0013-7227/07/$15.00/0 Printed in U.S.A.
Endocrinology 148(9):4440 – 4449 Copyright © 2007 by The Endocrine Society doi: 10.1210/en.2007-0441
Evidence that Ghrelin Is as Potent as Growth Hormone (GH)-Releasing Hormone (GHRH) in Releasing GH from Primary Pituitary Cell Cultures of a Nonhuman Primate (Papio anubis), Acting through Intracellular Signaling Pathways Distinct from GHRH Rhonda D. Kineman and Raul M. Luque Section of Endocrinology, Diabetes and Metabolism, Department of Medicine, University of Illinois at Chicago; and Research and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois 60612 Ghrelin is more effective than GHRH in stimulating GH release in normal adult humans and monkeys in vivo. This robust effect of ghrelin has been largely attributed to regulation of hypothalamic input, whereas the direct effect of ghrelin on pituitary GH release has been minimized by the observation that ghrelin has only a modest impact on GH release, compared with GHRH, in cultures prepared from human fetal pituitaries and GH-producing adenomas, as well as pituitaries from nonprimate species. However, comparable in vitro studies have not been performed to test the direct effect of ghrelin on normal adult primates. Therefore, in the present study, primary pituitary cell cultures from female baboons (Papio anubis) were used as a model system to test the direct effects of ghrelin on primate somatotrope
I
N VIVO, GH SECRETION is stimulated by exogenous treatment with GHRH and ghrelin and inhibited by somatostatin (SST) (1–3). It is clear that the positive actions of GHRH on GH release are largely mediated by direct interaction with pituitary somatotropes (1, 4). In contrast, animal studies indicate that the GH-releasing activities of ghrelin are mediated by both central augmentation of GHRH release (5, 6), coupled with suppression of SST tone (7), in addition to direct effects at the pituitary level (8 –10). In humans, the relative contribution of the central vs. the direct pituitary actions of ghrelin on GH release remains a subject of debate. A role for ghrelin-induced GHRH release is supported by the observation that the GH-releasing actions of a synthetic ghrelin analog (GHRP-6) are blunted in the presence of a GHRH-receptor (GHRH-R) antagonist (11), and ghrelin has only modest effects on GH output in individuals with hypothalamic-pituitary disconnection (12–14) and in patients with inactivating mutaFirst Published Online May 31, 2007 Abbreviations: AC, Adenylyl cyclase; GC, guanylyl cyclase; GHRH-R, GHRH receptor; GHS, GH secretagogue; GHS-R, GH secretagogue receptor; L-NAME, N-nitro-l-arginine methyl ester; NOS, nitric oxide synthase; PKA, protein kinase A; PKC, protein kinase C; PLC, phospholipase; PRL, prolactin; qrtRT-PCR, quantitative real-time RTPCR; SST, somatostatin; TPA, phorbol 12-myristate 13-acetate. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.
function. In this model, both ghrelin and GHRH increased GH release in a dose-dependent fashion. Surprisingly, at maximal concentrations (10 nM), both ghrelin and GHRH elicited a robust increase in GH release (4 and 24 h, respectively), and both up-regulated GH secretagogue-receptor and GHRH-receptor mRNA levels (24 h). Combined treatment with ghrelin and GHRH resulted in an additive effect on GH release, suggesting that distinct intracellular signaling pathways are activated by each ligand, as confirmed by the use of specific inhibitors of intracellular signaling. Together, these results present the first evidence that a direct effect of ghrelin on somatotrope function may play a major role in stimulating GH release in primates. (Endocrinology 148: 4440 – 4449, 2007)
tions in the GHRH-R (15, 16). However, a dominant role for ghrelin-induced GHRH release in modulating GH output is questioned by reports showing that ghrelin-induced GH release is consistently higher than that evoked by a maximally effective dose of GHRH (14, 17–21). In addition, bolus injection of ghrelin or its synthetic analogs [GH secretagogues (GHSs)] can act synergistically with GHRH to release GH (18, 21, 22), and GHRP-6 remains an effective GH-releasing agent even after continuous GHRH infusion (23). A dominant role for SST in ghrelin-mediated regulation of GH release is also questioned by the recent finding that the GH response to ghrelin does not vary among states of low, medium, and high-SST tone (24). All the aforementioned in vivo observations, coupled with the fact that the GH-releasing actions of ghrelin (or GHS) are modest compared with those of GHRH, in primary cultures established from human fetal pituitaries (25, 26), GH-producing pituitary adenomas (25), and in pituitary cultures from nonprimate animal models (9, 27–29), have led to the hypothesis that in humans, ghrelin mediates a yet to be identified factor(s) important in GH release (30, 31). However, it should be noted that the direct pituitary effects of ghrelin on GH release in normal, adult humans remain unknown. Therefore, the present study was conducted using primary pituitary cell cultures prepared from normal adult baboons (Papio anubis) as a primate model to compare and contrast the direct impact of ghrelin and
4440
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
Endocrinology, September 2007, 148(9):4440 – 4449
GHRH alone, and in combination on GH release, synthesis, and intracellular signaling. Materials and Methods
4441
serum-free basic media. Each treatment was repeated a minimum of three times on different pituitary cell preparations (three to four wells per treatment per experiment).
Hormone and cAMP analysis
Culture reagents All reagents used in this study were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise specified. Ghrelin was purchased from Phoenix Pharmaceuticals (Burlingame, CA). ␣-Minimum essential media, HEPES, horse serum, and penicillin-streptomycin were obtained from Invitrogen (Grand Island, NY). Activators [forskolin and phorbol 12-myristate 13-acetate (TPA)] and inhibitors (MDL-12,330A, H-89, Go6983, PD-98,059, LY-294,002, Nifedipine, ethapsigargin) of intracellular signaling pathways were purchased from Sigma-Aldrich, except U73122, N-nitro-l-arginine methyl ester (L-NAME), and LY-83,583, which were purchased from Cayman Chemical (Ann Arbor, MI).
Culture media were recovered and stored at ⫺80 C for subsequent analysis of GH concentrations using a human GH ELISA (Diagnostic Systems Laboratories, Inc., Webster, TX). In addition, to verify the specificity of the response, prolactin (PRL) levels were measured on select samples using a human PRL ELISA (Diagnostic Systems Laboratories, Inc.). In some cultures, media were removed, lysis buffer was added, and lysates were recovered and stored at ⫺80 C for analysis of intracellular cAMP accumulation, as assessed by the cAMP Biotrack EIA system following protocol 3 of the manufacturer’s instructions (Amersham Biosciences, Piscataway, NJ).
Animals and pituitary collection
RNA isolation and quantitative real-time RT-PCR
Pituitaries were obtained from randomly cycling female baboons (P. anubis, 15–25 yr of age) within 15 min after sodium pentobarbital overdose. The baboons used represent control animals from a breeding colony, all under Institutional Animal Care and Use Committee approved studies conducted by other University of Illinois at Chicago investigators. After killing, the pituitaries were excised immediately. For some pituitaries, the posterior pituitary was removed and the remaining anterior pituitary cut into small pieces (⬃20 – 40 mg), which were rapidly frozen in liquid nitrogen and stored at ⫺80 C until extraction for total RNA (see below, RNA isolation). Other pituitaries were placed in sterile cold (4 C) basic media consisting of ␣-minimum essential media, 0.15% BSA, 6 mm HEPES, and 10 IU/ml penicillin and 10 g/ml streptomycin, and transported to the laboratory, where they were washed twice with fresh media, the posterior lobes were discarded, and tissue was dispersed into single cells for culture (see below, Primary pituitary cell culture).
