AMF) eliciting mitogenic, motogenic, differentiation functions and has been implicated in tumor progression and metastasis. Since metastasis is regulated in part by hypoxia, which induces the transcription of metastasisassociated genes and anaerobic glycolic metabolism, we questioned whether hypoxia also regulates the expression level of tumor cells’ PGI/AMF. We establish here that in the human breast carcinoma BT-549 cells hypoxia enhanced expression of the transcription factor hypoxia-inducible factor (HIF) -1, which in turn led to the up-regulation of PGI/AMF expression and was specifically inhibited by inhibitors of the phosphatidylinositol 3ⴕ-kinase signaling pathway. In addition, the hypoxia induction of PGI/AMF expression was suppressed by inhibitors of vascular endothelial growth factor (VEGF) or VEGF receptors, suggesting that hypoxia-inducible VEGF regulates the PGI/AMF expression. Hypoxia also enhanced cancer cell motility, and these effects were strongly inhibited by the PGI/ AMF, VEGF, or VEGF receptor inhibitors. The results presented here suggest that under hypoxic conditions the expression of PGI/AMF is regulated in part by the HIF pathway, which in turn increases the flow of the glycolytic cascade leading to an increased anaerobic energy generation; thus, inhibition of PGI/AMF expression and activities may provide a new therapeutic modality for treatment of hypoxic tumors.—Funasaka, T., Yanagawa, T., Hogan, V., Raz, A. Regulation of phosphoglucose isomerase/autocrine motility factor expression by hypoxia. FASEB J. 19, 1422–1430 (2005)
ABSTRACT
Key Words: hypoxia-inducible factor-1 䡠 phosphoglucose isomerase 䡠 VEGF
Hypoxia, a reduction in tissue oxygen levels, is detected in several pathophysiological processes including ischemia, pulmonary diseases, and cancer. Tumor hypoxia is an important indicator for cancer prognosis as it contributes to tumor progression and a poor response to therapeutic modalities like radiation and 1422
chemotherapy (1). Aggressive tumors often lack sufficient blood supply due to their rapid expansion resulting in hypoxic stress, which in turn stimulates the generation of new blood vessel formation (i.e., angiogenesis/neovascularization, which provide the gateway for invading tumor cells to disseminate throughout the body) (2). Hypoxia triggers cellular responses, including resistance to apoptosis, erythropoiesis, and glycolysis. Most if not all are regulated by the transcriptional hypoxia-inducible factor 1␣ (HIF-1␣; 1, 2). HIF-1␣ regulates changes in gene expression in response to changes in the cellular oxygen level. In a normoxic environment, HIF-1␣ is extremely unstable and quickly degraded through the ubiquitin-proteasome pathway (3) while hypoxic conditions signal its translocation to the nucleus, where it binds to the promoter and enhancer regions of target genes containing hypoxia response elements (HREs), leading to their transcriptional activation (2). Among the promoters and enhancers are those encoding for the glycolytic enzymes that facilitate anaerobic energy generation (4). Hypoxia stimulates the expression of glucose transporter 1, hexokinase, phosphofructokinase, glyceraldehydes-3-phosphate dehydrogenase, and phosphoglycerate kinase (PGK) (1, 2, 5–7). The increased expression of genes encoding glycolytic enzymes is necessary for adaptation to hypoxia (8). Of note, PGK is a secreted protein exhibiting a different function extracellularly whereby it acts as disulfide reductase that facilitates the cleavage of disulfide bonds in plasmin and triggers proteolytic release of the angiogenesis inhibitor, angiostatin (6). Phosphoglucose isomerase (PGI; EC 5.3.1.9) is a housekeeping cytosolic enzyme of sugar metabolism that plays a key role in both glycolysis and gluconeogenesis pathways, catalyzing the interconversion of glucose 6-phosphate and fructose 6-phosphate (9); extracellularly it behaves as a cytokine. Molecular cloning and sequencing have identified PGI as an AMF (10). AMF is originally identified as a major cell motilitystimulating factor associated with cancer development and progression (11). Independently, PGI was found to 1
Correspondence: Tumor Progression and Metastasis Program, Barbara Ann Karmanos Cancer Institute, 110 East Warren Ave., Detroit, MI 48201, USA. E-mail:
[email protected] doi: 10.1096/fj.05-3699com 0892-6638/05/0019-1422 © FASEB
be a neuroleukin promoting growth of embryonic spinal and sensory neurons (12), maturation factor mediating differentiation of human myeloid leukemia cells (13), sperm antigen-36 (14), and myofibril-bound serine proteinase inhibitor (15). Aberrations in expression or activities of PGI due to mutations or deletions are of significant clinical importance since in humans they are associated with hereditary nonspherocytic hemolytic anemia diseases (16, 17). In addition, PGI/ AMF is an antigen of arthritis disease (18), and its presence in the serum and urine is of prognostic value associated with cancer progression (19 –21). In contrast to normal cells, tumor cells need glycolysis; the enhanced glycolysis is caused by oncogenic signals, like an activation of Akt and Myc, and microenvironmental hypoxia (8). Moreover, the molecular mechanisms of the versatile abilities of glycolytic enzymes have been poorly understood, especially the functional relationship between their glycolytic and nonglycolytic roles. Thus, we questioned whether PGI/AMF is an oxygenregulated gene similar to its upstream and downstream glycolytic enzymes hexokinase and phosphofructokinase, respectively. Recently it was suggested that the expression of PGI/AMF mRNA is up-regulated in some tumor cells by hypoxia and that hypoxia-induced PGI/ AMF mRNA expression was mediated in part by HIF-1␣ (21–23). However, so far no direct studies of the effect of hypoxia on PGI/AMF expression or function have been reported and, in contrast to other enzymes of the glycolytic pathway, little is known regarding the possible regulation of PGI/AMF expression by hypoxia. To this end, we systematically characterized the effects of hypoxia on PGI/AMF expression and addressed the question of whether HIF-1␣ regulated PGI/AMF expression or vice versa.
