Regulatory Overlap and Functional Redundancy among Bacillus ...

Download PDF
3 downloads 0 Views 369KB Size Report
Comment
Jun 8, 2007 - Cinoxacin. J41. DNA gyrase, DNA topoisomerase. PM35. A06. Miltefosine. J45. Fungicide, protein kinase C. PM36. A09–A11. Ibuprofen. J87.
JOURNAL OF BACTERIOLOGY, Oct. 2007, p. 6919–6927 0021-9193/07/$08.00⫹0 doi:10.1128/JB.00904-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Vol. 189, No. 19

Regulatory Overlap and Functional Redundancy among Bacillus subtilis Extracytoplasmic Function ␴ Factors䌤 Thorsten Mascher,† Anna-Barbara Hachmann, and John D. Helmann* Department of Microbiology, Cornell University, Ithaca, New York 14853-8101 Received 8 June 2007/Accepted 23 July 2007

Bacillus subtilis encodes seven extracytoplasmic function (ECF) ␴ factors that regulate partially overlapping regulons related to cell envelope homeostasis and antibiotic resistance. Here, we investigated their physiological role by constructing a mutant set of single, double, triple, and quadruple ECF ␴ factor deletions in the undomesticated B. subtilis strain NCIB3610. This mutant set was subsequently screened for defects in motility, multicellular differentiation, and sensitivity to more than 200 chemicals by using Phenotype MicroArrays. A quadruple mutant strain, harboring deletions of the sigV, sigY, sigZ, and ylaC gene, behaved indistinguishably from the wild-type strain, indicative of either regulatory redundancy or very specific functions of these four ECF ␴ factors. In contrast, a triple mutant, inactivated for the sigM, sigW, and sigX genes (but none of the corresponding double mutants), showed a biphasic growth behavior and a complete loss of multicellular differentiation, as judged by both colony formation and the inability to form a pellicle. This triple mutant also displayed a greatly increased sensitivity to detergents and several cell wall antibiotics including ␤-lactams, polymyxin B, and D-cycloserine. In several cases, these antibiotic-sensitive phenotypes are significantly enhanced in the triple mutant strain relative to strains lacking only one or two ␴ factors. two target operons of a fourth ECF ␴ factor, ␴Y, suggests that this protein may regulate expression of a toxic peptide and the corresponding immunity gene (12). The ECF ␴ factors of B. subtilis recognize structurally similar promoter sequences characterized by a highly conserved AAC motif in the ⫺35 region and a CGT motif in the ⫺10 region (17). While our understanding of promoter recognition by this family of ␴ factors is still incomplete, it is clear that there is the potential for regulatory overlap (9, 20). It has been shown, for example, that the autoregulatory promoter sites for the sigW and sigX genes are specifically recognized by their cognate ␴ factors but that only one or two base changes in the ⫺10 recognition element lead to sites that can be recognized by both ␴ factors (30). Similarly, some targets of ECF ␴ factor regulation have promoter sites that are recognized in vitro and, apparently, also in vivo by more than one holoenzyme species (9, 20). A recently described list of putative ␴V-dependent genes almost completely overlaps with genes that have already been shown to be under the control of ␴M, ␴W, or ␴X (39). In light of this potentially significant regulatory overlap, it seems likely that the lack of dramatic phenotypes associated with null mutations in many ECF ␴ factor genes in B. subtilis may be due, in part, to redundancy. Here, we present studies to determine phenotypes associated with single and multiple mutations in ECF ␴ factors in B. subtilis strain NCIB3610. Strain NCIB3610 displays complex multicellular behaviors such as swarming motility, pellicle formation (a thick biofilm at the liquid-air interface in standing cultures), and fruiting body formation (2–5, 14, 23–25, 32). Many of these complex, multigenic phenotypes have been lost by mutation in B. subtilis 168 and other laboratory strains but are common among environmental isolates. Thus, NCIB3610 is sometimes referred to as an undomesticated strain. Our findings demonstrate that even a quadruple mutant of four

The genome of Bacillus subtilis harbors seven extracytoplasmic function (ECF) ␴ factors. So far, the physiological roles of four of these ␴ factors have been investigated in some detail (␴M, ␴W, ␴X, and ␴Y), while the roles of the other three (␴V, ␴Z, and ␴YlaC) remain elusive. ␴X was the first ECF ␴ factor to be analyzed in detail (19, 21). It is induced by inhibitors of peptidoglycan biosynthesis and tunicamycin (17). ␴X regulates several genes related to cell wall metabolism including the dltA and pssA operons that affect the overall net charge of the cell envelope by incorporating positively charged groups into teichoic acids and the cytoplasmic membrane, respectively. A sigX mutant strain displays increased sensitivity to cationic antimicrobial peptides (8) and is affected in the formation of cell chain clusters during biofilm formation (26). ␴W is induced by various cell wall antibiotics, alkaline shock, and other stresses affecting the cell envelope (13, 29, 37). It controls a large “antibiosis” regulon involved in mediating resistance to various antibiotics including fosfomycin and the antibiotic peptides sublancin and SdpC (6, 7, 10). ␴M is activated in response to numerous stresses including high salinity, ethanol, heat, acid, phosphate starvation, superoxide stress, and exposure to cell wall antibiotics such as bacitracin, vancomycin, and cationic antimicrobial peptides (13, 18, 27, 29, 33). A sigM mutant strain is more sensitive to bacitracin, paraquat, and high salinity (9, 11, 27, 33). It has also been demonstrated that in B. subtilis strain W23 ␴M, together with ␴X, is involved in teichoic acid biosynthesis and septum formation (28). Identification of

* Corresponding author: Department of Microbiology, Wing Hall, Cornell University, Ithaca, NY 14853-8101. Phone: (607) 255-6570. Fax: (607) 255-3904. E-mail: [email protected]. † Present address: Department of General Microbiology, Institute of Microbiology and Genetics, Georg-August-University, Grisebachstr. 8, D-37077 Go ¨ttingen, Germany. 䌤 Published ahead of print on 3 August 2007. 6919

6920

MASCHER ET AL.