Total RNA from primary pituitary cell cultures and whole tissue was extracted using the Absolutely RNA RT-PCR Miniprep Kit (Stratagene, La Jolla, CA) with deoxyribonuclease treatment, as previously described (32, 33). The amount of RNA recovered was determined by the Ribogreen RNA quantification kit (Molecular Probes, Eugene, OR). Total RNA was reversed transcribed in a 20-l vol using random hexamer primers with enzyme and reagents supplied in the cDNA First Strand Synthesis kit (MRI Fermentas, Hanover, MD). The cDNA obtained was treated with Ribonuclease H (1 U; MRI Fermentas), and duplicate aliquots (1 l) were amplified by quantitative real-time RT-PCR (qrtRTPCR) using the Stratagene Brilliant SYBR green QPCR Master Mix. Details regarding the development, validation, and application of a qrtRT-PCR to measure expression levels of baboon GH, GHRH-R, GH secretagogue receptor (GHS-R), and cyclophilin A (used as a housekeeping gene) have been recently reported by our laboratory (32, 33). To identify an appropriate primer set for real-time amplification of baboon PRL cDNA, a partial sequence of the coding region of the baboon PRL gene was obtained by PCR sequencing using PCR-amplified cDNA products from total RNA extracted from baboon anterior pituitaries, as previously described. This sequence (559 bp) was submitted to GenBank (no. EF419886) and used to select baboon-specific primers for real-time PCR that amplified an 183-bp product, using an annealing temperature of 61 C. Primer sets for baboon GH, GHRH-R, GHS-R, PRL, and cyclophilin A used in this study are provided in Table 1.
Primary pituitary cell culture Anterior pituitaries were dispersed into single cells after an enzymatic and mechanical disruption, as previously described (32, 33). A single pituitary yielded approximately 25 ⫻ 106 cells with more than 98% viability, as determined by the trypan blue dye exclusion method (American Type Culture Collection, Manassas, VA). Cells were plated onto 24-well tissue culture plates at a density of 200,000 cells per well in 0.5 ml basic media containing 10% horse serum. After a 48-h incubation (37 C), media were removed, and cells were preincubated for 1 h with fresh, warm (37 C) serum-free media to stabilize basal GH secretion. After the preincubation period, media were replaced with serum-free media containing treatments consisting of either human GHRH or ghrelin alone, or in combination, forskolin, or TPA. After a 4 or 24-h incubation period, media were recovered for hormone analysis, whereas cells were extracted for total RNA (see below). In experiments using inhibitors of intracellular signaling, media containing the inhibitors were added after the 1-h preincubation period. Ninety minutes later, the media were exchanged with media containing the inhibitor combined with GHRH and/or ghrelin and incubated for an additional 4 h, and media were recovered for hormone analysis. Controls consisted of cells cultured in
Statistical analysis Basal mRNA values and GH released into the media did vary between pituitary cell preparations, likely due to variations in age, body condition, and reproductive status, which were out of our control. Therefore, within each experiment, values were normalized to vehicle-treated controls (set at 100%), and the results are reported as means ⫾ sem of all experiments. Each treatment group was tested on a minimum of three separate pituitary cultures prepared from different animals, and within each pituitary cell preparation (experiment), the treatment was repeated in three to four wells. Differences among treatment groups were assessed by ANOVA (one or two-way ANOVA), followed by NewmanKeuls test for multiple comparisons. P ⬍ 0.05 was considered significant.
TABLE 1. Baboon-specific primers for amplification of transcripts of GH, GHRH-R, GHS-R, PRL, and cyclophilin A used for qrtRT-PCR GenBank accession no.
Primer sequence
Nucleotide position
GH
Gene
DQ340390
GHRH-R
DQ340391
GHS-R
DQ340392
PRL
EF419886
Cyclophilin A
DQ315473
Sense: GACCTAGAGGAAGGCATCCAAA Antisense: AGCAGCCCGTAGTTCTTGAGTAG Sense: TCACCATCCTGGTTGCTCTC Antisense: GCAGCATCCTTCAGGAACAC Sense: GTGTGGGTGTCCAGCATCTT Antisense: CACGGTTTGCTTGTGGTTCT Sense: CCTTCGAGACCTGTTTGACC Antisense: ATCTGTTGGGCTTGCTCCTT Sense: CAAGACGGAGTGGTTGGATG Antisense: TGGTGGTCTTCTTGCTGGTC
Sn 21 As 163 Sn 74 As 185 Sn 389 As 535 Sn 14 As 196 Sn 351 As 472
Product size (bp)
143 112 147 183 122
4442
Endocrinology, September 2007, 148(9):4440 – 4449
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
All statistical analyses were performed using the GB-STAT software package (Dynamic Microsystems, Inc., Silver Spring, MD).
Results and Discussion Validity of baboon primary pituitary cell culture as an appropriate model to predict how ghrelin/GHRH modulates human somatotrope function
GH release (% of control)
Our understanding of the direct pituitary effects of ghrelin/GHRH-mediated GH secretion has largely been formed by studies conducted in nonprimate species, or in pituitary cell cultures established from human fetal pituitaries or GHproducing adenomas (9, 10, 25–27, 29, 34 –37). For the most part, the results indicate that the direct effects of ghrelin on GH release are modest compared with GHRH and cannot explain the dramatic in vivo effect of ghrelin on GH release in normal human adults (14, 17–21). However, to date, an appropriate model system has not been used to discount unequivocally a major role for the direct actions of ghrelin in mediating human GH release. Given that many similarities exist at the physiological and genomic levels between human and subhuman primates, the latter have been used to test a variety of hypotheses that cannot be tested in human subjects. In fact, it has been previously reported that rhesus monkeys, like humans, have a robust in vivo response to ghrelin (38), indicating that nonhuman primate models can be appropriate models to study the mechanisms by which ghrelin mediates GH release in humans. In the current report, baboon (P. anubis) pituitary cell cultures were used to supply the first information regarding the direct actions of ghrelin on GH secretion in primates. Comparison of partial baboon mRNA sequences [generated in this and previous studies (32, 33)] with human sequences important in GH release and synthesis revealed a close homology (GH 98%, GHRH-R 99%, GHS-R 97%, PRL 97%, and PIT1 97%), whereas the baboon sequences diverged from nonprimate species (73– 91% homologous when compared with transcripts of pig, rat, mouse, and sheep). Together, these findings suggest that information gained regarding regulation of somatotrope function in primary pituitary cell cultures from baboons can be extrapolated to humans. 1000
d c,d
GHRH
Primary pituitary cell cultures
271,597 ⫾ 96,891 5,741 ⫾ 1,216 1,635 ⫾ 430 1,210,160 ⫾ 444,960 143,585 ⫾ 11,902
336,047 ⫾ 116,149 7,535 ⫾ 2,300 1,711 ⫾ 604 1,429,300 ⫾ 400,893 119,122 ⫾ 24,001
Values represent means ⫾ SEM. There were five separate whole pituitary extracts and seven separate primary pituitary cell cultures.
