Parasitol Res (2008) 102:193–199 DOI 10.1007/s00436-007-0743-0
ORIGINAL PAPER
Repetitive sequences in the ITS1 region of the ribosomal DNA of Tunga penetrans and other flea species (Insecta, Siphonaptera) Sara Gamerschlag & Heinz Mehlhorn & Jörg Heukelbach & Hermann Feldmeier & Jochen D’Haese
Received: 16 August 2007 / Accepted: 21 August 2007 / Published online: 19 October 2007 # Springer-Verlag 2007
Abstract Different Tunga penetrans isolates from various hosts obtained from South America (Fortaleza. Brazil) have been studied by nucleotide sequence comparison of the first and the second internal transcribed spacer (ITS1, ITS2) of the ribosomal deoxyribonucleic acid (rDNA) and part of the mitochondrial 16S rDNA. Results show no significant hostdependent sequence differences. No indication for intraindividual and intraspecific polymorphisms could be detected. Comparing the ITS1 spacer region of T. penetrans from South America with that from Africa (Togo, Cameroon), distinct length variations have been observed caused by a repetitive sequence motif of 99 bp. The ITS1 from the South American T. penetrans contain two tandemly repeated copies, whereas four of these units are present in the spacer of the African T. penetrans. The absence of homogenization of these units indicates a recent separation of both populations. However, the different number of repetitions together with two base substitutions put the evolutionary distance of only 135 years as postulated for the transfer of T. penetrans from South America to Africa into question. Repetitive sequences could also be detected within the ITS1 rDNA region of other flea S. Gamerschlag : H. Mehlhorn : J. D’Haese (*) Department of Zoology and Parasitology, Heinrich-Heine-University, 40225 Düsseldorf, Germany e-mail:
[email protected] J. Heukelbach School of Public Health at Ceara State, Fortaleza, Brazil H. Feldmeier Center for Humanities and Health Sciences, Faculty of Medicine, Free University of Berlin, Berlin, Germany
species Ctenocephalides felis, Echidnophaga gallinacea, Pulex irritans, Spilopsyllus cuniculi, and Xenopsylla cheopis. The repeat units with lengths from 10 to 99 bp are arranged in pure tandem or interspersed. The repetitive elements observed in the ITS1 of various flea species may serve as a valuable tool for phylogeographic studies.
Introduction The sand flea genus Tunga includes ten species, most of which are hematophagous ectoparasites of single or few closely related hosts and show a geographically restricted distribution (Li and Chin 1957; Smit and Rosicky 1972, Smit 1962; Barnes and Radovsky 1969). The most common species is Tunga penetrans (Linne 1758) with a worldwide incidence in tropical and subtropical areas. T. penetrans is parasitizing various mammalian hosts including humans (Hopkins and Rothschild 1953; Linardi and Guimaraes 1993; Lewis 1972; Heukelbach et al. 2004). Only the female sand flea penetrates man’s skin, and its abdomen is finally considerably enlarged by the developing eggs thus causing the infection known as tungiasis (Geigy and Suter 1960; Heukelbach et al. 2006). T. penetrans is endemic in South America especially in parts with low hygienic standards. It is generally assumed that the distribution of the sand fleas originally occurring only in Latin America and the Caribbean started from South America. Frequently, it was stated that T. penetrans was accidentally introduced to the West Coast of Africa in the nineteenth century and spread over Africa and the Indian subcontinent within only a few decades (Hesse 1899; Gordon 1941; Sanusi et al. 1989; Heukelbach et al. 2001).