J. BACTERIOL. TABLE 1. Strains used in this study

B. subtilis strain

Genotype and/or description

Source, reference, or constructiona

CU1065 NCIB3610 HB0009 HB0020 HB0028 HB0029 HB0030 HB0031 HB0032 HB7007 HB0911 HB0912 HB0913 HB0914 HB0915 HB0982 HB0801 HB0802 HB0803 HB0804 HB0805 HB0806 HB0807 HB0808 HB0820 HB0822 HB0823 HB0824 HB0825 HB0826 HB0827 HB0828 HB0829 HB0834 HB0838 HB0839 HB0840 HB0841 HB0842 HB0844 HB0845 HB0846 HB0847

W168 trpC2 attSP␤ undomesticated wildtype strain, ancestor of W168 CU1065, sigY::mls; donor strain for sigY::mls allele CU1065 sigW::mls; donor strain for sigW::mls allele CU1065, sigV::kan; donor strain for sigV::kan allele CU1065, ylaC::kan; donor strain for ylaC::kan allele CU1065, sigX::spec sigW::mls CU1065, sigM::kan; donor strain for sigM::kan allele CU1065, sigZ::kan; donor strain for sigZ::kan allele CU1065 sigX::spec; donor strain for sigX::spec allele CU1065 sigV::cat; donor strain for sigV::cat allele CU1065 sigY::cat; donor strain for sigY::cat allele CU1065 sigZ::cat; donor strain for sigZ::cat allele CU1065 ylaC::cat; donor strain for ylaC::cat allele CU1065 ylaC::spec; donor strain for ylaC::spec allele CU1065 sigM::kan sigW::mls sigX::spec NCIB3610 sigM::kan NCIB3610 sigV::kan NCIB3610 sigW::mls NCIB3610 sigX::spec NCIB3610 sigY::mls NCIB3610 sigZ::kan NCIB3610 ylaC::kan NCIB3610 ylaC::spec NCIB3610 sigW::mls sigX::spec NCIB3610 sigY::mls sigV::kan NCIB3610 sigY::mls sigZ::kan NCIB3610 sigY::mls ylaC::kan NCIB3610 sigV::kan sigZ::cat NCIB3610 sigV::kan ylaC::cat NCIB3610 sigZ::kan ylaC::cat NCIB3610 sigM::kan sigX::spec NCIB3610 sigW::mls sigM::kan NCIB3610 sigW::mls sigX::spec sigM::kan NCIB3610 sigY::mls sigV::kan ylaC::spec NCIB3610 sigY::mls sigV::kan sigZ::cat NCIB3610 sigY::mls sigZ::kan ylaC::spec NCIB3610 sigV::kan sigZ::cat ylaC::spec NCIB3610 sigY::mls sigV::kan ylaC::spec sigZ::cat NCIB3610 sigW::mls sigX::spec sigM::kan sigV::cat NCIB3610 sigW::mls sigX::spec sigM::kan sigY::cat NCIB3610 sigW::mls sigX::spec sigM::kan sigZ::cat NCIB3610 sigW::mls sigX::spec sigM::kan ylaC::cat

Laboratory stock 3 12 7 11 11 M. Cao (unpublished) 13 11 19 LFH-PCR 3 CU1065 LFH-PCR 3 CU1065 LFH-PCR 3 CU1065 LFH-PCR 3 CU1065 LFH-PCR 3 CU1065 SPP1HB0031 3 HB0030 SPP1HB0031 3 NCIB3610 SPP1HB0028 3 NCIB3610 SPP1HB0020 3 NCIB3610 SPP1HB7007 3 NCIB3610 SPP1HB0031 3 NCIB3610 SPP1HB0032 3 NCIB3610 SPP1HB0029 3 NCIB3610 SPP1HB0915 3 NCIB3610 SPP1HB7007 3 HB0803 SPP1HB0028 3 HB0805 SPP1HB7007 3 HB0805 SPP1HB0029 3 HB0805 SPP1HB0911 3 HB0802 SPP1HB0914 3 HB0802 SPP1HB0914 3 HB0806 SPP1HB7007 3 HB0801 SPP1HB0031 3 HB0803 SPP1HB0031 3 HB0820 SPP1HB0911 3 HB0822 SPP1HB0913 3 HB0822 SPP1HB0915 3 HB0823 SPP1HB0915 3 HB0825 SPP1HB0913 3 HB0838 SPP1HB0911 3 HB0834 SPP1HB0912 3 HB0834 SPP1HB0913 3 HB0834 SPP1HB0914 3 HB0834

a LFH- PCR (35) was applied as described previously (27) to construct some of the ECF ␴ factor deletions using the primers listed in Table 2. Construction of deletion mutants in the nontransformable B. subtilis strain NCIB3610 was achieved by generalized transduction using bacteriophage SPP1 lysates from the respective donor strains as described previously (3).

ECF ␴ factor genes (sigV, sigY, ylaC, and sigZ) is phenotypically silent in a broad range of assays. In contrast, single mutations of the sigM, sigX, and sigW genes display many of the same phenotypes noted previously in strain 168. Remarkably, a triple mutant (sigM sigW sigX), but none of the corresponding single or double mutants, displays several new phenotypes, including growth defects, increased antibiotic sensitivity, and a dramatic loss of the ability to form robust pellicles. These results provide further evidence for regulatory and functional overlap between these three ␴ factor regulons. MATERIALS AND METHODS Bacterial strains and growth conditions. To assess the role of ECF ␴ factors in strain NCIB3610, we generated a set of mutant strains as summarized in Table 1. For the mutations already constructed in the 168 derivative CU1065, the mutant alleles were crossed into strain NCIB3610 using SPP1-mediated generalized transduction as described previously (3). To circumvent selection incom-

patibilities, additional mutants were constructed by long-flanking homology (LFH)-PCR (see below). SPP1 lysates were prepared, and the deletions were introduced into NCIB3610 in a stepwise fashion (Table 1). The success of the allelic replacements was verified by direct colony PCR. For strain construction and precultures, B. subtilis strains 168 and NCIB3610 were grown at 37°C in Luria-Bertani (LB) medium (10 g of tryptone, 5 g of yeast extract, 5 g of NaCl per liter of broth) or on LB plates supplemented with 1.5% agar with appropriate selection. Antibiotics were supplemented at the following concentrations: 10 ␮g ml⫺1 tetracycline, 100 ␮g ml⫺1 spectinomycin, 5 ␮g ml⫺1 chloramphenicol, 10 ␮g ml⫺1 kanamycin, and 1 ␮g ml⫺1 erythromycin plus 25 ␮g ml⫺1 lincomycin. For pellicle formation experiments, 50 ␮l of mid-log-phase culture was inoculated into 10 ml of minimal MSgg medium (5 mM potassium phosphate, pH 7, 100 mM morpholinepropanesulfonic acid [pH 7], 2 mM MgCl2, 700 ␮M CaCl2, 50 ␮M MnCl2, 50 ␮M FeCl3, 1 ␮M ZnCl2, 2 ␮M thiamine, 0.5% glycerol, 0.5% glutamate, 50 ␮g ml⫺1 tryptophan, 50 ␮g ml⫺1 phenylalanine, and 50 ␮g ml⫺1 threonine) and incubated at 22°C (3). For colony architecture analysis, 10 ␮l of LB precultures was spotted onto minimal MSgg agar plates (dried for 30 min in a laminar airflow prior to spotting) and incubated at 22°C. Swarming motility and sporulation were assayed according to published procedures (16, 25).