To confirm that the baboon primary pituitary cells maintain differentiated function after dispersion and culture, the absolute mRNA levels (copy numbers/0.05 g total RNA) of GH, GHRH-R, GHS-R, PRL, and cyclophilin A (used as a housekeeping gene) were compared between whole tissue extracts and extracts prepared from pituitary cultures 4 h after incubation in serum-free media, and the results are shown in Table 2. Transcript levels did not significantly vary between in vivo and in vitro samples, indicating that the cell preparation and culture conditions did not dramatically impact gene expression important in somatotrope function. It should also be noted that in these tissue extracts and pituitary cell preparations from female baboons, PRL expression was greater than GH, consistent with previous reports demonstrating that lactotropes are more abundant than somatotropes in female pituitaries (39, 40). Together, these results indicate that the culture system used maintains differentiated somatotrope function, and real-time RT-PCR can accurately reflect physiologically relevant differences in gene expression. Direct effects of GHRH and ghrelin on GH release
As shown in Fig. 1, both GHRH and ghrelin (4 h incubation) stimulated GH release from baboon pituitary cell cultures in a concentration-dependent manner. Specifically, GHRH stimulated basal GH release from baboon somato1000
Ghrelin
d
d
10-8
10-7
c,d
600
600
b,c
b,c 400
400
0
GH GHRH-R GHS-R PRL Cyclophilin A
Whole pituitary
800
800
200
TABLE 2. Absolute cDNA copy number/0.05 g total RNA of gene transcripts in the whole pituitary vs. primary pituitary cell cultures (control groups) of female baboons, as determined by qrtRT-PCR
a
a,b
a,b
a,b
200 0
Con 10-11 10-10
10-9
10-8
10-7
a Con 10-11 10-10
10-9
Concentration (-Log M) FIG. 1. Effect of GHRH (left) or ghrelin (right) treatment (4 h) on GH release from baboon pituitary cell cultures. Data are expressed as percentage of controls (Con), set at 100% within each experiment, and represent the mean ⫾ SEM of four independent experiments (three to four wells per treatment per experiment). Dose responses were assessed by one-way ANOVA, and values that do not share a common letter (a, b, c, or d) significantly differ (P ⬍ 0.05).
tropes at doses equal or more than 10⫺9 m, whereas ghrelin consistently released GH at 10⫺10 m or higher. Neither ghrelin nor GHRH altered PRL release at a maximal dose (10 nm; data not shown), which is at odds with previous reports showing that ghrelin could enhance PRL release in fetal pituitary preparations and in PRL-producing adenomas (25), indicating that the physiological/pathophysiological state dictates the specific effect of ghrelin on pituitary hormone release. Although ghrelin proved more potent than GHRH in releasing GH, the maximal effect of both secretagogues was similar. It should be noted that the absolute impact of ghrelin on GH release at a maximal dose (10 nm) ranged from 2.5fold, to as high as 80-fold more than vehicle-treated controls, depending on the individual pituitary preparation. We also observed that within each cell preparation, the relative magnitude of response to GHRH paralleled that of ghrelin. These findings are consistent with reports in vivo showing that human responses to ghrelin are variable, with mean responses ranging from 2.5- to 190-fold of baseline (14, 18, 19, 24, 41). These initial findings demonstrate that, in contrast to the modest effect of ghrelin on pituitary cell cultures prepared from nonprimate species (8 –10, 27, 29, 42), the direct effects of ghrelin on GH release in a primate model are dramatic and comparable to that of GHRH. Therefore, these results present the possibility that a direct pituitary effect of ghrelin could play a dominant role in the dramatic increase in GH after ghrelin treatment in humans. Effects of ghrelin and GHRH on mRNA transcript levels important in somatotrope function
GHRH is a known stimulator of GH gene expression; however, to our knowledge, no studies have been conducted to examine the direct effects of ghrelin on GH gene expression. Studies have been conducted using GHS, and depending on the time of treatment and the species studied, either positive or no effects on GH mRNA levels have been observed (1, 42, 43). In the present study, treatment of primary baboon pituitary cell cultures with ghrelin at a dose that evoked maximal GH release (10 nm) did not significantly alter GH mRNA levels after 4 or 24 h of incubation (Fig. 2). However, 10 nm GHRH did result in a modest but significant increase in GH mRNA levels after 24 h treatment, which is consistent with previous reports (44 – 47), whereas neither ghrelin nor GHRH altered PRL mRNA levels (data not shown). Because it has been previously observed that ghrelin/GHS and GHRH can differentially regulate GHS-R and GHRH-R in a homologous and heterologous fashion depending on the time of incubation, culture conditions, species, and age studied (47–54), we also examined the impact of ghrelin and GHRH on regulating receptor synthesis in adult female baboon pituitary cell cultures. As shown in Fig. 3, ghrelin and GHRH resulted in acute (4 h) homologous down-regulation of their own receptor mRNA levels, whereas 24 h incubation significantly increased receptor expression. A biphasic effect of homologous regulation of receptor expression for both ghrelin and GHRH, has been previously reported in the rat (44, 48, 49, 51). Of interest is the observation that ghrelin and
Endocrinology, September 2007, 148(9):4440 – 4449
200
4443
4h
175 150 125
a
a
a
GHRH
Ghrelin
100 GH mRNA (% of vehicle-treated controls)
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
75 50 25 0 Control
200
24h
175
b
150 125
a a
100 75 50 25 0 Control
GHRH
Ghrelin
FIG. 2. Effect of 4- (top) and 24-h (bottom) treatment of GHRH or ghrelin (10 nM) on GH mRNA levels in primary pituitary cell cultures from baboons. The GH mRNA copy number was determined by qrtRTPCR, and values were adjusted by the cyclophilin A copy number as an internal control. Values are expressed as percentage of controls, set at 100% within each experiment, and represent the mean ⫾ SEM of four independent experiments (three to four wells per treatment per experiment). Values that do not share a common letter (a or b) differ significantly (P ⬍ 0.05).
GHRH could up-regulate mRNA levels of their respective receptors after 24 h treatment. These results suggest that sustained ghrelin stimulation enhances the effects of GHRHmediated signaling, whereas sustained GHRH stimulation in turn enhances the effects of ghrelin-mediated signaling by augmentation of receptor synthesis. Interaction and intracellular signaling pathways of ghrelin and GHRH-mediated GH release
In the majority of studies conducted to date, combined treatment with maximal doses of GHRH and ghrelin (or GHS) results in an additive effect on GH release in primary pituitary cell cultures prepared from nonprimate species (1, 28, 55–57). An additive effect of GHRH and GHS was also observed in cultures prepared from GH-producing human adenomas (25), suggesting that GHRH and ghrelin work through distinct intracellular pathways to release GH. Consistent with previous reports, the effect of combined treatment with a maximal dose of ghrelin and GHRH (10 nm each) on GH release was additive in baboon pituitary cell cultures after 4 h incubation (Fig. 4). The stimulatory effect of GHRH and ghrelin, when applied alone, was still evident after 24 h incubation, whereas the additive effect of combined treatment was lost. Therefore, subsequent studies using specific intracellular signaling inhibitors were conducted at the 4-h time point to define the specific pathways activated by ghrelin and GHRH to induce GH release.
4444
Endocrinology, September 2007, 148(9):4440 – 4449
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
GHS-R mRNA
GHRH-R mRNA
600
4h
c
500
4h a
a
100
125
a
100
400
b
b
50
50
25
25
0
0 Control GHRH Ghrelin
Control GHRH Ghrelin
24h 350 300 250 200 150 100 50 0
200
75
24h b b
a
Control GHRH Ghrelin
350 300 250 200 150 100 50 0
b
a
GH release (% of control)
mRNA (% of vehicle-treated controls)
75
b b
300
a
100 0
400
Control GHRH Ghrelin
GHRH + Ghrelin
24h b
b b
300
b
200 a 100 a
0 Control GHRH Ghrelin Control GHRH Ghrelin
FIG. 3. Effect of 4- and 24-h treatment of GHRH or ghrelin (10 nM) on GHRH-R (left) and GHS-R (right) mRNA levels in primary pituitary cell cultures from baboons. Receptor mRNA copy numbers were determined by qrtRT-PCR, and values were adjusted by the cyclophilin A copy number as an internal control. Values are expressed as percentage of controls, set at 100% within each experiment, and represent the mean ⫾ SEM of four independent experiments (three to four wells per treatment per experiment). Values that do not share a common letter (a or b) differ significantly (P ⬍ 0.05).