194
In recent years, molecular biological analysis became an important tool for the investigation of evolutionary relationships within and between species and is especially valuable when morphological differences are limited. Analysis of genome sequence phylogenies of closely related species can only be assessed by fast-evolving deoxyribonucleic acid (DNA) regions. Such variable regions of the genome include the two internal transcribed spacer regions (ITS1 and ITS2) of the multicopy ribosomal DNA (rDNA). The ITS1 and ITS2 are located between the 18S, 5.8S, and the 28S rDNA and have proven useful for analyzing genetic relationships (Hillis and Dixon 1991; Coleman and Mai 1997; Essig et al. 1999; Vobis et al. 2004). Conserved stretches adjacent to the ITS can be conveniently used to design “universal” primers for the amplification of the spacer regions. Additional markers frequently used are the cytochrome oxydase I, II and 16S rDNA mitochondrial genes. Some investigations of various flea species using molecular markers have been made and showed significant species specific sequence variations (Luchetti et al. 2005, 2007; Vobis et al. 2005). The first aim of the present study was to investigate if there are host-dependent sequence differences in sand fleas in a defined geographical area as was shown for Crytosporidium species (Morgan et al. 1999). The second aim was to compare sand fleas from South America (Brazil) and Africa, where they are assumed to be introduced at the end of the nineteenth century. For these investigations, marker sequences (16S mitochondrial rDNA ITS1, ITS2 rDNA) were compared from sand fleas collected in Fortaleza (Brazil) obtained from different mammalian hosts and from Africa (Cameroon and Togo) isolated from humans. The finding of repetitive elements in the ITS1 sequence of T. penetrans prompted us to look for such elements in other flea species.
Materials and methods T. penetrans gravid females and the other flea species (Table 1) were extracted from single hosts and fixed in absolute ethanol for DNA analysis. For the extraction of genomic DNA the DNEasy™ Tissue Kit (Qiagen, Hilden, Germany) was used. Single fleas were frozen in liquid nitrogen and crushed in a mortar. The tissue was then mixed with lysis buffer and preparation of genomic DNA performed according to the protocol of the manufacturer for animal tissue. DNA was amplified by polymerase chain reaction (PCR) using the Hot Star Taq Master mix Kit (Qiagen) in a total volume of 50 μl. Each reaction mixture contained 0.4 mM of each primer, 2.5 U of Taq polymerase, 200 μM deoxynucleotide triphosphates, and 2 mM MgCl2. After a denaturation time of 5 min at 94°C, each of the 35 cycles
Parasitol Res (2008) 102:193–199
started with denaturation for 30 s at 94°C followed by annealing at 58°C for 30 s and elongation at 72°C for 90 s. A final elongation was for 5 min at 72°C. PCR products were examined on 1.5% agarose gels, and the fragments were purified by the QIAquick gel extraction kit (Qiagen). DNA was sequenced by SEQLAB (Sequence Laboratories GmbH, Göttingen, Germany). Primers used for PCR amplification The ITS1 was amplified using primers (listed below) that were designed to match the 5′ end of the 5.8S rDNA and the 3′ end of the 18S rDNA coding regions. The boundaries between the ITS1 region and the 18S and 5.8S ribosomal ribonucleic acid (rRNA) coding regions were estimated by comparison with the known sequences of other flea species. The primers used were the following): ITS1 sen (1) GTACACACCGCCCGTGCGTACT; end of the 18S rDNA from C. felis (Vobis 2002) ITS1 rev (1) GCTGCGTTCTTCATCGACCC; begin of the 5.8S rDNA from Anopheles pseudopunctipennis (Vobis 2002) ITS1 sen (2) CTTTGTACACACCGCCCGTCGCTAC; end of the 18S rDNA from T. monositus (Acc. AF286279) ITS1 rev (2) CCAGGTGTGGTCCGGGAACAGTATC; end of the 5.8S rDNA from T. penetrans (Acc. AY425819) and T. trimamillata (Acc. AY 425820) ITS1 sen (3) GTTGCTGGGAAGATGCCCAAACTTG; end of the 18S rDNA from T. monositus (Acc. AF286279), Echidnophaga and Pulex ITS1 sen (4) CAAGGTTTCCGTAGGTGAACCTGC; end of the 18S rDNA from T. monositus (Acc. AF286279), Echidnophaga and Pulex All primers were synthesized by MWG-Biotech AG (Ebersberg).