REGULATORY OVERLAP AMONG B. SUBTILIS ECF ␴ FACTORS

VOL. 189, 2007

6921

TABLE 2. Oligonucleotides used in this study a

Primer no.

Name

1293 1294 1449 1295 1296 1450 1297 1298 1451 1587 1588 1452 751 1334 1335 1340 1330 1331 1332 1333 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351

cat fwd cat rev cat check rev kan fwd kan rev kan-check rev mls fwd mls rev mls-check rev spec fwd spec rev spec-check rev sigY-Up fwd sigY-Up rev sigY-Do fwd sigY-Do rev sigV-Up fwd sigV-Up rev sigV-Do fwd sigV-Do-rev sigZ-Up fwd sigZ-Up rev sigZ-Do fwd sigZ-Do rev ylaC-Up fwd ylaC-Up rev ylaC-Up rev2 ylaC-Do fwd ylaC-Do fwd2 ylaC-Do rev

a

Sequence

CGGCAATAGTTACCCTTATTATCAAG CCAGCGTGGACCGGCGAGGCTAGTTACCC GTCTGCTTTCTTCATTAGAATCAATCC CAGCGAACCATTTGAGGTGATAGG CGATACAAATTCCTCGTAGGCGCTCGG CTGCCTCCTCATCCTCTTCATCC GATCCTTTAACTCTGGCAACCCTC GCCGACTGCGCAAAAGACATAATCG GTTTTGGTCGTAGAGCACACGG ATCGATTTTCGTTCGTGAATACATG GCAAGGGTTTATTGTTTTCTAAAATCTG CGTATGTATTCAAATATATCCTCCTCAC GGCAGATCAATCGCTCCG CTTGATAATAAGGGTAACTATTGCCGCTTGTGTATCCAATGACCGTGATCCC CCGTTAGTTGAAGAAGGTTTTTATATTACAGCGGCACTGTAAAGTCCAGAGTTCATAAAGG CAGAGGTTGGCGAAAGCAGTCCG GCAAGAATCACCTTTAACAGGCTATGCCG CTTGATAATAAGGGTAACTATTGCCGGTCAGTTATGCATGTGACAAGCAACGC CCGTTAGTTGAAGAAGGTTTTTATATTACAGCCTATACAGAGCATTGAAGCTGATGCGC GTGTCTTGTGATACATGGGTATTCCTCC GCTCAACCGTTCGTGGTCCGATGATCGG CTTGATAATAAGGGTAACTATTGCCGCGGCTGATGAAATTGATCCCATAGATCC CCGTTAGTTGAAGAAGGTTTTTATATTACAGCGCTGTCACATTGAAGCGGATCGATATGG CAATTCTCCACAGAAAAAATGGCTATGGC AAAGATCATGCTGATGATGGCGCGG CTTGATAATAAGGGTAACTATTGCCGACAAGTCCTCAATGGAATCCCTATGC TATAACATGTATTCACGAACGAAAATCGACAAGTCCTCAATGGAATCCCTATGC CCGTTAGTTGAAGAAGGTTTTTATATTACAGCCCACATTGCACCGGGCTAGATTAGAGC CAGATTTTAGAAAACAATAAACCCTTGCCCACATTGCACCGGGCTAGATTAGAGC GCTATGTTAACGACTGCCGCAATGACC

fwd, forward; rev, reverse.

LFH-PCR. The LFH-PCR technique is derived from a published procedure (35) and was performed as described previously (27). In brief, antibiotic resistance cassettes were amplified from plasmids: the cat cassette from pGEM-cat (38) and the kan, mls, and spec cassettes from pDG780, pDG646, and pDG1726, respectively (15). Two primer pairs were designed to amplify ⬃1,000 bp of DNA fragments flanking the region to be deleted at its 5⬘ and 3⬘ ends. The resulting fragments are here called “Up” and “Do” fragments, respectively. The 3⬘ end of the Up fragment as well as the 5⬘ end of the Do fragment extended into the gene(s) to be deleted in a way that all expression signals of genes up- and downstream of the targeted genes remained intact. Extensions of ⬃25 nucleotides were added to the 5⬘ end of the Up-reverse and the Do-forward primers that were complementary (opposite strand and inverted sequence) to the 5⬘ and 3⬘ ends of the amplified resistance cassette. All obtained fragments were purified using a QIAquick PCR purification kit (QIAGEN Sciences, Maryland). A total of 100 to 150 ng of the Up and Do fragments and 250 to 300 ng of the resistance cassette were used together with the specific Up-forward and Do-reverse primers at standard concentrations in a second PCR. In this reaction the three fragments were joined by the 25-nucleotide overlapping complementary ends and simultaneously amplified by normal primer annealing. The PCR products were directly used to transform B. subtilis. Transformants were screened by colony PCR, using the Up-forward primer with a reverse check primer annealing inside the resistance cassette (Table 2). The integrity of the regions flanking the integrated resistance cassettes was verified by sequencing PCR products of ⬃1,000 bp amplified from chromosomal DNA of the resulting mutants. Sequencing was performed at the Cornell BioResource Center. All PCRs were done in a total volume of 50 ␮l (10 ␮l for colony PCR) using HotStar DNA-Polymerase Mastermix (QIAGEN Sciences, Maryland) or TripleMaster Polymerase Mix (Eppendorf North America, Westbury, NY), according to the manufacturer’s procedure. The primers used in this study are listed in Table 2. Phenotypic characterization. Phenotype MicroArray assays were performed by Biolog (Hayward, CA), according to the published procedure (1, 34, 40) using turbidity measurements since, at the time of these analyses (2003), the dyes in use by Biolog were toxic to B. subtilis (B. Bochner, personal communication). Incubation and recording of phenotypic data were performed in the OmniLog station by capturing digital images of the microarray and storing turbidity values