MATERIALS AND METHODS
Cell culture and hypoxic treatment Human colon cancer cell line HCT-116 (ATCC CCL-247), human bladder cancer cell line J82 (ATCC HTB-1), and human fibrosarcoma HT-1080 (ATCC CCL-121) were purchased from the American Type Culture Collection (Manassas, VA, USA). Human prostate cancer cell line LnCAP was purchased from Urocor, Inc. (Oklahoma City, OK, USA). Human prostate cancer cell line PC-3 was kindly provided from Dr. Isaiah J. Fidler (The University of Texas M. D. Anderson Cancer Center, Houston, TX, USA). Human breast cancer cell lines BT-549 and MDA-MB-468 were kindly provided from Dr. Erik W. Thompson (Vincent T. Lombardi Cancer Research Center, Georgetown University Medical Center, Washington, D.C., USA). Human breast cancer cell line MCF-7 was obtained from the Cell Core, Karmanos Cancer Foundation (Detroit, MI, USA). HCT-116, LnCAP, and PC-3 cells were cultured in RPMI 1640 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and penicillin/streptomycin (Invitrogen). BT-549, MCF-7, MDA-MB-468, J82, and HT-1080 were cultured in DMEM (Invitrogen) with 10% FBS and penicillin/streptomycin. All cell lines were maintained at 37°C in an air/5% CO2 incubator. Hypoxic exposure was carried out under 1% oxygen, 5% CO2, and 94% nitrogen for 16 h. Before normoxic or hypoxic exposure, cells were washed with phosphate-buffered saline (PBS), and fresh medium was added. RNA interference To design specific small interfering RNA (siRNA) targeting HIF-1␣, the target sequence of the human HIF-1␣ gene was selected using siRNA Target Finder available at http:// www.ambion.com. The siRNA duplexes targeting HIF-1␣ were synthesized by Dharmacon, Inc. (Lafayette, CO, USA). Twenty-four hours after inoculation of cells, siRNA duplex transfection was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. The target sequence for the HIF-1␣ siRNA was 5⬘-AACUGAUGACCAGCAACUUGA-3⬘, and for the firefly (Photinus pyralis) luciferase (GL3) as a control was 5⬘-AACUUACGUGAGUACUUCGA-3⬘ (26). The specificity of the sequence was verified by a BLAST search of the public databases.
Reagents and antibodies
Reverse-transcription polymerase chain reaction (RT-PCR) analysis
Cobalt chloride (CoCl2), desferrioxamine (DFO), LY294002, PD98059, and SB203580 were obtained from Sigma (St. Louis, MO, USA). SU1498 (selective inhibitor of Flk-1 kinase), 4-[(4⬘-chloro-2⬘-fluoro) phenylamino]-6,7-dimethoxyquinazoline (inhibitor of Flt-1 and Flk-1), and anti-histone antibodies were obtained from Calbiochem (La Jolla, CA, USA). Type IV collagen, YC-1 [3-(5⬘-hydroxymethyl-2⬘-furyl)1-benzylindazole], and anti--actin antibodies were from Sigma. Monoclonal antibody against HIF-1␣ (H1␣67) was from Novus Biologicals (Littleton, CO, USA). Recombinant human VEGF165 and neutralizing antibody directed against human VEGF were purchased from R&D Systems (Minneapolis, MN, USA). Horseradish peroxidase (HRP)- or fluorescein isothiocyanate (FITC) -conjugated goat anti-mouse or rabbit antibodies were purchased from Zymed Laboratories (South San Francisco, CA, USA). Anti-PGI/AMF was described previously (24). The rabbit anti-PGI/AMF IgG was purified using an ImmunoPure (G) IgG kit (Pierce, Rockford, IL, USA).
Total RNA was extracted with TRIzol Reagent (Invitrogen). The cDNA for PCR template was generated by using a First-strand cDNA Synthesis Kit (Amersham Biosciences, Piscataway, NJ, USA) as recommended in the manufacturers’ protocols. For quantitative evaluation of the amplified product, PCR encompassing 20 – 40 cycles was preliminarily performed to determine the most suitable number of amplifications for each reaction. Each PCR cycle consisted of 1 min at 95°C, 1 min at 55°C, and 2 min at 68°C for PGI/AMF and HIF-1␣; 1 min at 95°C, 1 min at 58°C, and 2 min at 68°C for VEGF; and 1 min at 95°C, 1 min at 60°C, and 2 min at 68°C for -actin. PCR-amplified products were electrophoresed in 1% agarose gel and stained with ethidium bromide. Each expression was standardized using -actin signal as an internal control. Density of each band was quantitated with NIH Image software. The sequence of oligonucleotide primers are follows: 5⬘-AATGCAGAGACGGCGAAGGAG (forward) and 5⬘-ACGAGAAGAGAAAGGGGAGTC (reverse) for human PGI/AMF detection; 5⬘-GTCGGACAGCCTCACCAAACAGAGC (forward) and 5⬘-GTTAACTTGATCC-
HYPOXIA REGULATES PGI/AMF EXPRESSION
1423
AAAGCTCTGAG (reverse) for human HIF-1␣ detection; 5⬘-GAAGTGGTGAAGTTCATGGATGTC (forward) and 5⬘CGATCGTTCTGTATCAGTCTTTCC (reverse) for human VEGF detection; 5⬘-TGACGGGGTCACCCACACTGTGCCCAT (forward) and 5⬘-CTAGAAGCATTTGCGGTGGACGATGGAGGG (reverse) for human -actin detection as a housekeeping gene. Protein extraction For whole cell lysates, cells were washed twice with PBS and collected by scraping. Cell pellets were lysed in cold radioimmune precipitation assay buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10 mM EDTA, 1% of NP-40, Triton X-100, sodium deoxycholate) containing 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 g/mL leupeptin, and 10 g/mL aprotinin. Samples were clarified by centrifugation (15,000 rpm in 4°C for 30 min). Cell supernatants were 100-fold concentrated with Amicon Ultra (30,000 NMWL, Millipore, Bedford, MA, USA). For nuclear protein, cells were lysed in buffer A [10 mM HEPES-KOH (pH 7.8), 10 mM KCl, 0.1 mM EDTA (pH 8.0), 0.1% Nonidet P-40, 0.5 mM PMSF, 2 g/mL leupeptin, 2 g/mL aprotinin, 2 g/mL pepstatin, and 1 mM dithiothreitol], then vigorously mixed. The lysates were