Based on previous reports demonstrating that GHRH stimulates the release of GH by activation of adenylyl cyclase (AC)/cAMP/protein kinase A (PKA) intracellular signaling pathway, whereas ghrelin exerts its positive effects on GH release mainly through the phospholipase C (PLC)/inositol triphosphate/protein kinase C (PKC) route (1, 58, 59), we first verified that receptor-independent activation of these pathways by forskolin (a direct activator of AC) and TPA (a direct activator of PKC) could also release GH in baboon pituitary cultures. As anticipated, both forskolin (1 m) and TPA (0.1 m) resulted in a robust release of GH compared with vehicle-treated controls (Fig. 5). To test whether the separate initiation of these pathways is important in GHRHand ghrelin-mediated GH release, cells were pretreated with an inhibitor of AC (MDL-12.330A; 10 m) or PLC (U73122; 50 m) 90 min before application of GHRH and ghrelin alone, and in combination (Fig. 6). In keeping with the essential role of the AC/cAMP/PKA pathway in GH-releasing activity of GHRH and the PLC/inositol triphosphate/PKC pathway in the GH-releasing activity of ghrelin (1, 58, 59), inhibition of AC activity effectively blocked GHRH-mediated GH release, whereas inhibition of PLC activity abolished ghrelin-mediated GH release. These results indicate that unique intracellular signaling pathways are activated by the separate application of GHRH and ghrelin. This conclusion is further
GHRH + Ghrelin
FIG. 4. Effect of 4- (top) and 24-h (bottom) treatment of GHRH and/or ghrelin (10 nM) on GH secretion in primary pituitary cell cultures from baboons. Absolute GH values were 55 ⫾ 12 ng/ml after 4 h and 242 ⫾ 49 ng/ml after 24-h incubation. Values are expressed as percentage of controls, set at 100% within each experiment, and represent the mean ⫾ SEM of three to seven independent experiments (three to four wells per treatment per experiment). Values that do not share a common letter (a, b, or c) differ significantly (P ⬍ 0.05).
supported by the observation that GHRH increased intracellular cAMP accumulation, whereas ghrelin did not (Fig. 7). These results are similar to that reported using GHSs in GH-producing adenomas (37), and primary pituitary cell cultures from rat (60, 61) and sheep (61). However, these results are in stark contrast to the pig, in which both GHRH and ghrelin augment cAMP production, and require AC activity to evoke GH release (10), further demonstrating that there are distinct species’ differences in the intracellular pathways linked to ghrelin-mediated GH secretion. GH release (% of control)
125
4h
1000 800
**
600 400 200 0 Control Forskolin
300 250 200 150 100 50 0
**
Control TPA
FIG. 5. Effect of forskolin (a direct activator of AC) and TPA (a direct activator of PKC) on GH release (4 h) in primary pituitary cell cultures from baboons. Data are expressed as percentage of controls, set at 100% within each experiment, and represent the mean ⫾ SEM of three independent experiments (three to four wells per treatment per experiment). Asterisks indicate values that significantly differ from their respective controls assessed by Student’s t test (**, P ⬍ 0.01).
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
Endocrinology, September 2007, 148(9):4440 – 4449
Role of adenylyl cyclase (AC) FIG. 6. Effect of inhibition of AC (MDL12,330A; 10 M) (left) or PLC (U73122; 50 M) (right) on GHRH and/or ghrelin-stimulated GH release in primary pituitary cell cultures from baboons. On the day of the experiment, inhibitors were added to the incubation media 90 min before GHRH and/or ghrelin (4 h, 10 nM each). Values are expressed as percentage of vehicle-treated controls, set at 100% within each experiment, and represent the mean ⫾ SEM of three independent experiments (three to four wells per treatment per experiment). P ⬍ 0.05: a, vs. control; b, vs. GHRH or ghrelin alone; and c, vs. the same treatment in absence of inhibitor.
GH release (% of control)
ab 400
400
cAMP levels (fmol/well)
0
300 a
200
c c
100
Control GHRH Ghrelin
b a
a
a
300
400
100
ab
500
500
c
200
U73122 600
600
500
300
Vehicle
MDL-12,330A
Despite ghrelin’s inability to enhance cAMP accumulation when applied alone, ghrelin did augment the actions of GHRH in this regard (Fig. 7). A similar observation using GHSs has been reported in primary pituitary cultures from sheep (61) and rats (60, 61). Interestingly, Cunha and Mayo (62) using Hela-T4 cells cotransfected with the GHRH-R and GHS-R also found that treatment with multiple GHSs and ghrelin did not enhance cAMP, whereas these treatments augmented GHRH-stimulated cAMP accumulation. These authors suggested that ligand-activation of both the GHRH-R and GHS-R results in the direct interaction of these receptors that leads to unique intracellular signaling events. We might speculate that such a situation may be involved in the baboon cultures in that we observed that although the AC inhibitor, MDL-12,330A, did not alter ghrelin-stimulated GH release, it did completely block the combined effects of GHRH and ghrelin (Fig. 6). In contrast, the PLC inhibitor, U73122, only partially blocked GH release when the ligands were applied in combination. Together, these results indicate that: 1) ghrelin alone, or in combination with GHRH, activates PLC to release GH; and 2) AC is essential for ghrelininduced GH release only when combined with GHRH. Additional studies are required to elucidate fully this complex interaction. Given the limited source of baboon pituitary tissue, subsequent studies were performed focusing on the intracellular 600
Role phospholipase C (PLC)
Vehicle
0
4445
a
Control GHRH Ghrelin GHRH + Ghrelin
FIG. 7. Effects of GHRH and ghrelin alone or in combination (4 h, 10 nM each) on cAMP accumulation in primary pituitary cell cultures from baboons. Absolute cAMP levels in control-treated group were 609 ⫾ 81 fmol/well. Values are expressed as percentage of controls, set at 100% within each experiment, and represent the mean ⫾ SEM of three independent experiments (three to four wells per treatment per experiment). Values that do not share a common letter (a, b, or c) differ significantly (P ⬍ 0.05).