in a computer file displayed as a kinetic graph. The Biolog plates used for these analyses were PM9, PM10, PM31A, PM32A, PM33A, PM34B, PM35B, and PM36 as described on the Biolog website (http://www.biolog.com/PM_Maps .html and http://www.biolog.com/PMArchived_Maps.html). The OmniLog-PM software generates time course curves for turbidity and calculates differences in the areas for mutant and control cells. The units are arbitrary. Positive values indicate that the mutant showed greater rates of growth than the control. The differences are averages of values reported for two or more mutants of each type compared with the corresponding control strains. All significant hits (as defined by Biolog) are listed in Table 3 for the comparison of strain HB0834 (⌬sigMWX; hereafter, MWX mutant) versus NCIB3610. Some of the sensitivities identified by Phenotype MicroArray analysis were subsequently verified by disk diffusion assays. Cultures of NCIB3610, the MWX mutant, and the corresponding single and double mutants were inoculated from fresh overnight cultures (with selection) in LB medium and incubated (without selection) at 37°C with aeration until an optical density at 600 nm of ⬃1.0 (late log phase). One hundred milliliters of these cultures was mixed with 3 ml of 0.7% LB soft agar (kept liquid at 50°C) and directly poured onto LB plates (without selection). After 30 min at room temperature (to allow the soft agar to solidify), the plates were dried for 20 min in a laminar airflow hood. After cooling, filter paper disks (5.5-mm diameter) carrying the antibiotics to be tested (5 ␮l from stock solutions were used per filter disk; antibiotics were at a concentration of 100 mg ml⫺1 with the exception of polymyxin B at 10 mg ml⫺1 and moenomycin at 0.25 mg ml⫺1) were placed on the top of the agar, and the plates were incubated at 37°C overnight. The next day, the diameters of the inhibition zones were measured (after subtraction of the diameter of the filter paper disks). Position weight matrices. The promoter consensus sequence alignment was performed with the Weblogo software (http://weblogo.berkeley.edu/). The ␴X regulon (11 target promoters) (8) and ␴W regulon (30 promoters) (6, 10) are based on published tabulations. The ␴M regulon is based on the tabulation of eight promoters listed by Jervis et al. (22) together with 10 recently identified promoters sites (W. Eiamphungporn and J. D. Helmann, unpublished results).

6922

MASCHER ET AL.

J. BACTERIOL.

TABLE 3. Phenotype MicroArrray analysis of the MWX strain versus NCIB3610 Phenotype group and PM no.

a

Well(s)

Growth conditions

Gained phenotypes (resistance) PM32 PM36 PM32

A04 E09, E10 B01

t-Butyl hydroquinone Neomycin Lincomycin

Lost phenotypes (sensitivity) PM36

C02–C04

2-Hydroxybenzoic acid

E10, E11 B09–B12 C03 C09 A06 A09–A11 E11 A03 F05–F07 H03, H04 B04 B08 D11, D12 C04 A03 E08 F10 F11 F12 G02 G03 B03 B04 B05 B06 B07 B08 B09 B10 C02 C04 C05 C06 C07 C08 D02 D03 D04 D07 D11 B01 C06 D10–D12 E10–E12 H07, H08 H12 G03, G04 G05 H01 H05 F02–F04 F05, F06 F11, F12 G09, G10 H09, H10

Warfarin Fusaric acid 1-Hydroxy-pyridine-2-thione Cinoxacin Miltefosine Ibuprofen Chlorpromazine Alexidine Lauroylsarcosine Triton X-100 CHAPSO Lauryl sulfobetaine Dodecyl maltoside Iodoacetate pH 4.5 pH 9.5 glycine pH 9.5, L-ornithine pH 9.5, L-homoarginine pH 9.5, L-homoserine pH 9.5, L-norleucine pH 9.5, L-norvaline pH 4.5, L-arginine pH 4.5, L-asparagine pH 4.5, L-aspartic acid pH 4.5, L-glutamic acid pH 4.5, L-glutamine pH 4.5, glycine pH 4.5, L-histidine pH 4.5, L-isoleucine pH 4.5, L-phenylalanine pH 4.5, L-serine pH 4.5, L-threonine pH 4.5, L-tryptophan pH 4.5, L-tyrosine pH 4.5, L-valine pH 4.5, L-norleucine pH 4.5, L-norvaline pH 4.5, a-amino-N-butyric acid pH 4.5, g-hydroxy glutamate pH 4.5, trimethylamine-N-oxide pH 4.5 Compound 48/80 Cadmium chloride Phosphomycin Glycine Bacitracin, zinc salt Cefotaxime Cefazolin Cefoxitin Cefoperazone Cefsulodin Cephaloridine Cefuroxime Azlocillin D-Cycloserine

PM34 PM31 PM31 PM35 PM35 PM36 PM31 PM36 PM31 PM31 PM35 PM35 PM36 PM35 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM10 PM35 PM32 PM32 PM35 PM35 PM32 PM32 PM32 PM32 PM33 PM33 PM33 PM33 PM32 a

Differenceb

43 27 11 ⫺41 ⫺55 ⫺73 ⫺22 ⫺41 ⫺45 ⫺87 ⫺67 ⫺79 ⫺103 ⫺137 ⫺50 ⫺24 ⫺99 ⫺64 ⫺38 ⫺23 ⫺26 ⫺38 ⫺52 ⫺16 ⫺35 ⫺49 ⫺32 ⫺35 ⫺86 ⫺74 ⫺72 ⫺71 ⫺54 ⫺56 ⫺47 ⫺57 ⫺21 ⫺43 ⫺59 ⫺34 ⫺82 ⫺23 ⫺56 ⫺81 ⫺61 ⫺56 ⫺35 ⫺82 ⫺60 ⫺99 ⫺131 ⫺90 ⫺58 ⫺75 ⫺149 ⫺134 ⫺80 ⫺107 ⫺100