Table 1 Origin of the different flea species used in the study Flea species
Origin
Host
Tunga penetrans Tunga penetrans Tunga penetrans Echidnophaga gallinacea Pulex irritans Ctenocephalides felis Ctenocephalides felis Spilopsyllus cuniculi
Brazil (Fortaleza) Cameroon Togo Cameroon Cameroon Cameroon Germany Germany
Pig, dog, rat Human Human Chicken Human Cat Breed of Bayer AG Cat
Parasitol Res (2008) 102:193–199
195
Software and databases The multiple sequence alignment program CLUSTAL X (Thompson et al. 1997) and the program MAFFT (Katoh et al. 2005) were used to obtain a nucleotide sequence alignment file. The program SEAVIEW was used to optimize the alignments (Galtier et al. 1996); alignments were also edited by eyes. The program DOTMATCHER from the European Molecular Biology Open Software Suite package (Rice et al. 2000) was used to find repeats within the sequences. Various known sequences were obtained from GenBank™ (National Center for Biotechnology Information [NCBI], http://www.ncbi.nlm.nih.gov/). The Basic Local Alignment Search Tool search (Altschul et al. 1997) was accomplished via NCBI. All ITS1 sequences obtained in the present study have been deposited in the European Molecular Biology Laboratory data bank under accession numbers EU169193 to EU169197, Tunga penetrans isolates; EU169198, Pulex irritans; EU169199, Echidnophaga gallinacea; EU170156, Ctenocephalides felis; EU170157, Spilopsyllus cuniculi.
Results Re-evaluation of possible host-dependent morphological and sequence differences showed no significant variations between the sand fleas from South America collected from pigs, rats, dogs, and humans as hosts in contrast to the original assumption (Vobis et al. 2005). As molecular markers, a fragment of the 16S rDNA and the internal transcribed spacers (ITS1, ITS2) have been used (data not shown). Comparing sand fleas obtained from South America and Africa with the same markers, only the ITS1 regions were considerably different. The ITS1 rDNA of all South American T. penetrans from Brazil have a total length of 878 bp. The ITS1 rDNA of the
Fig. 1 The ITS1 rDNA sequences from the South American and the African T. penetrans are plotted against themselves to show the positions of the repeats
African T. penetrans from Cameroon and Togo are identical among each other, with a total length of 1,076 bp. A search for repeats (program DOTMATCHER) resulted in repetitive sequences within the ITS1 of both populations (Fig. 1). The repeat units have a length of 99 bp and are tandemly arranged within the ITS1 spacer of both populations. The repetitive elements start within the ITS1 sequence of the African T. penetrans at position 114, 214, 314, 414, and end at position 513. Within the spacer sequence of the South American T. penetrans, the repeats range from positions 114 to 213 and from 214 to 313 (Figs. 2 and 4). In addition to the length differences between the ITS1 rDNA of the African and the South American T. penetrans caused by the number of repeats, there are sequence differences by base substitutions within the repetitive elements. The first and second ITS1 repeat of the Brazilian fleas differ by three base substitutions at the position 154/ 254 (T to C), 195/295 (A to T), and 197/297 (C to G). The sequences of the first and third ITS1 repeat of the African T. penetrans are identical and also the second and fourth. Differences are caused by one base substitution at position 154/254/354/454. Relating to this base substitution the first and third repeat of the African is identical with the first