a ac
a
200 100
GHRH + Ghrelin
a
0
c Control GHRH Ghrelin
GHRH + Ghrelin
signals important in GH release, when ghrelin and GHRH were applied separately. Inhibition of PKA activity by H-89 (15 m), as well as inhibition of PKC activity by Go6983 (20 m), completely blocked ghrelin-induced GH release, whereas only H-89 was effective in blocking GHRH-mediated GH release (Fig. 8). These results suggest the possibility that ghrelin may activate the PLC/PKC intracellular pathway that signals through PKA to evoke GH secretory vesicle release. Another possibility is that other intracellular signals are involved, as suggested by a report showing that ghrelin requires PKC, PKA, and MAPK to up-regulate Pit1 mRNA levels in primary infant rat pituitary cultures (63). In addition, multiple reports have suggested that these pathways interconnect to mediate various aspects of pituitary function (64 – 67). To determine whether MAPK is also involved in the ghrelin-mediated GH release observed in this report, baboon pituitary cell cultures were treated with an inhibitor to MAPK activity (PD-98,058, 10 m) before stimulation with ghrelin or GHRH (Fig. 8). Inhibition of MAPK activity did not alter GHRH-mediated GH release, as previously observed in human GH-secreting adenomas (68). However, MAPK was clearly required for GH release evoked by ghrelin. How MAPK, PKA, and PKC may interact to mediate the GH releasing effects of ghrelin remains to be determined. Recent reports have implicated that nitric oxide synthase (NOS) mediated generation of nitric oxide and subsequent activation of guanylyl cyclase (GC)-generated cGMP production as an additional intracellular signaling pathway necessary for both GHRH and ghrelin stimulation of GH release in cultures prepared from pigs (69, 70). In rats, NOS/GC is also required for GHRH-stimulated GH release (71), whereas the role of NOS/GC in ghrelin-mediated GH secretion has not been tested to date. In addition, it has been demonstrated that NOS and GC are expressed by somatotropes of different species, including humans (72–75). To determine whether the NOS/NO/GC/ cGMP pathway is required for GHRH- and ghrelin-mediated GH release in the primate pituitary, baboon cells were pretreated with an inhibitor of NOS activity (L-NAME, 10 m) or an inhibitor of GC activity (LY-83,583, 10 m) before GHRH or ghrelin application (Fig. 9, left panel). Both inhibitors completely blocked GHRH-induced GH release but did not affect ghrelinstimulated GH release. These results once again indicate distinct species’ differences in the intracellular pathways linked to ghrelin-mediated GH secretion.
4446
Endocrinology, September 2007, 148(9):4440 – 4449
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
GH release (% of control)
Role of PKA
350
Role of PKC
Vehicle
Vehicle
350
H-89 a
250
b
b
100
50
0
0 Control
GHRH
150
Ghrelin
b
b
100
50
a
200
150
150
a
a
250
200
200
Vehicle PD-98,059
300
a
a a
250
a
350
Go6983
300
300
Role of MAPK
100 50
Control
GHRH
0
Ghrelin
Control
GHRH
Ghrelin
FIG. 8. Effect of inhibition of PKA (H89; 15 M) (left), PKC (Go6983; 20 M) (middle), or MAPK (PD-98,059; 10 M) (right) on GHRH or ghrelin-stimulated GH release in primary pituitary cell cultures from baboons. On the day of the experiment, inhibitors were added to the incubation media 90 min before GHRH or ghrelin treatment (4 h, 10 nM). Values are expressed as percentage of vehicle-treated controls, set at 100% within each experiment, and represent the mean ⫾ SEM of three independent experiments (three to four wells per treatment per experiment). P ⬍ 0.05: a, vs. control; and b, vs. the same treatment in absence of inhibitor.
Finally, given the importance of the Ca2⫹ ion in the response of somatotropes to diverse stimuli (59, 76, 77) and the fact that the relative contribution of each source of Ca2⫹ (extracellular vs. intracellular) to ghrelin- and GHRH-mediated GH release is species dependent (10, 78 – 80), we also tested the relative contribution of extracellular and intracellular Ca2⫹ to ghrelin- and GHRH-induced GH release in baboon pituitary cell cultures. Blockade of plasma membrane L-type voltage-sensitive Ca2⫹ channels by nifedipine (1 m) to inhibit the influx of extracellular Ca2⫹ completely abolished both GHRH and ghrelin-stimulated GH release (Fig. 9,
right panel), whereas blockade of Ca2⫹ release from intracellular pools by thapsigargin (10 m) abolished GHRHinduced GH release but only blunted the effects of ghrelin (Fig. 9). Summary
The results presented here clearly show that ghrelin has a dramatic and potent effect on GH release in primate pituitary cell cultures comparable to that evoked by GHRH. This novel observation presents the exciting possibility that a direct
Role of extra- / intracellular Ca2+
Role of NOS/GC
Vehicle
Vehicle 400
L-NAME
400
Nifedipine
a a
300
a a
GH release (% of control)
FIG. 9. Effect of inhibition of NOS (L-NAME; 10 M), GC (LY-83,583; 10 M), extracellular Ca2⫹ channels (nifedipine; 1 M), or intracellular Ca2⫹ channels (thapsigargine; 10 M) on GHRH or ghrelin-stimulated GH release in primary pituitary cell cultures from baboons. Inhibitors were added to the incubation media 90 min before GHRH or ghrelin treatments (4 h, 10 nM). Values are expressed as percentage of vehicle-treated controls, set at 100% within each experiment, and represent the mean ⫾ SEM of three independent experiments (three to four wells per treatment per experiment). P ⬍ 0.05: a, vs. control; and b, vs. the same treatment in absence of inhibitor.
300 a
200
200 b
100 0
Control
GHRH
Ghrelin
0
Control
GHRH
Ghrelin
Vehicle
Vehicle 500
b
b
100
LY-83,583
400
Thapsigargin
a 400 a
a
a
a 300
ab
300 200 200
b
b 100
100 0
0 Control
GHRH
Ghrelin
Control
GHRH
Ghrelin
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
Endocrinology, September 2007, 148(9):4440 – 4449
4447
Working model proposed to explain the stimulatory effect of GHRH and Ghrelin alone or in combination on GH release in a non-human primate somatotrope
GHRH
Ghrelin GHRH-R GH S-R
GHRH-R
AC/cAMP
NOS/NO production
AC/cAMP production
+
+ + PKA activation
+
MAPK activation
+
2+
+
GC/cGMP production
Ca
PLC/IP production
lar
Extrace llu
+
S-R
u cell
lar Ca 2+
+
GH
ra Ext
FIG. 10. Working model summarizing the second messenger routes activated by ghrelin and GHRH alone and in combination to stimulate GH release in pituitary cell cultures prepared from a nonhuman primate (P. anubis). As shown by the solid arrows, the data presented here using specific inhibitors of intracellular signaling pathways indicate that ghrelin requires PLC/PKC, MAPK, and extracellular Ca2⫹, whereas GHRH requires AC/ cAMP, NOS/GC, and both intracellular and extracellular Ca2⫹. Of interest is the fact that both ghrelin and GHRH require PKA, suggesting that these pathways may converge (intersect) at the level of PKA as diagrammed, or ghrelin and GHRH activate distinct intracellular pools of PKA. How ghrelin activates PKA to augment GH release remains unknown. However, work of others, as indicated by the dashed lines, present several possibilities. Finally, our initial findings indicate that when ghrelin is applied in combination with GHRH, the intracellular signals necessary to release GH are distinct from that observed with ghrelin alone, now requiring AC/cAMP.
GHRH + Ghrelin
+ PKC activation
intracellular Ca2+
GH RELEASE pituitary action of ghrelin may play a major role in the dynamic release of GH observed in humans (14, 17–21) and monkeys (38) after ghrelin treatment in vivo. These results also indicate that the direct actions of ghrelin on somatotrope function are not only confined to the acute stimulation of GH release but may also include augmentation of GHRH-mediated GH release by stimulation of GHRH-R synthesis after prolonged exposure. Finally, the use of specific inhibitors of intracellular signaling revealed that the GH-releasing actions of ghrelin and GHRH, when applied alone to primate pituitary cell cultures, are mediated by distinct intracellular signaling pathways. Specifically, ghrelin requires PLC/PKC, MAPK, and extracellular Ca2⫹, whereas GHRH requires AC/cAMP, NOS/GC, and both intracellular and extracellular Ca2⫹, as illustrated in Fig. 10. Of interest is the fact that both ghrelin and GHRH require PKA, suggesting that these pathways may converge (intersect) at the level of PKA (as diagrammed in Fig. 10), or ghrelin and GHRH activate distinct intracellular pools of PKA (81). Finally, our initial results indicate that when ghrelin is applied in combination with GHRH, the intracellular signals necessary to release GH are distinct from that observed with ghrelin alone, requiring AC/cAMP. Acknowledgments We thank the veterinarian staff of the University of Illinois at Chicago, Biological Resource Center, for its invaluable help, and give special
thanks to Dr. Lisa Halliday for facilitating the collection of the baboon pituitaries used in this study. Received April 5, 2007. Accepted May 21, 2007. Address all correspondence and requests for reprints to: Raul M. Luque, Ph.D., Jesse Brown Veterans Affairs Medical Center, Research and Development Division, M.P 151, West Side, Suite 6215, 820 South Damen Avenue, Chicago, Illinois 60612. E-mail:
[email protected]. This work was supported by the National Institutes of Health Grant NIDDK 30677 (to R.D.K.) and by the “Secretaria de Universidades, Investigacio´n y Tecnologı´a de la Junta de Andalucia” (to R.M.L.). Disclosure Statement: The authors have nothing to disclose.