pelleted, resuspended in buffer C [50 mM HEPES-KOH (pH 7.8), 420 mM KCl, 0.1 mM EDTA (pH 8.0), 5 mM MgCl2, 2% glycerol, 0.5 mM PMSF, 2 g/mL leupeptin, 2 g/mL aprotinin, 2 g/mL pepstatin, and 1 mM dithiothreitol] and gently mixed at 4°C for 30 min. Debris was removed by centrifugation, and aliquots of the supernatant were stored as nuclear protein. Protein concentrations of each sample were determined using Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA, USA). Western analysis Equal amounts of proteins were loaded in each lane. All protein samples were separated on either 6 or 8% SDS-PAGE gels and transferred to 0.2 m polyvinylidene fluoride membrane (Osmonics Inc., Minnetonka, MN, USA) at 15 V, 30 mA overnight at 4°C. Then the membrane was blocked with 5% nonfat dry milk in PBS for 1 h at room temperature. The blocked membrane was incubated with diluted primary antibodies (PGI/AMF, 1:500; HIF-1␣ 1:200; histone, 1:200; and -actin 1:5000) for 3 h (PGI/AMF, HIF-1␣, and histone) or 1 h (-actin) at room temperature. After extensive washing to remove excess antibody from the membrane, either antirabbit or anti-mouse HRP-conjugated secondary antibody (1:5000) was added and incubated for 1 h at room temperature. Proteins were visualized by enhanced chemiluminescence (ECL) system. Density of each band was quantitated with NIH Image software. Migration assay To study the migration of cells using Transwell cell culture chambers (Corning Costar Co., Cambridge, MA, USA) (27), polycarbonate filters with 8.0 m pore size were coated on the backside with 5 g/filter type IV collagen. Medium containing 10% FBS was placed in the lower chamber, then 1 ⫻ 105 cells were added to the upper chamber in serum-free medium. Antibodies or drugs were added to the suspended cells. The cells were allowed to migrate through the pores and attach to the backside of membrane. After incubation, the membranes were fixed in methanol, then stained with 1% eosin and hematoxylin. The cells were removed from the upper surface of each membrane by scraping with a cotton swab. The cells that had penetrated through the membrane 1424
Vol. 19
September 2005
were counted under a microscope. Each assay was performed in triplicate. Immunofluorescence analysis Cells seeded on coverslips were fixed with 4% paraformaldehyde/PBS for 10 min at room temperature. The fixed cells were washed three times with PBS and permeabilized with 0.1% Triton X-100/PBS (pH 7.2) for 15 min. The cells were blocked with 1% bovine serum albumin/PBS for 30 min at 4°C, then labeled with anti-PGI/AMF or HIF-1␣ (1:100 dilution in 0.1% bovine serum albumin/PBS, respectively) for 2 h at 4°C. After incubation, the cells were washed with 0.05% Triton X-100/PBS and incubated with 0.5% FITC-conjugated goat anti-rabbit secondary antibody in 0.05% Triton X-100/ PBS for 1 h at room temperature in the dark. After washing, the cells were mounted on a glass slide with 80% glycerol and fluorescent images were analyzed in an Olympus fluorescence microscope using a ⫻400 lens. Statistical analysis Data are expressed as means ⫾ sd. Comparisons between the groups was determined using unpaired t test. P ⬍ 0.05 was considered statistically significant.
RESULTS Hypoxia increases PGI/AMF expression in human cancer cells To analyze the broad generalized effect of hypoxia on PGI/AMF expression, eight human cancer cell lines representing breast, colon, bladder, prostate, and lung cells were exposed to hypoxia (1% oxygen) or normoxia for 16 h at 37°C. The level of RNAs and proteins was determined by RT-PCR or Western blot, respectively. All the cell lines expressed PGI/AMF mRNA at higher levels under hypoxic conditions (2- to 10-fold) than under normoxic conditions (Fig. 1A), which was similar to the elevated level of hif-1␣ in response to the hypoxic environment (Fig. 1A). Western blot analysis for PGI/AMF revealed that an increase of secreted PGI/AMF protein occurred after hypoxia in all cell lines (Fig. 1B). The PGI/AMF level in the cell lysate seems to be refractory to the change from the normal to the hypoxic environment (Fig. 1B). However, analyses of PGI/AMF secretion levels revealed that all of the cells tested responded by elevated secretion under hypoxia, and the breast cancer cells (BT-549, MCF-7, and MDA-MB-468) that secrete a relatively low levels of the protein under normoxic conditions were most responsive to hypoxia by secreting PGI/AMF at significantly high levels (BT-549: 7.19⫾1.184 ratio to normoxic control, P⬍0.005; MCF-7: 5.27⫾1.240, P⬍0.01; MDA-MB-468: 5.66⫾1.424, P⬍0.01). The total proteins signify the sum of the protein in the cell lysate and the conditioned media (secreted type), and it has been reported that the enhanced synthesis of PGI/AMF is responsible for enhanced secretion (25, 28, 29). Therefore, we concluded that PGI/AMF protein could be induced by hypoxia. From the result of Fig. 1, we have
The FASEB Journal
FUNASAKA ET AL.
Figure 1. PGI/AMF mRNA and protein expression of human cancer cells. A) PGI/AMF mRNA expression. All cells were exposed to normoxia (N) or hypoxia (H) for 16 h before harvesting. RNAs were extracted from cells, then RT-PCR analysis was performed. B) PGI/AMF protein expression. All cells were exposed to normoxia (N) or hypoxia (H) for 16 h, then whole cell lysates or concentrated-cell conditioned media were subject to immunoblot analysis for PGI/AMF, HIF1␣, and -actin expression. Representative results of 3 different experiments are shown.