R 1 SA R 2 SA R1 A R2 A R3 A R4 A
114 214 114 214 314 414
GTACGCGGTC TATGGAACGA TATTCGGTTA CGGGCGCCTT TGAGCCTGGA GTACGCGGTC TATGGAACGA TATTCGGTTA CGGGCGCCTT CGAGCCTGGA GTACGCGGTC TATGGAACGA TATTCGGTTA CGGGCGCCTT TGAGCCTGGA GTACGCGGTC TATGGAACGA TATTCGGTTA CGGGCGCCTT CGAGCCTGGA GTACGCGGTC TATGGAACGA TATTCGGTTA CGGGCGCCTT TGAGCCTGGA GTACGCGGTC TATGGAACGA TATTCGGTTA CGGGCGCCTT CGAGCCTGGA
R 1 SA R 2 SA R1 A R2 A R3 A R4 A
ATATCGAGCG CTACCCGTTT CACGGGCTAT TATCTGTGAC AGCGTCTTT ATATCGAGCG CTACCCGTTT CACGGGCTAT TTTGTGTGAC AGCGTCTTT ATATCGAGCG CTACCCGTTT CACGGGCTAT TTTGTGTGAC AGCGTCTTT ATATCGAGCG CTACCCGTTT CACGGGCTAT TTTGTGTGAC AGCGTCTTT ATATCGAGCG CTACCCGTTT CACGGGCTAT TTTGTGTGAC AGCGTCTTT ATATCGAGCG CTACCCGTTT CACGGGCTAT TTTGTGTGAC AGCGTCTTT
213 313 213 313 413 513
Fig. 2 Repetitive sequences of the ITS1 rDNA from T. penetrans. from South America (R 1–2 SA) and Africa (R1–4 A). The repeat unit is 99 bp long and is present twice within the sequence of the South American T. penetrans (position 114–313) and four times within the ITS1 rDNA sequence of the African T. penetrans (positions 114–513). Sequence differences are marked
196
Parasitol Res (2008) 102:193–199
repeat of the South Americans such as the second and fourth repeat of the African is identical with the second repeat of the South American fleas (Fig. 2). Repetitive sequences within the ITS1 from different flea species
Fig. 3 Gel electrophoresis of PCR products of the ITS1 rDNA region of: 1 T. penetrans Brazil, ITS1 878 bp (host: pig; primer [1]); 2 T. penetrans Brazil, ITS1 878 bp (host: rat; primer [1]); 3 T. penetrans Cameroon, ITS1 1,076 bp (host: human; primer [2]); 4 T. penetrans Togo, ITS1 1,076 bp (host: human; primer [2]); 5 E. gallinacea, ITS1 1,076 bp (primer [2]); 6 P. irritans, ITS1 868 bp (primer [2]); 7 C. felis, ITS1 668 bp (primer [2]); 8 S. cuniculi, ITS1 699 bp (primer [2]). Note that length differences are also caused by the different primers used (numbers in square brackets, see “Materials and methods”); M 100-bp ladder
ITS1 rDNA sequences were obtained from six flea species all belonging to the family Pulicidae (Table 1). The spacer lengths ranged from 668 to 1,076 bp (Fig. 3). Dot-plot analysis indicated the presence of two to four repetitive elements with a repeat length ranging from 10 to 99 bp (Fig. 4). The ITS1 rDNA sequences from T. penetrans, E. gallinacea, P. irritans, and X. cheopis contain long tandemly arranged repetitive elements with a length ranging from 78 to 99 bp. Within the sequence of T. penetrans and E. gallinacea and X. cheopis, the repetitive elements start about 115 bp behind the 5′ end, whereas they begin within the sequence of P. irritans at position 145. The ITS1 rDNA sequence from C. felis and S. cuniculi include interspersed repeats with lengths of 41 and 10 bp, separately arranged from positions 264 to 305, 441 to 482 and 43 to 53, 135 to 145, respectively (Fig. 4). The repetitive sequences can cover more than 30% of the total spacer length. Repeat variations among each other are consistently lower within the tandemly repeated motifs than between the dispersed copies. The first repeat is always located in the first half of the spacer sequence. Without the repeat units, the ITS1 of all flea species investigated would have a rather constant total length of about 700 bp with a conserved gene region at both ends of the spacer sequence. These conserved regions contain stretches of identical nucleotides with approximate lengths of 30 bp.