Mode of actionc

Oxidizing agent Protein synthesis, aminoglycoside Protein synthesis, lincosamide Anticapsule; multiple antibiotic resistance inducer Antimicrobial, from plants Chelator, lipophilic Chelator, lipophilic DNA gyrase, DNA topoisomerase Fungicide, protein kinase C Inhibitor prostaglandin synthetase Inhibits cyclic nucleotide phosphodiesterase Membrane, biguanide, electron transport Membrane, detergent Membrane, detergent Membrane, detergent Membrane, detergent Membrane, detergent, nonionic Oxidation, sulfhydryl pH pH, deaminase pH, deaminase pH, deaminase pH, deaminase pH, deaminase pH, deaminase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase pH, decarboxylase control Phospholipase C, ADP ribosylation Transport, toxic cation Wall Wall Wall and membrane Wall, cephalosporin Wall, cephalosporin Wall, cephalosporin Wall, cephalosporin Wall, cephalosporin Wall, cephalosporin Wall, cephalosporin Wall, ␤-lactam Wall, sphingolipid synthesis

Phenotype MicroArrray (PM) plate numbers are as described on the Biolog website (see Materials and Methods). Growth measurements were done using turbidity as described in Methods and Materials. Negative values indicate significantly poorer growth of the MWX strain relative to NCIB3610 while positive values indicate better growth of the MWX strain relative to NCIB3610. c Possible effect or mode of action (original Biolog annotation). Not all modes of action are applicable to B. subtilis. b

REGULATORY OVERLAP AMONG B. SUBTILIS ECF ␴ FACTORS

VOL. 189, 2007

6923

FIG. 1. Effects of ECF ␴ factor deletions on multicellular differentiation and growth. (A) Colony morphology of domesticated (CU1065) and undomesticated (NCIB3610) wild-type strains compared to the quadruple and triple mutants HB0842 (⌬VYZylaC) and MWX, respectively. Strains were grown in LB medium to mid-log phase with selection; 10 ␮l was spotted on MSgg plates (dried for 30 min in a laminar airflow) and incubated at room temperature for 6 days without selection. Colonies are shown at the same scale. Bar, 2 mm. (B) Pellicle formation of the same strains as in panel A. Ten milliliters of liquid MSgg medium (in six-well plates) was inoculated with 50 ␮l of mid-log-phase culture and incubated for 6 days at room temperature. The diameter of each well is 35 mm. (C) Pellicle formation of double and single mutants in sigM, sigW, and sigX. All parameters are as above.

RESULTS AND DISCUSSION Construction of ECF mutant strains in NCIB3610. To assess the role of ECF ␴ factors in strain NCIB3610, we constructed a set of strains including all seven single mutants and selected multiple mutants. Since little is known regarding the roles of four of the ECF ␴ factors (␴V, ␴Y, ␴Z, and ␴YlaC), we generated a quadruple mutant (HB0842) to determine if this might reveal previously undisclosed phenotypes. In the case of the other three ␴ factors (␴M, ␴W, and ␴X), where considerably more background information is available, we generated all possible single, double, and triple mutant strains. This collection was then screened for defects in multicellular differentiation and motility, as well as sensitivity against a multitude of chemical compounds utilizing Phenotypic MicroArrays (1). ECF ␴ factors ␴M, ␴W, and ␴X are important for multicellular differentiation but not motility or sporulation. To address the role of ECF ␴ factors in multicellular differentiation, strains were inoculated in MSgg minimal medium or spotted on MSgg plates to allow pellicle formation or colony differentiation, respectively (3). As expected, the strain 168 derivative CU1065 formed undifferentiated round colonies and only formed a flat, skin-like pellicle. In contrast, NCIB3610 forms complex colony patterns on MSgg plates and thick, wrinkled pellicles in MSgg medium (Fig. 1A and B). The quadruple mutant HB0842 (lacking ␴V, ␴Y, ␴Z, and ␴YlaC) behaved indistinguishably from the corresponding wild type. In contrast, the triple mutant MWX strain completely lost its ability to differentiate on MSgg plates, forming small and relatively uniform-looking colonies and grew very poorly at the liquidair interface in MSgg medium. This behavior was unique to

the MWX triple mutant, since all related double and single mutants behaved just like the wild type (Fig. 1C). These results indicate that these three ␴ factors have overlapping functions with respect to complex processes of multicellular differentiation. Despite the obvious defects in pellicle formation and complex colony architecture, there were no measurable defects for these strains in either sporulation efficiency (in liquid culture) or swarming motility (data not shown). We reasoned that strains lacking additional ECF ␴ factors might uncover defects in these processes. However, even the four quadruple mutant strains constructed from the MWX triple mutant by individual insertional inactivation of one of the remaining ECF ␴ factors (Table 1, HB0842 to HB0847) did not have any phenotypic defects in these assays (data not shown). Therefore, these ECF ␴ factors appear not to be involved in the regulation of motility or sporulation in B. subtilis. However, it remains formally possible that additional defects might be uncovered if all seven ECF ␴ factors were deleted. Growth of the MWX triple mutant is affected in LB but not in MSgg medium. The phenotype of the MWX mutant strain on MSgg plates and in MSgg medium seemed to indicate poor growth (Fig. 1B), at least under the tested conditions. We therefore investigated the growth behavior of various ECF mutant strains. Growth of the MWX triple mutant and the quadruple mutant HB0842 (lacking ␴V, ␴Y, ␴Z, and ␴YlaC) in MSgg medium was unaffected at 37°C with aeration (Fig. 2A). To our surprise, the MWX triple mutant, but none of the component double mutants, showed a reproducible biphasic growth behavior when incubated in LB medium at 37°C with

6924

MASCHER ET AL.