References 1. Muller EE, Locatelli V, Cocchi D 1999 Neuroendocrine control of growth hormone secretion. Physiol Rev 79:511– 607 2. Bowers CY 2001 Unnatural growth hormone-releasing peptide begets natural ghrelin. J Clin Endocrinol Metab 86:1464 –1469 3. Anderson LL, Jeftinija S, Scanes CG, SMH, Lee JS, Jeftinija K, GlavaskiJoksimovic A 2005 Physiology of ghrelin and related peptides. Domest Anim Endocrinol 29:111–144 4. Vance ML 1990 Growth-hormone-releasing hormone. Clin Chem 36:415– 420 5. Guillaume V, Magnan E, Cataldi M, Dutour A, Sauze N, Renard M, Razafindraibe H, Conte-Devolx B, Deghenghi R, Lenaerts V, Oliver C 1994 GH-releasing hormone secretion is stimulated by a new GH-releasing hexapeptide in sheep. Endocrinology 135:1073–1076 6. Tannenbaum GS, Bowers CY 2001 Interactions of growth hormone secretagogues and growth hormone-releasing hormone/somatostatin. Endocrine 14: 21–27 7. Fairhall KM, Mynett A, Robinson IC 1995 Central effects of growth hormonereleasing hexapeptide (GHRP-6) on growth hormone release are inhibited by central somatostatin action. J Endocrinol 144:555–560 8. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 1999
4448
9. 10.
11.
12.
13.
14. 15.
16.
17.
18.
19.
20.
21.
22.
23. 24.
25.
26. 27.
28.
Endocrinology, September 2007, 148(9):4440 – 4449
Ghrelin is a growth hormone-releasing acylated peptide from stomach. Nature 402:656 – 660 Hashizume T, Horiuchi N, Tate N, Nonaka S, Kojima M, Hosoda H, Kangawa K 2003 Effects of ghrelin on growth hormone secretion from cultured adenohypophysial cells in cattle. Endocr J 50:289 –295 Malagon MM, Luque RM, Ruiz-Guerrero E, Rodriguez-Pacheco F, GarciaNavarro S, CFF, Gracia-Navarro F, Castano JP 2003 Intracellular signaling mechanisms mediating ghrelin-stimulated growth hormone release in somatotropes. Endocrinology 144:5372–5380 Pandya N, DeMott-Friberg R, Bowers CY, Barkan AL, Jaffe CA 1998 Growth hormone (GH)-releasing peptide-6 requires endogenous hypothalamic GHreleasing hormone for maximal GH stimulation. J Clin Endocrinol Metab 83:1186 –1189 Pombo M, Barreiro P, Penalva A, Peino R, Dieguez C, Casanueva FF 1995 Absence of growth hormone (GH) secretion after the administration of either GH-releasing hormone (GHRH), GH-releasing peptide (GHRP-6), or GHRH plus GHRP-6 in children with neonatal pituitary stalk transection. J Clin Endocrinal Metab 80:3180 –3184 Popovic V, Damjanovic S, Micic D, Djurovic M, Dieguez C, Casanueva FF 1995 Blocked growth hormone-releasing peptide (GHRP-6)-induced GH secretion and absence of the synergic action of GHRP-6 plus GH-releasing hormone in patients with hypothalamopituitary disconnection: evidence that GHRP-6 main action is exerted at the hypothalamic level. J Clin Endocrinal Metab 80:942–947 Popovic V, Miljic D, Micic D, Damjanovic S, Arvat E, Ghigo E, Dieguez C, Casanueva FF 2003 Ghrelin main action on the regulation of growth hormone release is exerted at hypothalamic level. J Clin Endocrinol Metab 88:3450 –3453 Gondo RG, Aguiar-Oliveira MH, Hayashida CY, Toledo SP, Abelin N, Levine MA, Bowers CY, Souza AH, Pereira RM, Santos NL, Salvatori R 2001 Growth hormone-releasing peptide-2 stimulates GH secretion in GH-deficient patients with mutated GH-releasing hormone receptor. J Clin Endocrinol Metab 86:3279 –3283 Maheshwari HG, Pezzoli SS, Rahim A, Shalet SM, Thorner MO, Baumann G 2002 Pulsatile growth hormone secretion persists in genetic growth hormone-releasing hormone resistance. Am J Physiol Endocrinol Metab 282:E943– E951 Arvat E, Di Vito L, Broglio F, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F, Ghigo E 2000 Preliminary evidence that ghrelin, the natural GH secretagogue (GHS)-receptor ligand, strongly stimulates GH secretion in humans. J Endocrinol Invest 23:493– 495 Arvat E, Maccario M, Di Vito L, Broglio F, Benso A, Gottero C, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F, Ghigo E 2001 Endocrine activities of ghrelin, a natural growth hormone secretagogue (GHS), in humans: comparison and interactions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing hormone. J Clin Endocrinal Metab 86:1169 – 1174 Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y, Hosoda K, Akamizu T, Kojima M, Kangawa K, Nakao K 2000 Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 85:4908 – 4911 Di Vito L, Broglio F, Benso A, Gottero C, Prodam F, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Ghigo E, Arvat E 2002 The GHreleasing effect of ghrelin, a natural GH secretagogue, is only blunted by the infusion of exogenous somatostatin in humans. Clin Endocrinol (Oxf) 56:643– 648 Hataya Y, Akamizu T, Takaya K, Kanamoto N, Ariyasu H, Saijo M, Moriyama K, Shimatsu A, Kojima M, Kangawa K, Nakao K 2001 A low dose of ghrelin stimulates growth hormone (GH) release synergistically with GHreleasing hormone in humans. J Clin Endocrinol Metab 86:4552– 4555 Bowers CY, Reynolds GA, Durham D, Barrera CM, Pezzoli SS, Thorner MO 1990 Growth hormone (GH)-releasing peptide stimulates GH release in normal men and acts synergistically with GH-releasing hormone. J Clin Endocrinal Metab 70:975–982 Robinson BM, Friberg RD, Bowers CY, Barkan AL 1992 Acute growth hormone (GH) response to GH-releasing hexapeptide in humans is independent of endogenous GH-releasing hormone. J Clin Endocrinol Metab 75:1121–1124 Veldhuis JD, Iranmanesh A, Mielke K, Miles JM, Carpenter PC, Bowers CY 2006 Ghrelin potentiates growth hormone secretion driven by putative somatostatin withdrawal and resists inhibition by human corticotropin-releasing hormone. J Clin Endocrinol Metab 91:2441–2446 Rubinfeld H, Hadani M, Taylor JE, Dong JZ, Comstock J, Shen Y, DeOliveira D, Datta R, Culler MD, Shimon I 2004 Novel ghrelin analogs with improved affinity for the GH secretagogue receptor stimulate GH and prolactin release from human pituitary cells. Eur J Endocrinol 151:787–795 Shimon I, Yan X, Melmed S 1998 Human fetal pituitary expresses functional growth hormone-releasing peptide receptors. J Clin Endocrinol Metab 83:174 – 178 Yamazaki M, Nakamura K, Kobayashi H, Matsubara M, Hayashi Y, Kangawa K, Sakai T 2002 Regulational effect of ghrelin on growth hormone secretion from perifused rat anterior pituitary cells. J Neuroendocrinol 14: 156 –162 Hashizume T, Horiuchi N, Tate N, Nonaka S, Mikami U, Kojima M 2003
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
29. 30. 31. 32. 33. 34.