Discussion
Fig. 4 ITS1 rDNA region of different flea species a Tunga penetrans (Africa): four tandemly arranged repeats with lengths of 99 bp, repeats start at position 114. b Tunga penetrans (South America): two tandemly arranged repeats with lengths of 99 bp, repeats start at position 114. c Echidnophaga gallinacea: four tandemly arranged repeats, the first three repeats with lengths of 78 bp—the fourth repeat has 69 bp, repeat start at position 119. d Pulex irritans: two tandemly arranged repeats with lengths of 99 bp, repeats start at position 145. e Spilopsyllus cuniculi: two interspersed repeats with lengths of 41 bp, repeats start at position 264 and 441. f Ctenocephalides felis: two interspersed repeats with lengths of 10 bp, repeats start at position 43 and 135. g Xenopsylla cheopis (Acc. DQ295061): two tandemly arranged repeats with lengths of 97 bp, repeats start at position 119. Highly conserved adjacent gene regions (18S, 5.8S rDNA) are marked black, repeat containing gene regions are shaded. The lengths of the complete ITS1 are listed behind the species name
The information from sequences of multicopy genes like the rapidly evolving ITS regions of the rDNA has been widely used for phylogenetic reconstruction at and below the species level. No sequence differences in the16S rDNA fragment the ITS1 and ITS2 in the T. penetrans samples with different host preference collected in South America (Fortaleza). With the exception of the ITS1, this applies also for the Kenyan and Cameroonian samples. All samples show no significant morphological differences. Comparable results have been obtained by Luchetti et al. (2007) concerning a low variability of the ITS2 sequence within the populations. Despite the high dispersal ability of the sand fleas, they described a diverging ITS2 sequence pattern with samples collected in Ecuador distinguished from the Brazilian and African ones. Within the ITS1, we also found distinct differences between the South American and African T. penetrans
Parasitol Res (2008) 102:193–199
populations. The ITS1 rDNA regions reveal a considerable length variation caused by long repetitive sequences occupying up to 30% of the spacer length and allowed us to classify the two sand flea groups. The value of a spacer for phylogenetic studies on the level of species or populations can be different for different species (Von der Schulenburg et al. 2001; Platas et al. 2001). The ITS2 rDNA is in some genera like Drosophila more conservative then the ITS1; other genus, for example, Gonatocerus (Hymenoptera), do not show significant sequence variability of the ITS1 but a high variability within the ITS2 (Schlötterer et al. 1994; de Leon et al. 2004). The repetitive elements in the sand flea ITS1 rDNA are tandemly arranged and have a repeat unit length of 99 bp. This unit exists four times within the ITS1 rDNA of the African T. penetrans with a total spacer length of 1,076 bp and twice within the sequence of the South American T. penetrans with a total spacer length of 878 bp. Besides the repetitive elements, both ITS1 sequences are identical. Internal repeats in the ITS spacers are not unusual and have been frequently described. Depending on their length, they have also been named mini- or microsatellites (den Bakker et al. 2004). As in the sand fleas, the incidence of tandem repeats is mostly coupled with extreme length variations of ITS1 rDNA. Most eukaryotic ITS1 rDNA regions show a length of 800–1,100 bp (Schlötterer et al. 1994; Vogler and DeSalle 1994; Tang et al. 1996; Gouliamova et al. 1998; van Herwerden et al. 1998; Harris and Crandall 2000). Many insects show a spacer length of 200–1,000 bp (Paskewitz et al. 1993). The four repeats within the ITS1 rDNA sequence of the African T. penetrans differ by only 1 bp, whereas the first and third repeat and the second and fourth repeats are identical. The same ITS1 sequences were additionally obtained for sand fleas from Nigeria (Abari 2006). The two repeats in the sequence of the South American T. penetrans differ by three base pairs, and the second of these two repeats is identical with the second and fourth repeat of the African T. penetrans (Fig. 4). This observation suggests a collective development of two repeats with one base substitution before these two populations separated. After the separation of the of the South American and African populations, two events, a duplication of the two repeats within the sequence of the African T. penetrans and two base substitutions in the first repeat of the South American T. penetrans, might have happened in the same time period. The facts that the repeats within the ITS1 of these two populations are located exactly at the same position, have exactly the same lengths and nearly the same sequences indicate a relatively recent development of these repeats. The analysis of the ITS1 sequences of isolates from other flea species has revealed that the presence of repeated
197