J. BACTERIOL.

FIG. 2. Growth of NCIB3610 (WT) and the derived triple (HB0834 [WXM]) and quadruple (HB0842 [VYZC]) mutants in MSgg medium (A) and LB medium (B). Ten milliliters of prewarmed medium (without antibiotics) was inoculated with 50 ␮l of a fresh overnight LB culture (grown with selection) and incubated at 37°C with aeration. Samples were taken at the indicated time points, and the growth was monitored by measuring the optical density at 600 nm (OD600).

aeration (Fig. 2B and data not shown). The culture grew at a slightly slower rate, and there was a drop in optical density at the end of the logarithmic growth phase. Reinoculation experiments indicate that this is a stable trait of the MWX mutant and does not reflect outgrowth of a mutant subpopulation. Phase-contrast microscopy (data not shown) failed to reveal any dramatic changes in cell morphology, suggesting that the drop in turbidity was likely due to partial lysis of the culture. A global sensitivity screen revealed new phenotypes linked to the ECF ␴ factors ␴M, ␴W, and ␴X in HB0834. ECF ␴ factors are involved in the maintenance of cell envelope integrity and regulate functions that contribute to the innate resistance of B. subtilis against antibacterial compounds such as bacitracin, fosfomycin, and nisin. However, some compounds (e.g., cephalosporin C) can induce ECF ␴-dependent stress responses, and yet single mutants are not more sensitive to these agents (7–10). In light of the known regulatory overlap among ECF ␴ factors and the results presented above, we reasoned that the roles of ECF ␴ factors in resistance to some antibiotics may only be apparent in multiple-mutant strains. As one approach to testing a broad range of stress conditions, we examined the sensitivity of NCIB3610, the MWX triple mutant and the quadruple mutant (HB0842) against a variety of chemical stresses using Phenotype MicroArrays. Phenotype microarrays allow the analysis of hundreds of physiological tests in parallel, thereby enabling the fast and accurate identification of novel traits linked to genetic alterations (1, 34, 40). Remarkably, a comparison of the quadruple mutant HB0842 with the isogenic wild type revealed only three significant differences in growth: the mutant grew better than wild type in the presence of chloramphenicol, neomycin, and piperacillin. The first two phenotypes are explained by the use of chloramphenicol and neomycin resistance cassettes in the strain construction. Thus, despite the deletion of four presumed regulatory proteins (␴V, ␴Y, ␴Z, and ␴YlaC), the only detectable difference in this assay is a slightly increased resistance to piperacillin. In contrast, the MWX triple mutant was clearly sensitive to a broad range of chemicals (Table 3). Many of these sensitivities were anticipated from the known phenotypes of the single mutants. This includes, for example, the known sensitivity of

sigW mutants to fosfomycin (7) and sigM mutants to bacitracin (9). As expected, resistance to chloramphenicol and kanamycin was detected as gained phenotypes, consistent with the use of these resistance cassettes to delete the genes encoding ECF ␴ factors. Note that the concentrations of erythromycin and kanamycin in these assays were too low to suppress the growth of B. subtilis and that spectinomycin was not represented on the sensitivity plates available at the time of the analysis. The most obvious and noteworthy phenotypes detected in the MWX triple mutant were the increased sensitivities to acidic (pH 4.5) or basic (pH 9.5) growth conditions, several detergents {including lauroylsarcosine, Triton X-100, CHAPSO (3-[(3cholamidopropyl)-dimethylammonio]-2-hydroxy-1-propanesulfonate), lauryl sulfobetaine, and dodecyl maltoside}, ␤-lactam antibiotics (including seven different cephalosporins), and D-cycloserine. While the sensitivity to low-pH conditions was anticipated from the phenotype of the sigM single mutant (18), the remaining phenotypes have not previously been associated with mutation of ECF ␴ factors in B. subtilis. Several of these and related antibacterial compounds were therefore chosen for further in-depth analyses. In addition, several antibiotics previously shown to have ECF ␴ factor-related resistance determinants (bacitracin, fosfomycin, moenomycin, and nisin; the latter was not present on the phenotype microarray) were also included in our analysis. ␴M, ␴W, and ␴X play a crucial role in the innate resistance of B. subtilis against inhibitors of cell envelope integrity. We performed disk diffusion assays for NCIB3610 and the corresponding mutants as described previously (11). The quantified data (average of at least two assays with two independent mutants) for representative compounds are shown in Fig. 3, and the sites of action for several of the cell wall biosynthesis inhibitors are summarized in Fig. 4A. Previous studies indicated that the ECF ␴ factor-mediated resistance of B. subtilis 168 against bacitracin and fosfomycin is linked to the regulation of the bcrC and fosB genes, respectively. Expression of bcrC is mediated by ␴M and ␴X, while fosB is expressed in a ␴W-dependent manner (7, 9). The present results support the hypothesis that ␴M is a primary determinant for bacitracin resistance, while ␴W is key for fosfomycin resistance. However,

VOL. 189, 2007

REGULATORY OVERLAP AMONG B. SUBTILIS ECF ␴ FACTORS

6925

FIG. 3. Disk diffusion assays of antibiotic sensitivity. Each bar represents the average zone of inhibition of at least two assays performed with two independent clones of each deletion mutant (deleted sigma factors are shown on the x axis). The y axis shows the zone of inhibition (in millimeters), expressed as total diameter minus diameter of the filter paper disk (5.5 mm). Note that the scale of the individual antibiotics varies for reasons of clarity. NCIB, NCIB3610; SDS, sodium dodecyl sulfate.

we additionally observed a further increase in both bacitracin and fosfomycin sensitivity in the MWX triple mutant (Fig. 3). Resistance against ␤-lactams is mostly mediated by the concerted action of ␴W and ␴X. Overall, the effect is more pronounced with penicillins (Fig. 3, ampicillin), while only a weak to moderate effect was observed for cephalosporins (Fig. 3, cephalosporin C). Comparable results were obtained for penicillin G and carbenicillin (penicillins), as well as cefotaxim/ ceoxitin (cephalosporins) (data not shown). The most pronounced example of a concerted action of all three ECF ␴ factors was D-cycloserine, where increased sensitivity was observed only in the triple mutant, while all single and double mutants behaved indistinguishably from the wild-type strain NCIB3610 (Fig. 3). Similarly, sensitivity to nisin, sodium dodecyl sulfate, polymyxin B, and Triton X-100 was in each case most dramatic for the triple mutant (Fig. 3; also data not shown).

Concluding remarks. The results presented here emphasize the complex and overlapping roles of ECF ␴ factors in B. subtilis physiology. One surprising result of this study is the lack of any phenotype for a quadruple mutant inactivated for four of the seven B. subtilis ECF ␴ factors (␴V, ␴Y, ␴Z, and ␴YlaC). The ␴Y regulon has been found to consist of its own (autoregulated) operon, possibly encoding a toxic peptide and accompanying export machinery, and a single unlinked gene (ybgB) encoding a protein similar to immunity proteins that protect against toxic peptides (6, 12). No regulatory overlap was observed with any other ECF ␴ factors, and its physiological role is unclear. Interestingly, genes activated by the overexpression of ␴V have been identified, and most appear to overlap with the known targets for ␴M, ␴W, and ␴X (39). Thus, ␴V may, under some growth conditions, also contribute to expression of some of the same genes. The roles of the ␴Z and

6926

J. BACTERIOL.

MASCHER ET AL.