elected to continue our studies using the BT-549 cells due to their high PGI/AMF secretion response to hypoxia. HIF-1␣ role in PGI/AMF induction by hypoxia Based on the data depicted in Fig. 1, we question whether the expression and consequently the secretion of PGI/AMF are mediated in part by HIF-1␣. To address this in detail, we resorted to CoCl2 and DFO, as they were reported to chemically mimic hypoxic conditions (30). As expected, exposure of BT-549 cells to hypoxia environment and treatment with either 100 M CoCl2 or 100 M DFO resulted in HIF-1␣ protein up-regulation (Fig. 2), which led to increased PGI/AMF secretion levels (hypoxia: 7.59⫾1.367 ratio to normoxic control, P⬍0.005; CoCl2: 4.90⫾1.165, P⬍0.01; DFO: 5.28⫾1.187, P⬍0.01; Fig. 2). To determine whether the increased levels of PGI/AMF seen after hypoxia were a result of the increased levels of HIF-1␣, cells were transfected with siRNA specific to the HIF-1␣ before hypoxic stimulation. Western blot analysis revealed that knockdown of HIF-1␣ by siRNA attenuated PGI/AMF
Figure 2. PGI/AMF expression by chemical mimics of hypoxia. BT-549 cells were exposed to normoxia (N), hypoxia (H), 100 M CoCl2 , or 100 M DFO for 16 h. Cells were then harvested and whole cell lysates or concentrated cell-conditioned media prepared and analyzed by immunoblot analysis. Representative results of 3 different experiments are shown. HYPOXIA REGULATES PGI/AMF EXPRESSION
secretion enhancement (0.47⫾0.087 ratio to hypoxic control, P⬍0.01; Fig. 3). It has been reported that HIF-1␣ expression is linked to the increased expression of the angiogenic factor VEGF (1). The treatment with siRNA targeted to HIF-1␣ also suppressed up-regulation of VEGF expression (Fig. 3). Taken together, this result implies that the up-regulation in HIF-1␣ expression under hypoxia is associated with PGI/AMF elevated secretion (23, 25). We examined whether hypoxia affects the cellular localization of HIF-1␣ and PGI/AMF compartmentalization using indirect immunofluorescence analyses. Under control environment, HIF-1␣ was not detected in cultured BT-549 cells distributed throughout the cytoplasm and nucleus (Fig. 4Ia), whereas under hypoxic condition it appears to be mainly translocated to the nucleus (Fig. 4Ic). A different picture was observed when PGI/AMF distribution was analyzed. Under control conditions it was found to be localized in the cytoplasm and the nucleus (Fig. 4Ib). Under hypoxic exposure, the cells showed a dramatic increase in the PGI/AMF levels in the nucleus compared with the cytoplasm (Fig. 4Id). This shift in the cellular localization of PGI/AMF was confirmed biochemically in protein levels when Western blot analyses were performed using nuclear protein extractions (2.12⫾0.470 ratio to normoxic control, P⬍0.05; Fig. 4II). Since we have documented above that the overall total PGI/AMF level in whole cell protein extracts did not change under hypoxic conditions, we may conclude that hypoxia signals for nuclear import of PGI/AMF. Signaling and PGI/AMF expression It has been reported that HIF-1␣ protein synthesis and phosphorylation are regulated by activation of the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3⬘-kinase (PI3K) pathways (1). Thus, to find out whether any of these pathways play any role in the hypoxia signaling upstream of PGI/AMF, we treated the cells with different kinase inhibitors prior to
Figure 3. Knockdown of HIF-1␣ expression by siRNA gene silencing. BT-549 cells were transfected with HIF-1␣-specific siRNA duplex or control siRNA (mock) as described in Materials and Methods. Cells were then exposed to normoxia (N) or hypoxia (H) for 16 h and analyzed by immunoblot analysis for PGI/AMF, VEGF, HIF-1␣, and -actin expression. Representative results of 3 different experiments are shown. WT, wild-type BT-549 cells; M, mock cells; Si, siRNA against HIF-1␣ transfected cells. 1425
Figure 4. Hypoxic nuclear accumulation of PGI/AMF. I, Indirect immunofluorescence analysis of normoxic and hypoxic BT-549 cells. Cells were cultured under normoxic (a, b) or hypoxic (c, d) conditions for 16 h, then prepared for immunofluorescence as described in Materials and Methods. Cells were then stained with either anti-HIF-1␣ (a, c) or PGI/AMF (b, d) antibodies. II, Nuclear extracts from normoxic and hypoxic BT-549 cells were analyzed by immunoblotting analysis. Cells were exposed to normoxia (N) or hypoxia (H) for 16 h before harvested. Representative results of 3 different experiments are shown.
Hypoxia is a major inducer of VEGF up-regulation in many cell types (1), and since both PGI/AMF and VEGF expression is up-regulated by hypoxia and the two play a cooperative function during metastasis under low oxygen pressure (27), we next questioned the possibility of a cross-talk between PGI/AMF and VEGF under hypoxia. To address this possibility, we first tested whether VEGF-neutralizing antibody or inhibitors of the VEGF receptors (Flt-1/Flk-1) affect hypoxic induction of PGI/AMF. As shown in Fig. 6A, VEGF-neutralizing antibody treatment during hypoxic exposure inhibited hypoxia-induced PGI/AMF protein secretion levels (0.5 g/mL: 0.70⫾0.108 ratio to hypoxic control, P⬍0.05; 1 g/mL: 0.51⫾0.087, P⬍0.005; 5 g/mL: 0.35⫾0.122, P⬍0.005; normoxic control: 0.22⫾0.062, P⬍0.001). Similarly, Flk-1 inhibitor, SU1498, and Flt-1/Flk-1 inhibitor, tyrosine kinase (TK) inhibitor, partially decreased hypoxia-induced PGI/AMF secretion (TK inhibitor 5 M: 0.58⫾0.090 ratio to hypoxic control, P⬍0.005; TK inhibitor 50 M: 0.43⫾0.083, P⬍0.001; normoxic control: 0.17⫾0.068, P⬍0.001; Fig. 6B, and SU1498 10 M: 0.58⫾0.086 ratio to hypoxic control,
hypoxia exposure (Fig. 5). We used three classes of inhibitors: LY294002 (LY), a PI3K inhibitor; PD98059 (PD), a specific inhibitor of p42/p44 MAPK; and SB203580 (SB), a specific inhibitor of p38 MAPK. As reported for other cells (1), under hypoxia HIF-1␣ expression in BT-549 cells was blocked by LY, reduced by SB, but not affected by PD (Fig. 5). LY also completely shut down hypoxia-induced PGI/AMF secretion (LY: 0.13⫾0.106 ratio to hypoxic control, P⬍0.001; normoxic control: 0.21⫾0.075, P⬍0.001) whereas PD and SB had no significant effect on PGI/AMF secretion. These results suggest that increased PGI/AMF secretion by hypoxia is highly dependent on PI3K activity.