DNA motifs is widespread among flea species. We could find repeats within the ITS1 rDNA of all six flea species (Fig. 4). The repetitive elements of varying lengths could be seen in pure tandem or interspersed. The repeat sequences of the different flea species do not show any significant similarity. The positions of the repeats within the ITS1 sequence, especially those of the tandemly arranged repeats, are mainly restricted to the first half of the spacer. This implies that the repetition has independently developed several times. ITS are believed to have few evolutionary constraints and might be expected to evolve at or near the neutral level (Schlötterer et al. 1994). Therefore, on the basis of ITS1 rDNA sequence differences the approximate evolutionary distance has frequently been calculated. A substitution rate of 0.85% per million years was estimated for the ITS rDNA from Drosophila (Caccone et al. 1988). For the interspecies sequence differences of 0.07–0, 4%/position in the ITS2 rDNA described for different Anopheles species, an evolutionary distance of at most 0.5 million years have been approximated (Paskewitz et al. 1993). The presence of more conserved regions in the ITS sequence has to be considered so that the spacers apparently can not freely mutate along the complete length (Thweatt and Lee 1990; Henry et al. 1994; Von der Schulenburg et al. 2001). 3′ and 5′ ends of the ITS1 adjacent to the ribosomal 18S rDNA and 5.8S rDNA genes apparently play a decisive role for pre-RNA synthesis and the secondary structure formation during rRNA maturation (Schlötterer et al. 1994; Von der Schulenburg et al. 1999, 2001). It is generally assumed that concerted evolution results in the homogenization of individual rDNA and produces a mostly uniform sequence in all repeats of a given species. Different mechanisms have been proposed for the process of concerted evolution including unequal crossing over and gene conversion. Unequal crossing over assumes recombination among tandem rDNA units either within or between chromosomes, resulting in the stochastic elimination of variation in individuals and populations (Dover et al. 1982; Vogler and DeSalle 1994). ITS evolution seems to be shaped by internal repetition, leading to ITS1 size variation and increase the variability factor. This repetition includes repetitive elements with comparatively long repeat units, e.g. in trematodes (Platyhelminthes) and dipterans and coleopterans (Paskewitz et al. 1993; Schlötterer et al. 1994; Vogler and DeSalle 1994; Tang et al. 1996; van Herwerden et al. 1998; Gouliamova et al. 1998; Harris and Crandall 2000; Von der Schulenburg et al. 2001; Warberg et al. 2005) as well as short repeats as, e.g., in some fungi (Platas et al. 2001). For the evolution of repetitive sequences, mechanisms, which include intra- and interstrand recombinational effects like unequal crossing over and failure in DNA replication like slipped-strand
198
mispairing or replication slippage, are assumed (Platas et al. 2001). The mutational rate of these regions is much faster and does not allow the calculation of the evolutional distance with reasonable accuracy. Nevertheless, the sequence differences found in the South American and African populations may put the common assumption about the distribution of the sand fleas (Hesse 1899; Henning 1904; Gordon 1941; Heukelbach et al. 2001) into question. According to this assumption, the sand fleas arrived for the first time 1872 from South America to Africa together with a load of sand on the ship “Thomas Mitchell” from Brazil to Angola. From Angola, they distributed along the West Coast and arrived to East Africa and Madagascar around the end of the nineteenth century and the Indian subcontinent with British troops 1899. However, reports exist that the sand flea might have been reintroduced to Africa at this time (cited in Hoeppli 1963). Apparently, together with the prospered maritime trade between South America and West Africa in the fifteenth century, African slaves already infested with T. penetrans had been brought to South America. The ITS1 sequence of T. penetrans and their internal repetitive sequences show neither unambiguous indication of intraindividual variations nor of differences within a population. This is apparently not the case for Echidnophaga (Abari 2006). It would be of interest also to analyze the other flea species concerning their variability of their internal repetitive elements. Further sequence data of different T. penetrans populations of South America and Africa may allow establishing the spreading of this sand flea from America to and across the African continent. In summary, the repetitive sequences within the ITS1 rDNA region appear to be useful to differentiate fleas at the level of population, especially when even minor morphological differences are missing. Acknowledgment We wish to thank Elizabeth Abari and Nadine Nagy for kindly providing Fortaleza Tunga penatrans samples as well as Prof. Dr. K Dogba (Togo) and Prof. Dr. Njayon (Cameroon) for sending fleas captured in their countries.