FIG. 4. (A) Schematic diagram of the steps in peptidoglycan synthesis (in gray) inhibited by various tested antibiotics. The ECF ␴ factors (or combinations thereof) responsible for mediating resistance against each drug are given. GlcNAc, N-acetylglucosamine; MurNAC, N-acetyl muramic acid; 3aa and 5aa, tri- and pentapeptide side chains, respectively; C55⬃P/⬃PP, undecaprenyl (pyro)phosphate. (B) Weblogo representation (generated at http://weblogo.berkeley.edu/logo.cgi) of the position weight matrices (promoter consensus sequences) for recognition by ␴M, ␴W, and ␴X. At bottom, a virtual overall consensus for the three ECF ␴ factors is given which was generated by combining all target promoters of the three corresponding regulons. The promoters used for determining the consensus sequences are derived from either published tabulations (6, 8, 10, 22) or from our unpublished results (for ␴M).

␴YlaC factors are presently unclear, although it has been suggested that a ylaC mutant strain may be more sensitive to oxidative stress (31). A key finding of the present analyses relates to the regulatory overlap, and the corresponding functional consequences, for the ␴X, ␴W, and ␴M factors. The novel phenotypes revealed in the MWX triple mutant strain with respect to pellicle formation, colony morphology, and antibiotic sensitivity reveal a clear functional overlap. In principle, these results could be due to the control of separate, but functionally complementary, target genes by each of these ␴ factors. For example, a function needed for pellicle formation may be provided by any of three genes that are specifically transcribed as part of the ␴X, ␴W, and ␴M regulons. Alternatively, there may be one gene, or possibly more, that is essential for pellicle formation and is transcribed from a promoter that can be recognized by any of these three ECF ␴ factors. The actual situation may reflect some combination of these possibilities, although we favor the latter model. There are already several published examples of promoter sites that can be recognized by more than one ECF ␴ factor (9, 20, 22, 28). This overlap is perhaps not too surprising as the deduced consensus sequences

for recognition by ␴M, ␴W, and ␴X (Fig. 4B) are quite similar. Moreover, recent global analyses in Escherichia coli have revealed an unexpected extent of promoter overlap even among more distantly related ␴ factors (36). Ongoing studies to determine the complete regulons controlled by each of these regulators and the extent of regulon overlap will hopefully shed light on this and related questions. ACKNOWLEDGMENTS We thank Daniel Kearns (Indiana University) for phage SPP1 and advice on NCIB3610 genetics, Reinhold Bru ¨ckner and Regine Hakenbeck (Kaiserslautern) for the generous gift of various ␤-lactam antibiotics, and Dave Popham (Virginia Tech) for the gift of moenomycin. This work was supported by grant GM-47446 from the National Institutes of Health (to J.D.H.) and by grant MA 3269 from the Deutsche Forschungsgemeinschaft and grants from the Fonds der Chemischen Industrie (to T.M.). REFERENCES 1. Bochner, B. R., P. Gadzinski, and E. Panomitros. 2001. Phenotype microarrays for high-throughput phenotypic testing and assay of gene function. Genome Res. 11:1246–1255.

VOL. 189, 2007

REGULATORY OVERLAP AMONG B. SUBTILIS ECF ␴ FACTORS

2. Branda, S. S., F. Chu, D. B. Kearns, R. Losick, and R. Kolter. 2006. A major protein component of the Bacillus subtilis biofilm matrix. Mol. Microbiol. 59:1229–1238. 3. Branda, S. S., J. E. Gonzalez-Pastor, S. Ben-Yehuda, R. Losick, and R. Kolter. 2001. Fruiting body formation by Bacillus subtilis. Proc. Natl. Acad. Sci. USA 98:11621–11626. 4. Branda, S. S., J. E. Gonzalez-Pastor, E. Dervyn, S. D. Ehrlich, R. Losick, and R. Kolter. 2004. Genes involved in formation of structured multicellular communities by Bacillus subtilis. J. Bacteriol. 186:3970–3979. 5. Branda, S. S., S. Vik, L. Friedman, and R. Kolter. 2005. Biofilms: the matrix revisited. Trends Microbiol. 13:20–26. 6. Butcher, B. G., and J. D. Helmann. 2006. Identification of Bacillus subtilis ␴W-dependent genes that provide intrinsic resistance to antimicrobial compounds produced by bacilli. Mol. Microbiol. 60:765–782. 7. Cao, M., B. A. Bernat, Z. Wang, R. N. Armstrong, and J. D. Helmann. 2001. FosB, a cysteine-dependent fosfomycin resistance protein under the control of ␴W, an extracytoplasmic-function ␴ factor in Bacillus subtilis. J. Bacteriol. 183:2380–2383. 8. Cao, M., and J. D. Helmann. 2004. The Bacillus subtilis extracytoplasmicfunction ␴X factor regulates modification of the cell envelope and resistance to cationic antimicrobial peptides. J. Bacteriol. 186:1136–1146. 9. Cao, M., and J. D. Helmann. 2002. Regulation of the Bacillus subtilis bcrC bacitracin resistance gene by two extracytoplasmic function ␴ factors. J. Bacteriol. 184:6123–6129. 10. Cao, M., P. A. Kobel, M. M. Morshedi, M. F. Wu, C. Paddon, and J. D. Helmann. 2002. Defining the Bacillus subtilis ␴W regulon: a comparative analysis of promoter consensus search, run-off transcription/macroarray analysis (ROMA), and transcriptional profiling approaches. J. Mol. Biol. 316:443–457. 11. Cao, M., C. M. Moore, and J. D. Helmann. 2005. Bacillus subtilis paraquat resistance is directed by ␴M, an extracytoplasmic function sigma factor, and is conferred by YqjL and BcrC. J. Bacteriol. 187:2948–2956. 12. Cao, M., L. Salzberg, C. S. Tsai, T. Mascher, C. Bonilla, T. Wang, R. W. Ye, L. Marquez-Magana, and J. D. Helmann. 2003. Regulation of the Bacillus subtilis extracytoplasmic function protein ␴Y and its target promoters. J. Bacteriol. 185:4883–4890. 13. Cao, M., T. Wang, R. Ye, and J. D. Helmann. 2002. Antibiotics that inhibit cell wall biosynthesis induce expression of the Bacillus subtilis ␴W and ␴M regulons. Mol. Microbiol. 45:1267–1276. 14. Chu, F., D. B. Kearns, S. S. Branda, R. Kolter, and R. Losick. 2006. Targets of the master regulator of biofilm formation in Bacillus subtilis. Mol. Microbiol. 59:1216–1228. 15. Guerout-Fleury, A. M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic-resistance cassettes for Bacillus subtilis. Gene 167:335–336. 16. Harwood, C. R., and S. M. Cutting. 1990. Molecular biological methods for Bacillus. John Wiley and Sons, Chichester, United Kingdom. 17. Helmann, J. D. 2002. The extracytoplasmic function (ECF) sigma factors. Adv. Microb. Physiol. 46:47–110. 18. Horsburgh, M. J., and A. Moir. 1999. ␴M, an ECF RNA polymerase sigma factor of Bacillus subtilis 168, is essential for growth and survival in high concentrations of salt. Mol. Microbiol. 32:41–50. 19. Huang, X., A. Decatur, A. Sorokin, and J. D. Helmann. 1997. The Bacillus subtilis ␴X protein is an extracytoplasmic function sigma factor contributing to survival at high temperature. J. Bacteriol. 179:2915–2921. 20. Huang, X., K. L. Fredrick, and J. D. Helmann. 1998. Promoter recognition by Bacillus subtilis ␴W: autoregulation and partial overlap with the ␴X regulon. J. Bacteriol. 180:3765–3770. 21. Huang, X., and J. D. Helmann. 1998. Identification of target promoters for the Bacillus subtilis ␴X factor using a consensus-directed search. J. Mol. Biol. 279:165–173.