Figure 5. Effect of different kinase inhibitors on PGI/AMF expression. BT-549 cells were pretreated with 50 M LY294002 (LY), 100 M PD98059 (PD), or 5 M SB203580 (SB) for 1 h, then exposed to normoxia (N) or hypoxia (H) for 16 h before harvesting. Whole cell lysates or concentratedcell conditioned media were subject to immunoblot analysis. Representative results of 3 different experiments are shown. 1426
Vol. 19
September 2005
Figure 6. Effect of VEGF inhibitors on PGI/AMF expression. A) Effect of VEGF-neutralizing antibody (VEGF-Ab) on hypoxia-induced PGI/AMF protein expressions. BT-549 cells were exposed to normoxia (N) or hypoxia (H) for 16 h before harvesting together with VEGF-Ab (0.5–5 g/mL). B, C) Effect of inhibition of VEGF receptors on hypoxia-induced PGI/AMF protein expressions. BT-549 cells were exposed to normoxia (N) or hypoxia (H) in the presence of VEGFtyrosine kinase inhibitor (0.5–50 M; TK inhibitor, Flk-1, and Flt-1 inhibitor) (B) or SU1498 (0.1–10 M; Flk-1 selective inhibitor) (C). As for the SU1498, more than this concentration was not used because it was toxic to the cells (data not shown). Representative results of 3 different experiments are shown.
The FASEB Journal
FUNASAKA ET AL.
P⬍0.005; normoxic control: 0.16⫾0.062, P⬍0.001; Fig. 6C). Taken together, these data suggest that hypoxiainduced VEGF and the subsequent receptor activation partially contribute to PGI/AMF induction during hypoxia. Next, we tested the capacity of recombinant human VEGF to induce AMF protein expression under normoxic conditions (Fig. 7). Unexpectedly, AMF secretion level was extinguished at 10 ng/mL VEGF addition (0.21⫾0.065 ratio to normoxic control, P⬍0.001). Similar results were obtained under hypoxic conditions (10 ng/mL: 0.40⫾0.095 ratio to hypoxic control, P⬍0.001; 100 ng/mL: 0.27⫾0.066, P⬍0.001). Taking the VEGF concentration in conditioned media under hypoxia into account (⬃several tens or hundreds pg/mL, 31, 32), excessive amounts of VEGF seem to activate the negative regulatory feedback loop for AMF secretion in cancer cells. YC-1 is a novel therapeutic agent originally developed as a stimulator of soluble guanylyl cyclase for circulation disorders (33). It has been revealed that YC-1 inhibits platelet aggregation, vascular contraction, HIF-1␣ activity, and tumor angiogenesis (34). YC-1 also suppresses VEGF levels under hypoxic conditions due to its inhibitory effect on HIF-1␣ protein (35). To investigate the inhibitory effect of YC-1 on HIF-1␣mediated hypoxic responses on bT-549 cells, cells were treated with YC-1 under hypoxic conditions (Fig. 8). The HIF-1␣ protein level increased under hypoxia conditions without YC-1 but showed a dose-dependent decrease with YC-1. The expression levels of VEGF also showed a dose-dependent decrease in response to YC-1. The secreted PGI/AMF protein level under hypoxic conditions was decreased with YC-1 (10 M: 0.39⫾0.029 ratio to hypoxic control, P⬍0.001), whereas expression of PGI/AMF in cell lysates was only marginally affected. The kinetic response of gene expression to hypoxia in BT-549 cells was performed by RT-PCR analysis and a differential time-dependent response of HIF-1␣, VEGF PGI/AMF expression was observed within ⬃2 h, ⬃4 h, and ⬃8 h, respectively (Fig. 9). To test the effects of various inhibitors on hypoxiainduced cell motility, we used PGI/AMF antibody (100 ng/mL IgG), VEGF neutralizing antibody (5 ng/mL), YC-1 (10 M), and VEGF receptor inhibitors (SU1498; 10 M and TK inhibitor; 50 M). Hypoxia induced cell migration by ⬃2.0-fold (Fig. 10). Neither of the tested inhibitors exhibited a significant inhibition of cells motility under control normoxic conditions, while sig-
Figure 7. Effect of VEGF on AMF expression. BT-549 cells were treated with the indicated concentrations of human recombinant VEGF (1–100 ng/mL; rVEGF) under normoxia (N) or hypoxia (H) for 16 h before harvesting. Representative results of 3 different experiments are shown. HYPOXIA REGULATES PGI/AMF EXPRESSION
Figure 8. Effect of YC-1 on PGI/AMF expression. BT-549 cells were treated with YC-1 (0.1–10 M) and cultured under normoxia (N) or hypoxia (H) for 16 h before harvesting. Cell samples were subject to immunoblot analysis for PGI/AMF, VEGF, HIF-1␣, and -actin expression. Representative results of 3 different experiments are shown.
nificantly inhibiting hypoxia-stimulated motility. PGI/ AMF antibody and TK inhibitor completely blocked hypoxia-induced cell motility; VEGF-neutralizing antibody YC-1 and SU1498 reduced cell motility by ⬃30 – 40%. These results confirm that PGI/AMF acts as a motile stimulator during hypoxia, a function partially mediated by VEGF.
DISCUSSION In this study we have demonstrated that the cell motility factor PGI/AMF is an hypoxic-inducible gene in a wide range of human cancer cell lines including breast, colon, bladder, prostate, and lung, resulting in its increased secretion and subsequently induction of cell motility. The elevated expression and secretion of PGI/AMF in response to the hypoxic microenvironment was associated with HIF-1␣. In breast cancer, HIF-1␣ over-
Figure 9. Hypoxic regulation of PGI/AMF gene expression. Time course of PGI/AMF, VEGF, and HIF-1␣ mRNA expression in BT-549 cells exposed to hypoxia. mRNA was isolated at the indicated time points of hypoxia and semiquantitative RT-PCR analysis was performed. Results were quantified by NIH Image software after normalization to the -actin control signals. Data are presented as mean ⫾ sd of 3 triplicate experiments. ●, HIF-1␣; Œ, VEGF; f, PGI/AMF. 1427
Figure 10. Effect of inhibiting PGI/AMF or VEGF activity on hypoxia-stimulated cell motility. 1 ⫻ 105 of BT-549 cells were seeded onto the upper surface of Transwell chambers (see Materials and Methods) with or without various inhibitors and cultured under normoxia or hypoxia for 16 h. After incubation, the cells invading to the lower surface were visually counted in 5 randomly selected microscopic fields (⫻200) per filter. The data are presented as mean ⫾ sd for triplicate determinations. *P ⬍ 0.01 compared with normal control by Student’s t test. Control; PGI/AMF-Ab; VEGF-Ab; YC-1; SU-1498; TK inhibitor.