References Abari E (2006) Verwandtschaftsbeziehungen bei hautpenetrierenden Flöhen. Diploma thesis, Heinrich-Heine-University, Düsseldorf, Germany Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 Barnes AM, Radovsky FJ (1969) A new Tunga (Siphonaptera) from the nearctic region with description of all stages. J Med Entomol 6:19–36 Caccone A, Amato GD, Powell JR (1988) Rates and patterns of scnDNA and mtDNA divergence within the Drosophila melanogaster subgroup. Genetics 118:671–683
Parasitol Res (2008) 102:193–199 Coleman AW, Mai JC (1997) Ribosomal DNA ITS-1 and ITS-2 sequence comparisons as a tool for predicting genetic relatedness. J Mol Evol 45:168–177 de Leon JH, Jones WA, Morgan DJ (2004) Molecular distinction between populations of Gonatocerus morrilli, egg parasitoids of the glassy-winged sharpshooter from Texas and California: do cryptic species exist. J Insect Sci 4:39 den Bakker HC, Gravendeel B, Kyper DW (2004) An ITS phylogeny of Leccinum and an analysis of the evolution of minisatellite-like sequences within ITS1. Mycologia 95:102–118 Dover GA, Strachan T, Coen ES, Brown SD (1982) Molecular drive. Science 218:1069 Essig A, Rinder H, Gothe R, Zahler M (1999) Genetic differentiation of mites of the genus Chorioptes (Acari: Psoroptidae). Exp Appl Acarol 23:309–318 Galtier N, Gouy M, Gautier C (1996) SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput Appl Biosci 12:543–548 Geigy R, Suter P (1960) Zur Copulation der Flöhe. Revue Suisse Zool 67:206–210 Gordon RM (1941) The jigger flea. Lancet 2:47–49 Gouliamova DE, Hennebert GL, Smith MT, van der Walt JP (1998) Diversity and affinities among species and strains of Lipomyces. Antonie Van Leeuwenhoek 74:283–291 Harris DJ, Crandall KA (2000) Intragenomic variation within ITS1 and ITS2 of freshwater crayfishes (Decapoda: Cambaridae): implications for phylogenetic and micro satellite studies. Mol Biol Evol 17:284–291 Henning G (1904) Zur Geschichte des Sandflohs (Sarcopsylla penetrans L.) in Afrika. Naturwiss Wochenschr 20:310–312 Henry Y, Wood H, Morrissey JP, Petfalski E, Kearsey S, Tollervey D (1994) The 5′ end of yeast 5.8S rRNA is generated by exonucleases from an upstream cleavage site. EMBO J 13:2452–2463 Hesse P (1899) Die Ausbreitung des Sandflohs in Afrika. Geogr Z (Hettner) 1899:522–530 Heukelbach J, de Oliveira FA, Hesse G, Feldmeier H (2001) Tungiasis: a neglected health problem of poor communities. Trop Med Int Health 6:267–272 Heukelbach J, Costa AM, Wilcke T, Mencke N, Feldmeier H (2004) The animal reservoir of Tunga penetrans in severely affected communities of North-East Brazil. Med Vet Entomol 18:329–335 Heukelbach J, Kuenzer M, Counahan M, Feldmeier H, Speare R (2006) Correct diagnosis of current head lice infestation made by affected individuals from a hyperendemic area. Int J Dermatol 45:1437–1438 Hillis DM, Dixon MT (1991) Ribosomal DNA: molecular evolution and phylogenetic inference. Q Rev Biol 66(4):411–446 Hoeppli R (1963) Early references to the occurrence of Tunga penetrans in Tropical Africa. Acta Trop 20:143–152 Hopkins GHE, Rothschild M (1953) An illustrated catalogue of the Rothschild collection of fleas (Siphonaptera) in the British Museum, vol 1. Tungidae and Pulicidae. British Museum Natural History, London Katoh K, Kuma K, Toh H, Miyata T (2005) MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res 33:511–518 Lewis RE (1972) Notes on the geographical distribution and host preferences in the order Siphonaptera. 1. Pulicidae. J Med Entomol 9:511–520 Li KC, Chin TH (1957) Tunga callida sp. new, A new species of sand flea from Yunnan. Acta Entomol Sin 7:113–120 Linardi PM, Guomaraes LR (1993) Systematic review of genera and subgenera of Rhopalopsyllinae (Siphonaptera: Rhopalopsyllidae) by phenetic and cladistic methods. J Med Entomol 30(1):161–170 Luchetti A, Mantovani B, Pampiglione S, Trentini M (2005) Molecular characterization of Tunga trimamillata and T. penetrans