6927

22. Jervis, A. J., P. D. Thackray, C. W. Houston, M. J. Horsburgh, and A. Moir. 2007. SigM-responsive genes of Bacillus subtilis and their promoters. J. Bacteriol. 189:4534–4538. 23. Kearns, D. B., F. Chu, S. S. Branda, R. Kolter, and R. Losick. 2005. A master regulator for biofilm formation by Bacillus subtilis. Mol. Microbiol. 55:739– 749. 24. Kearns, D. B., F. Chu, R. Rudner, and R. Losick. 2004. Genes governing swarming in Bacillus subtilis and evidence for a phase variation mechanism controlling surface motility. Mol. Microbiol. 52:357–369. 25. Kearns, D. B., and R. Losick. 2003. Swarming motility in undomesticated Bacillus subtilis. Mol. Microbiol. 49:581–590. 26. Kobayashi, K. 2007. Bacillus subtilis pellicle formation proceeds through genetically defined morphological changes. J. Bacteriol. 189:4920–4931. 27. Mascher, T., N. G. Margulis, T. Wang, R. W. Ye, and J. D. Helmann. 2003. Cell wall stress responses in Bacillus subtilis: the regulatory network of the bacitracin stimulon. Mol. Microbiol. 50:1591–1604. 28. Minnig, K., J. L. Barblan, S. Kehl, S. B. Moller, and C. Mauel. 2003. In Bacillus subtilis W23, the duet ␴X ␴M, two sigma factors of the extracytoplasmic function subfamily, are required for septum and wall synthesis under batch culture conditions. Mol. Microbiol. 49:1435–1447. 29. Pietia ¨inen, M., M. Gardemeister, M. Mecklin, S. Leskela, M. Sarvas, and V. P. Kontinen. 2005. Cationic antimicrobial peptides elicit a complex stress response in Bacillus subtilis that involves ECF-type sigma factors and twocomponent signal transduction systems. Microbiology 151:1577–1592. 30. Qiu, J., and J. D. Helmann. 2001. The ⫺10 region is a key promoter specificity determinant for the Bacillus subtilis extracytoplasmic-function ␴ factors ␴X and ␴W. J. Bacteriol. 183:1921–1927. 31. Ryu, H. B., I. Shin, H. S. Yim, and S. O. Kang. 2006. YlaC is an extracytoplasmic function (ECF) sigma factor contributing to hydrogen peroxide resistance in Bacillus subtilis. J. Microbiol. 44:206–216. 32. Stanley, N. R., and B. A. Lazazzera. 2005. Defining the genetic differences between wild and domestic strains of Bacillus subtilis that affect poly-␥-DLglutamic acid production and biofilm formation. Mol. Microbiol. 57:1143– 1158. 33. Thackray, P. D., and A. Moir. 2003. SigM, an extracytoplasmic function sigma factor of Bacillus subtilis, is activated in response to cell wall antibiotics, ethanol, heat, acid, and superoxide stress. J. Bacteriol. 185:3491–3498. 34. von Eiff, C., P. McNamara, K. Becker, D. Bates, X. H. Lei, M. Ziman, B. R. Bochner, G. Peters, and R. A. Proctor. 2006. Phenotype microarray profiling of Staphylococcus aureus menD and hemB mutants with the small-colonyvariant phenotype. J. Bacteriol. 188:687–693. 35. Wach, A. 1996. PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12:259–265. 36. Wade, J. T., D. C. Roa, D. C. Grainger, D. Hurd, S. J. Busby, K. Struhl, and E. Nudler. 2006. Extensive functional overlap between sigma factors in Escherichia coli. Nat. Struct. Mol. Biol. 13:806–814. 37. Wiegert, T., G. Homuth, S. Versteeg, and W. Schumann. 2001. Alkaline shock induces the Bacillus subtilis ␴W regulon. Mol. Microbiol. 41:59–71. 38. Youngman, P. 1990. Use of transposons and integrational vectors for mutagenesis and construction of gene fusions in Bacillus subtilis, p. 221–266. In C. R. Harwood and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley and Sons, Chichester, United Kingdom. 39. Zellmeier, S., C. Hofmann, S. Thomas, T. Wiegert, and W. Schumann. 2005. Identification of ␴V-dependent genes of Bacillus subtilis. FEMS Microbiol. Lett. 253:221–229. 40. Zhou, L., X.-H. Lei, B. R. Bochner, and B. L. Wanner. 2003. Phenotype microarray analysis of Escherichia coli K-12 mutants with deletions of all two-component systems. J. Bacteriol. 185:4956–4972.