expression can be detected in ductal carcinomas but not in benign ductal hyperplasia, and is associated with tumor angiogenesis and increased mortality in breast cancer (35). HIF-1␣ activity is increased by both hypoxia and genetic alterations, including the loss of function in the tumor suppressor genes encoding p53, PTEN, and pVHL as well as the gain of function in oncogenes that activate the PI3K, SRC, and MAPK signal transduction pathways, and is correlated with tumor growth and angiogenesis (1, 2). In this study, we discovered that PGI/AMF was induced by CoCl2 and DFO, which increase HIF-1␣ levels, and HIF-1␣ is important in hypoxic induction of PGI/AMF expression by using siRNA for the first time. Further, we report that suppression of HIF-1␣ expression by PI3K inhibitor LY294002 has resulted in substantial inhibition of PGI/AMF expression under hypoxia. The insignificant effect of p38 or p42/p44 MAPK inhibitor on HIF-1␣ protein expression, which did not affect PGI/ AMF expression, suggests that HIF-1␣ regulates PGI/ AMF expression under hypoxia in a PI3K-dependent manner. Hypoxia-induced HIF-1␣ is a well-known primary mediator of neovascularization observed in various pathological conditions such as tumor angiogenesis, cardiovascular diseases, and retinal neovascularization (36). A principal mediator of tumor angiogenesis is VEGF; a major transcriptional activator of the VEGF gene is HIF-1␣. Thus, it was reasonable to assume that the expression of VEGF and PGI/AMF under hypoxia might be related. Indeed, we show here by using a neutralizing anti-VEGF antibody and pharmacological inhibitors of VEGF receptors that PGI/AMF expression under hypoxia is regulated by VEGF, which is induced by HIF-1␣. Furthermore, the Flk-1 receptor seems to be 1428
Vol. 19
September 2005
the major pathway involved in this regulation as the SU1498 (Flk-1 inhibitor) had a similar effect as the VEGF TK inhibitor (Flt-1/Flk-1 inhibitor). The hypothesis is further supported by experiments showing that YC-1, a drug that can inhibit VEGF expression after HIF-1␣ inhibition (36), had a significant effect on hypoxic PGI/AMF induction. Of note, PGI/AMF mRNA was up-regulated in time-dependent manner by hypoxia treatment, but its increased expression was delayed in comparison with the relative rapid expression of HIF-1␣ and VEGF in response to hypoxic exposure. Moreover, there are some reports that activation of PI3K leads to increased levels of HIF-1␣ protein, positively regulates HIF-1␣-mediated transcription of VEGF in various cancer cell lines, and mediates angiogenesis (1, 2). Taken together, our results suggest that hypoxic induction of PGI/AMF could be regulated at least in part by VEGF. Unexpectedly, excessive amount of VEGF extinguished the AMF expression under normoxia and hypoxia. It has been reported that the VEGF protein level in medium from cancer cells cultured under hypoxic conditions was approximately several hundreds pg/mL (31, 32). Thus, our experimental setting was harsh for cells. However, it is possible that VEGF might bring the negative regulatory feedback loop for AMF expression in some conditions. It has been reported that VEGF must work in conjunction with other factors during complex biological phenomena (37). PGI/AMF was originally identified as a cytokine that stimulates cell motility for various types of cells, including normal and cancer cells (27). We verified the bioactivity of PGI/AMF under hypoxic conditions and found that cells under this environment show an enhanced motility compared with cells under normoxic conditions, which was associated with PGI/AMF upregulation, and that motile stimulation was suppressed by specific PGI/AMF and VEGF/VEGF receptor inhibitors. Anti-PGI/AMF antibody substantially suppressed the stimulated cell motility under hypoxia, suggesting that PGI/AMF plays a key in tumor cell invasion and motility during hypoxia. The subcellular localization of PGI/AMF was detected by immunofluorescence or immunoblotting. Immunofluorescence studies showed that PGI/AMF is localized primarily in the cytoplasm of normoxic cells. The nuclei of most hypoxic cells were strongly immunoreactive. The nuclear accumulation of PGI/AMF was confirmed by immunoblotting, indicating it was ⬃2.0fold more than normoxic cells. Many growth factors, such as VEGF, PDGF, and epidermal growth factor, trigger their mitogenic signaling by binding to the transmembrane receptor tyrosine kinases. The activated receptors binding their respective phosphorylate the receptor substrates to initiate intracellular kinase signaling cascades (38). It is evident, however, that there may be alternative signaling pathways for some growth factors involving their nuclear transport and signaling. Subsequent to growth factor ligand-receptor internalization, ligands may translocate to the nucleus
The FASEB Journal
FUNASAKA ET AL.
and directly function in mitogenic processes (39). FGF-1 is one of these nuclear translocatable factors. It is a potent mitogen for many cell types and is involved in a variety of physiological and pathological processes, including embryogenesis, angiogenesis, wound healing, etc. (40). It has been suggested that stimulation of DNA synthesis and cell proliferation by FGF requires the nuclear translocation of FGF (41, 42). Thus, nuclear translocated PGI/AMF might exert some activity under hypoxic conditions. Moreover, although both PGI/AMF and FGF-1 have to be released from cells to interact with their receptors on the cell surface, they lack a signal sequence that targets the protein onto the normal secretory pathway (43, 44). Taken in light of our finding that PGI/AMF secretion is remarkably up-regulated during hypoxia, it is possible that the secretory pathway of PGI/AMF is involved with nuclear translocation of PGI/AMF. PGI/AMF like PGK, FGF-1 and -2, PDGF, interleukin-1, etc., lack a secretory signal sequence and are secreted via the nonclassical secretion pathway (43– 46). We previously reported that the level and rate of PGI/AMF secretion are related to its level of expression (28), and the results presented here give credence to the notion that an increase in the cellular level of expression may be translated to an increase in protein secretion of signal-less proteins. It should be noted that PGI/AMF is the first example of a hypoxia-dependent control for the secretion of a signal sequence-less proteins. In summary, the data presented here add to the well-established role of hypoxia in the regulation of energy metabolism, showing that the glucose-metabolizing enzyme PGI/AMF is up-regulated by hypoxia and is controlled by HIF-1␣. Induction of this glycolytic enzyme is surely critical to accelerate the anaerobic synthesis of ATP during hypoxia, and its extracellular function contributes to cell motility and invasion during cancer metastasis. Activation of PGI/AMF together with the activation of multiple hypoxia-dependent genes should add to the understanding of the effect of the microenvironment on cancer progression and its inhibitors may be used for cancer therapy. This work was supported in part by a grant from NIH CA 51714 to A.R. The authors thank Ms. Vivian Powell for her editing of the manuscript.