Parasitol Res (2008) 102:193–199 (Insecta, Siphonaptera, Tungidae): taxonomy and genetic variability. Parasite 12:123–129 Luchetti A, Trentini M, Pampiglone S, Fiorawanti ML Mantovani B (2007) Genetic variability of Tunga penetrans (Siphonaptera, Tungidae) sand fleas across South America and Africa. Parasitol Res 100:593–598 Morgan UM, Xiao L, Fayer R, Graczyk TK, Lal AA, Deplazes P, Thompson RC (1999) Polygenetic analysis of Cryptosporidium isolates from captive reptiles using 18S rDNA sequence data and random amplified polymorphic DNA analysis. J Parasitol. 85:525–30 Paskewitz SM, Wesson DM, Collins FH (1993) The internal transcribed spacers of ribosomal DNA in five members of the Anopheles gambiae species complex. Insect Mol Biol 2:247–257 Platas G, Acero J, Borkowski JA, Gonzalez V, Portal MA, Rubio V, Sanchez-Ballesteros J, Salazar O, Pelaez F (2001) Presence of a simple tandem repeat in the ITS1 region of the Xylariales. Curr Microbiol 43:43–50 Rice P, Longden I, Bleasby A (2000) EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 16:276–277 Sanusi ID, Brown EB, Shepard TG, Grafton WD (1989) Tungiasis: report of one case and review of the 14 reported cases in the United States. J Am Acad Dermatol 20:941–944 Schlötterer C, Hauser MT, von Haeseler A, Tautz D (1994) Comparative evolutionary analysis of rDNA ITS regions in Drosophila. Mol Biol Evol 11:513–522 Smit FGAM (1962) A new sand-flea from Ecuador. Entomologist 95:89–93 Smit FG, Rosicky B (1972) Some Siphonaptera from Chile. Folia Parasitol 19:365–368 Tang J, Toe L, Back C, Unnasch TR (1996) Intra-specific heterogeneity of the rDNA internal transcribed spacer in the Simulium damnosum (Diptera: Simuliidae) complex. Mol Biol Evol 13:244–252 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies
199 for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882 Thweatt R, Lee JC (1990) Yeast precursor ribosomal RNA. Molecular cloning and probing the higher-order structure of the internal transcribed spacer I by kethoxal and dimethylsulfate modification. J Mol Biol 211:305–320 van Herwerden L, Blair D, Agatsuma T (1998) Intra-and inter-specific variation in nuclear ribosomal internal transcribed spacer 1 of the Schistosoma japonicum species complex. Parasitology 116:311–317 Vobis M (2002) Flöhe und ihre molekularbiologische Charakterisierung. Diploma thesis, Heinrich-Heine-University Düsseldorf, Germany Vobis M, D’Haese J, Mehlhorn H, Mencke N, Blagburn BL, Bond R, Denholm I, Dryden MW, Payne P, Rust MK, Schroeder I, Vaughn MB, Bledsoe D (2004) Molecular phylogeny of isolates of Ctenocephalides felis and related species based on analysis of ITS1, ITS2 and mitochondrial 16S rDNA sequences and random binding primers. Parasitol Res 94:219–226 Vobis M, D’Haese J, Mehlhorn H, Heukelbach J, Mencke N, Feldmeier H (2005) Molecular biological investigations of Brazilian Tunga sp. isolates from man, dogs, cats, pigs and rats. Parasitol Res 96:107–112 Vogler AP, DeSalle R (1994) Evolution and phylogenetic information content of the ITS-1 region in the tiger beetle Cicindela dorsalis. Mol Biol Evol 11:393–405 Von der Schulenburg JH, Englisch U, Wagele JW (1999) Evolution of ITS1 rDNA in the Digenea (Plathelminthes: trematoda): 3′ end sequence conservation and its phylogenetic utility. J Mol Evol 48 (1):2–12 Von der Schulenburg JH, Hancock JM, Pagnamenta A, Sloggett JJ, Majerus ME, Hurst GD (2001) Extreme length and length variation in the first ribosomal internal transcribed spacer of ladybird beetles (Coleoptera: Coccinellidae). Mol Biol Evol 18:648–660 Warberg R, Jensen KT, Frydenberg J (2005) Repetitive sequences in the ITS1 region of ribosomal DNA in congeneric microphallid species (Trematoda: Digenea). Parasitol Res 97:420–423