35.
36.
37.
38. 39. 40.
41. 42. 43. 44. 45. 46. 47.
48. 49.
50. 51. 52.
53.
Effects of ghrelin on growth hormone secretion from cultured adenohypophysial cells in pigs. Domest Anim Endocrinol 24:209 –218 Pinilla L, Barreiro ML, Tena-Sempere M, Aguilar E 2003 Role of ghrelin in the control of growth hormone secretion in prepubertal rats: interactions with excitatory amino acids. Neuroendocrinology 77:83–90 Casanueva FF, Dieguez C 1999 Growth hormone secretagogues: physiological role and clinical utility. Trends Endocrinol Metab 10:30 –38 Bowers CY, Sartor AO, Reynolds GA, Badger TM 1991 On the actions of the growth hormone-releasing hexapeptide, GHRP. Endocrinology 128:2027–2035 Luque RM, Gahete MD, Hochgeschwender U, Kineman RD 2006 Evidence that endogenous SST inhibits ACTH and ghrelin expression by independent pathways. Am J Physiol Endocrinol Metab 291:E395–E403 Luque RM, Gahete MD, Valentine RJ, Kineman RD 2006 Examination of the direct effects of metabolic factors on somatotrope function in a non-human primate model, Papio anubis. J Mol Endocrinol 37:25–38 Goodyer CG, Branchaud CL, Lefebvre Y 1993 In vitro modulation of growth hormone (GH) secretion from early to midgestation human fetal pituitaries by GH-releasing factor and somatostatin: role of Gs-adenylate cyclase-Gi complex and Ca2⫹ channels. J Clin Endocrinol Metab 76:1265–1270 Renner U, Brockmeier S, Strasburger CJ, Lange M, Schopohl J, Muller OA, Von Werder K, Stalla GK 1994 Growth hormone (GH)-releasing peptide stimulation of GH release from human somatotroph adenoma cells: interaction with GH-releasing hormone, thyrotropin-releasing hormone, and octreotide. J Clin Endocrinol Metab 78:1090 –1096 Chen C, Pullar M, Loneragan K, Zhang J, Clarke IJ 1998 Effect of growth hormone-releasing peptide-2 (GHRP-2) and GH-releasing hormone (GHRH) on the cAMP levels and GH release from cultured acromegalic tumours. J Neuroendocrinol 10:473– 480 Hanew K, Utsumi A, Tanaka A, Ikeda H, Yokogoshi Y 1998 Secretory mechanisms of growth hormone (GH)-releasing peptide-, GH-releasing hormone-, and thyrotropin-releasing hormone-induced GH release in patients with acromegaly. J Clin Endocrinol Metab 83:3578 –3583 Walker RF, Codd EE, Barone FC, Nelson AH, Goodwin T, Campbell SA 1990 Oral activity of the growth hormone releasing peptide His-D-Trp-Ala-Trp-DPhe-Lys-NH2 in rats, dogs and monkeys. Life Sci 47:29 –36 Herbert DC, Hayashida T 1974 Histologic identification and immunochemical studies of prolactin and growth hormone in the primate pituitary gland. Gen Comp Endocrinol 24:381–397 Girod C, Dubois MP 1976 [Demonstration by immunofluorescence of somatotropic cells and prolactin cells in the monkeys Erythrocebus patas, Cercopithecus aethiops and Papio hamadryas]. C R Seances Soc Biol Fil 170:1214 – 1218 (French) Peino R, Baldelli R, Rodriguez-Garcia J, Rodriguez-Segade S, Kojima.M, Kangawa K, Arvat E, Ghigo E, Dieguez C, Casanueva FF 2000 Ghrelininduced growth hormone secretion in humans. Eur J Endocrinol 143:R11–R14 van der Lely AJ, Tschop M, Heiman ML, Ghigo E 2004 Biological, physiological, pathophysiological, and pharmacological aspects of ghrelin. Endocr Rev 25:426 – 457 Mayo KE, Godfrey PA, Suhr ST, Kulik DJ, Rahal JO 1995 Growth hormonereleasing hormone: synthesis and signalling. Recent Prog Horm Res 50:35–73 Gick GG, Zeytin FN, Brazeau P, Ling NC, Esch FS, Bancroft C 1984 Growth hormone-releasing factor regulates growth hormone mRNA in primary cultures of rat pituitary cells. Proc Natl Acad Sci USA 81:1553–1555 Barinaga M, Yamonoto G, Rivier C, Vale W, Evans R, Rosenfeld MG 1983 Transcriptional regulation of growth hormone gene expression by growth hormone-releasing factor. Nature 306:84 – 85 Bossis I, Porter TE 2003 Evaluation of glucocorticoid-induced growth hormone gene expression in chicken embryonic pituitary cells using a novel in situ mRNA quantitation method. Mol Cell Endocrinol 201:13–23 Yan M, Hernandez M, Xu R, Chen C 2004 Effect of GHRH and GHRP-2 treatment in vitro on GH secretion and levels of GH, pituitary transcription factor-1, GHRH-receptor, GH-secretagogue-receptor and somatostatin receptor mRNAs in ovine pituitary cells. Eur J Endocrinol 150:235–242 Aleppo G, Moskal SF2, DeGrandis PA, Kineman RD, Frohman LA 1997 Homologous down-regulation of growth hormone-releasing hormone receptor messenger ribonucleic acid levels. Endocrinology 138:1058 –1065 Kineman RD, Kamegai J, Frohman LA 1999 Growth hormone-releasing hormone (GHRH) and the growth hormone secretagogue (GHS), L692,585, differentially modulate rat pituitary GHS receptor (GHS-R) and GHRH receptor (GHRH-R) mRNA levels. Endocrinology 140:3581–3586 Girard N, Boulanger L, Denis S, Gaudreau P 1999 Differential in vivo regulation of the pituitary growth hormone-releasing hormone (GHRH) receptor by GHRH in young and aged rats. Endocrinology 140:2836 –2842 Lasko CM, Korytko AI, Wehrenberg WB, Cuttler L 2001 Differential GHreleasing hormone regulation of GHRH receptor mRNA expression in the rat pituitary. Am J Physiol Endocrinol Metab 280:E626 –E631 Luque RM, Kineman RD, Park S, Peng XD, Gracia-Navarro F, Castano JP, Malagon MM 2004 Homologous and heterologous regulation of pituitary receptors for ghrelin and growth hormone-releasing hormone. Endocrinology 145:3182–3189 Roh SG, Doconto M, Feng DD, Chen C 2006 Differential regulation of GHRH-
Kineman and Luque • Ghrelin’s Direct Effects on Primate GH Release
54.
55.
56.
57. 58. 59.
60.
61.
62.
63. 64. 65.