5.
6.
7.
8. 9. 10.
11.
12.
13.
14. 15.
16.
17.
18. 19. 20.
21.
REFERENCES Semenza, G. L. (2003) Targeting HIF-1 for cancer therapy. Nat. Rev. Cancer 3, 721–732 2. Dang, C. V., and Semenza, G. L. (1999) Oncogenic alterations of metabolism. Trends Biochem. Sci. 24, 68 –72 3. Kallio, P. J., Wilson, W. J., O’Brien, S., Makino, Y., and Poellinger, L. (1999) Regulation of the hypoxia-inducible transcription factor 1␣ by the ubiquitin-proteasome pathway. J. Biol. Chem. 274, 6519 – 6525 4. Semenza, G. L. (1999) Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu. Rev. Cell Dev. Biol. 15, 551–578
22.
1.
HYPOXIA REGULATES PGI/AMF EXPRESSION
23.
24.
Sivitz, W. I., Lund, D. D., Yorek, B., Griver-McKay, M., and Schmid, P. G. (1992) Pretranslational regulation of two cardiac glucose transporters in rats exposed to hypobaric hypoxia. Am. J. Physiol. 263, E562–E569 Daly, E. B., Wind, T., Jiang, X. M., Sun, L., and Hogg, P. J. (2004) Secretion of phosphoglycerate kinase from tumour cells is controlled by oxygen-sensing hydroxylases. Biochim. Biophys. Acta 1691, 17–22 Semenza, G. L., Roth, P. H., Fang, H. M., and Wang, G. L. (1994) Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J. Biol. Chem. 269, 23757–23763 Kim, J. W., and Dang, C. V. (2005) Multifaceted roles of glycolytic enzymes. Trends Biochem. Sci. 30, 142–150 Faik, P., Walker, J. I., Redmill, A. A., and Morgan, M. J. (1988) Mouse glucose-6-phosphate isomerase and neuroleukin have identical 3⬘ sequences. Nature (London) 332, 455– 457 Watanabe, H., Takehana, K., Date, M., Shinozaki, T., and Raz, A. (1996) Tumor cell autocrine motility factor is the neuroleukin/ phosphohexose isomerase polypeptide. Cancer Res. 56, 2960 – 2963 Liotta, L. A., Mandler, R., Murano, G., Katz, D. A., Gordon, R. K., Chiang, P. K., and Schiffmann, E. (1986) Tumor cell autocrine motility factor. Proc. Natl. Acad. Sci. USA 83, 3302– 3306 Gurney, M. E., Apatoff, B. R., Spear, G. T., Baumel, M. J., Antel, J. P., Bania, M. B., and Reder, A. T. (1986) Neuroleukin: a lymphokine product of lectin-stimulated T cells. Science 234, 574 –581 Xu, W., Seiter, K., Feldman, E., Ahmed, T., and Chiao, J. W. (1996) The differentiation and maturation mediator for human myeloid leukemia cells shares homology with neuroleukin or phosphoglucose isomerase. Blood 87, 4502– 4506 Yakirevich, E., and Naot, Y. (2000) Cloning of a glucose phosphate isomerase/neuroleukin-like sperm antigen involved in sperm agglutination. Biol. Reprod. 62, 1016 –1023 Cao, M. J., Osatomi, K., Matsuda, R., Ohkubo, M., Hara, K., and Ishihara, T. (2000) Purification of a novel serine proteinase inhibitor from the skeletal muscle of white croaker (Argyrosomus argentatus). Biochem. Biophys. Res. Commun. 272, 485– 489 Schroter, W., Eber, S. W., Bardosi, A., Gahr, M., Gabriel, M., and Sitzmann, F. C. (1985) Generalised glucosephosphate isomerase (GPI) deficiency causing haemolytic anaemia, neuromuscular symptoms and impairment of granulocytic function: a new syndrome due to a new stable GPI variant with diminished specific activity (GPI Homburg). Eur. J. Pediatr. 144, 301–305 Beutler, E., West, C., Britton, H. A., Harris, J., and Forman, L. (1997) Glucosephosphate isomerase (GPI) deficiency mutations associated with hereditary nonspherocytic hemolytic anemia (HNSHA). Blood Cells Mol. Dis. 23, 402– 409 Matsumoto, I., Staub, A., Benoist, C., and Mathis, D. (1999) Arthritis provoked by linked T and B cell recognition of a glycolytic enzyme. Science 286, 1732–1735 Gomm, S. A., Keevil, B. G., Thatcher, N., Hasleton, P. S., and Swindell, R. S. (1988) The value of tumour markers in lung cancer. Br. J. Cancer 58, 797– 804 Baumann, M., Kappl, A., Lang, T., Brand, K., Siegfried, W., and Paterok, E. (1990) The diagnostic validity of the serum tumor marker phosphohexose isomerase (PHI) in patients with gastrointestinal, kidney, and breast cancer. Cancer Invest. 8, 351–356 Filella, X., Molina, R., Jo, J., Mas, E., and Ballesta, A. M. (1991) Serum phosphohexose isomerase activities in patients with colorectal cancer. Tumour Biol. 12, 360 –367 Yoon, D. Y., Buchler, P., Saarikoski, S. T., Hines, O. J., Reber, H. A., and Hankinson, O. (2001) Identification of genes differentially induced by hypoxia in pancreatic cancer cells. Biochem. Biophys. Res. Commun. 288, 882– 886 Niizeki, H., Kobayashi, M., Horiuchi, I., Akakura, N., Chen, J., Wang, J., Hamada, J. I., Seth, P., Katoh, H., Watanabe, H., et al. (2002) Hypoxia enhances the expression of autocrine motility factor and the motility of human pancreatic cancer cells. Br. J. Cancer 86, 1914 –1919 Krishnamachary, B., Berg-Dixon, S., Kelly, B., Agani, F., Feldser, D., Ferreira, G., Iyer, N., LaRusch, J., Pak, B., Taghavi, P., et al. (2003) Regulation of colon carcinoma cell invasion by hypoxiainducible factor 1. Cancer Res. 63, 1138 –1143
1429
25.