66.
receptor and GHS-receptor expression by long-term in vitro treatment of ovine pituitary cells with GHRP-2 and GHRH. Endocrine 30:55– 62 Porter TE, Ellestad LE, Fay A, Stewart JL, Bossis I 2006 Identification of the chicken growth hormone-releasing hormone receptor (GHRH-R) mRNA and gene: regulation of anterior pituitary GHRH-R mRNA levels by homologous and heterologous hormones. Endocrinology 147:2535–2543 Blake AD, Smith RG 1991 Desensitization studies using perifused rat pituitary cells show that growth hormone-releasing hormone and His-D-Trp-Ala-TrpD-Phe-Lys-NH2 stimulate growth hormone release through distinct receptor sites. J Endocrinol 129:11–19 Wu D, Chen C, Katoh K, Zhang J, Clarke IJ 1994 The effect of GH-releasing peptide-2 (GHRP-2 or KP 102) on GH secretion from primary cultured ovine pituitary cells can be abolished by a specific GH-releasing factor (GRF) receptor antagonist. J Endocrinol 140:R9 –R13 Soliman EB, Hashizume T, Kanematsu S 1994 Effect of growth hormone (GH)-releasing peptide (GHRP) on the release of GH from cultured anterior pituitary cells in cattle. Endocr J 41:585–591 Anderson LL, Jeftinija S, Scanes CG 2004 Growth hormone secretion: molecular and cellular mechanisms and in vivo approaches. Exp Biol Med (Maywood) 229:291–302 Gracia-Navarro F, Castano JP, Malagon MM, Sanchez-Hormigo A, Luque RM, Hickey GJ, Peinado JR, Delgado E, Martinez-Fuentes AJ 2002 Research progress in the stimulatory inputs regulating growth hormone (GH) secretion. Comp Biochem Physiol B Biochem Mol Biol 132:141–150 Cheng K, Chan WW, Barreto Jr A, Convey EM, Smith RG 1989 The synergistic effects of His-D-Trp-Ala-Trp-D-Phe-Lys- NH2 on growth hormone (GH)-releasing factor-stimulated GH release and intracellular adenosine 3⬘,5⬘-monophosphate accumulation in rat primary pituitary cell culture. Endocrinology 124:2791–2798 Wu D, Chen C, Zhang J, Bowers CY, Clarke IJ 1996 The effects of GH-releasing peptide-6 (GHRP-6) and GHRP-2 on intracellular adenosine 3⬘-5⬘-monophosphate (cAMP) levels and GH secretion in ovine and rat somatotrophs. J Endocrinol 148:197–205 Cunha SR, Mayo KE 2002 Ghrelin and growth hormone (GH) secretagogues potentiate GH-releasing hormone (GHRH)-induced cyclic adenosine 3⬘,5⬘monophosphate production in cells expressing transfected GHRH and GH secretagogue receptors. Endocrinology 143:4570 – 4582 Garcia A, Alvarez CV, Smith RG, Dieguez C 2001 Regulation of PIT-1 expression by ghrelin and GHRP-6 through the GH secretagogue receptor. Mol Endocrinol 15:1484 –1495 Wu D, Clarke IJ, Chen C 1997 The role of protein kinase C in GH secretion induced by GH-releasing factor and GH-releasing peptides in cultured ovine somatotrophs. J Endocrinol 154:219 –230 Mousseaux D, Le Gallic L, Ryan J, Oiry C, Gagne D, Fehrentz JA, Galleyrand JC, Martinez J 2006 Regulation of ERK1/2 activity by ghrelin-activated growth hormone secretagogue receptor 1A involves a PLC/PKCvarepsilon pathway. Br J Pharmacol 148:350 –365 Yamakawa K, Arita J 2004 Cross-talk between the estrogen receptor-, protein kinase A-, and mitogen-activated protein kinase-mediated signaling pathways in the regulation of lactotroph proliferation in primary culture. J Steroid Biochem Mol Biol 88:123–130
Endocrinology, September 2007, 148(9):4440 – 4449
4449
67. Fernandez M, Sanchez-Franco F, Palacios N, Sanchez I, Villuendas G, Cacicedo L 2003 Involvement of vasoactive intestinal peptide on insulin-like growth factor I-induced proliferation of rat pituitary lactotropes in primary culture: evidence for an autocrine and/or paracrine regulatory system. Neuroendocrinology 77:341–352 68. Lania A, Filopanti M, Corbetta S, Losa M, Ballare E, Beck-Peccoz P, Spada A 2003 Effects of hypothalamic neuropeptides on extracellular signal-regulated kinase (ERK1 and ERK2) cascade in human tumoral pituitary cells. J Clin Endocrinol Metab 88:1692–1696 69. Rodriguez-Pacheco F, Luque RM, Garcia-Navarro S, Gracia-Navarro F, Castano JP, Malagon MM 2005 Ghrelin induces growth hormone (GH) secretion via nitric oxide (NO)/cGMP signaling. Ann NY Acad Sci 1040:452– 453 70. Luque RM, Rodriguez-Pacheco F, Tena-Sempere M, Gracia-Navarro F, Malagon MM, Castano JP 2005 Differential contribution of nitric oxide and cGMP to the stimulatory effects of growth hormone-releasing hormone and low-concentration somatostatin on growth hormone release from somatotrophs. J Neuroendocrinol 17:577–582 71. Tena-Sempere M, Pinilla L, Gonzalez D, Aguilar E 1996 Involvement of endogenous nitric oxide in the control of pituitary responsiveness to different elicitors of growth hormone release in prepubertal rats. Neuroendocrinology 64:146 –152 72. Kostic TS, Andric SA, Stojilkovic SS 2001 Spontaneous and receptor-controlled soluble guanylyl cyclase activity in anterior pituitary cells. Mol Endocrinol 15:1010 –1022 73. Rubinek T, Rubinfeld H, Hadani M, Barkai G, Shimon I 2005 Nitric oxide stimulates growth hormone secretion from human fetal pituitaries and cultured pituitary adenomas. Endocrine 28:209 –216 74. Lloyd RV, Jin L, Qian X, Zhang S, Scheithauer BW 1995 Nitric oxide synthase in the human pituitary gland. Am J Pathol 146:86 –94 75. Uretsky AD, Chang JP 2000 Evidence that nitric oxide is involved in the regulation of growth hormone secretion in goldfish. Gen Comp Endocrinol 118:461– 470 76. Thorner MO, Holl RW, Leong DA 1988 The somatotrope: an endocrine cell with functional calcium transients. J Exp Biol 139:169 –179 77. Chen C 2000 Growth hormone secretagogue actions on the pituitary gland: multiple receptors for multiple ligands? Clin Exp Pharmacol Physiol 27:323– 329 78. Chen C, Israel JM, Vincent JD 1989 Electrophysiological responses of rat pituitary cells in somatotroph-enriched primary culture to human growth hormone-releasing factor. Neuroendocrinology 50:679 – 687 79. Ramirez JL, Castano JP, Torronteras R, Martinez-Fuentes AJ, Frawley LS, Garcia-Navarro S, Gracia-Navarro F 1999 Growth hormone (GH)-releasing factor differentially activates cyclic adenosine 3⬘,5⬘-monophosphate- and inositol phosphate-dependent pathways to stimulate GH release in two porcine somatotrope subpopulations. Endocrinology 140:1752–1759 80. Yamazaki M, Kobayashi H, Tanaka T, Kangawa K, Inoue K, Sakai T 2004 Ghrelin-induced growth hormone release from isolated rat anterior pituitary cells depends on intracellular and extracellular Ca2⫹ sources. J Neuroendocrinol 16:825– 831 81. Sim AT, Scott JD 1999 Targeting of PKA, PKC and protein phosphatases to cellular microdomains. Cell Calcium 26:209 –217
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.