26.
27.
28.
29.
30.
31.
32.
33. 34.
1430
Niinaka, Y., Paku, S., Haga, A., Watanabe, H., and Raz, A. (1998) Expression and secretion of neuroleukin/phosphohexose isomerase/maturation factor as autocrine motility factor by tumor cells. Cancer Res. 58, 2667–2674 Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (London) 411, 494 – 498 Funasaka, T., Haga, A., Raz, A., and Nagase, H. (2002) Autocrine motility factor secreted by tumor cells upregulates vascular endothelial growth factor receptor (Flt-1) expression in endothelial cells. Int. J. Cancer 101, 217–223 Tsutsumi, S., Hogan, V., Nabi, I. R., and Raz, A. (2003) Overexpression of the autocrine motility factor/phosphoglucose isomerase induces transformation and survival of NIH-3T3 fibroblasts. Cancer Res. 63, 242–249 Yanagawa, T., Watanabe, H., Takeuchi, T., Fujimoto, S., Kurihara, H., and Takagishi, K. (2004) Overexpression of autocrine motility factor in metastatic tumor cells: possible association with augmented expression of KIF3A and GDI-beta. Lab. Invest. 84, 513–522 Gleadle, J. M., Ebert, B. L., Firth, J. D., and Ratcliffe, P. J. (1995) Regulation of angiogenic growth factor expression by hypoxia, transition metals, and chelating agents. Am. J. Physiol. 268, C1362–C1368 Blancher, C., Moore, J. W., Robertson, N., and Harris, A. L. (2001) Effects of ras and von Hippel-Lindau (VHL) gene mutations on hypoxia-inducible factor (HIF)-1␣, HIF-2␣, and vascular endothelial growth factor expression and their regulation by the phosphatidylinositol 3⬘-kinase/Akt signaling pathway. Cancer Res. 61, 7349 –7355 Yeo, E. J., Chun, Y. S., Cho, Y. S., Kim, J., Lee, J. C., Kim, M. S., and Park, J. W. (2003) YC-1: a potential anticancer drug targeting hypoxia-inducible factor 1. J. Natl. Cancer Inst. 95, 516 –525 Ko, F. N., Wu, C. C., Kuo, S. C., Lee, F. Y., and Teng, C. M. (1994) YC-1, a novel activator of platelet guanylate cyclase. Blood 84, 4226 – 4233 Galle, J., Zabel, U., Hubner, U., Hatzelmann, A., Wagner, B., Wanner, C., and Schmidt, H. H. (1999) Effects of the soluble guanylyl cyclase activator, YC-1, on vascular tone, cyclic GMP levels and phosphodiesterase activity. Br. J. Pharmacol. 127, 195–203
Vol. 19
September 2005
35.
36. 37.
38. 39. 40. 41. 42.
43.
44.
45. 46.
Bos, R., Zhong, H., Hanrahan, C. F., Mommers, E. C., Semenza, G. L., Pinedo, H. M., Abeloff, M. D., Simons, J. W., van Diest, P. J., and van der Wall, E. (2001) Levels of hypoxia-inducible factor 1␣ during breast carcinogenesis. J. Natl. Cancer Inst. 93, 309 –314 Shweiki, D., Itin, A., Soffer, D., and Keshet, E. (1992) Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature (London) 359, 843– 845 Visconti, R. P., Richardson, C. D., and Sato, T. N. (2002) Orchestration of angiogenesis and arteriovenous contribution by angiopoietins and vascular endothelial growth factor (VEGF). Proc. Natl. Acad. Sci. USA 99, 8219 – 8224 Pawson, T. (2002) Regulation and targets of receptor tyrosine kinases. Eur. J. Cancer 38, Suppl. 5, S3–10 Jans, D. A. (1994) Nuclear signaling pathways for polypeptide ligands and their membrane receptors? FASEB J. 8, 841– 847 Burgess, W. H., and Maciag, T. (1989) The heparin-binding (fibroblast) growth factor family of proteins. Annu. Rev. Biochem. 58, 575– 606 Lin, Y. Z., Yao, S. Y., and Hawiger, J. (1996) Role of the nuclear localization sequence in fibroblast growth factor-1-stimulated mitogenic pathways. J. Biol. Chem. 271, 5305–5308 Komi, A., Ishisaki, A., Suzuki, M., and Imamura, T. (2003) A permeable FGF-1 nuclear localization sequence peptide induces DNA synthesis independently of Ras activation. Exp. Cell Res. 283, 91–100 Haga, A., Niinaka, Y., and Raz, A. (2000) Phosphohexose isomerase/autocrine motility factor/neuroleukin/maturation factor is a multifunctional phosphoprotein. Biochim. Biophys. Acta 1480, 235–244 Abraham, J. A., Mergia, A., Whang, J. L., Tumolo, A., Friedman, J., Hjerrild, K. A., Gospodarowicz, D., and Fiddes, J. C. (1986) Nucleotide sequence of a bovine clone encoding the angiogenic protein, basic fibroblast growth factor. Science 233, 545–548 Muesch, A., Hartmann, E., Rohde, K., Rubartelli, A., Sitia, R., and Rapoport, T. A. (1990) A novel pathway for secretory proteins? Trends Biochem. Sci. 15, 86 – 88 Rubartelli, A., and Sitia, R. (1991) Interleukin 1 beta and thioredoxin are secreted through a novel pathway of secretion. Biochem. Soc. Trans. 19, 255–259
The FASEB Journal
Received for publication January 18, 2005. Accepted for publication May 5, 2005.
FUNASAKA ET AL.
