Biology, Temple University School of Medicine, 3307 North Broad Street, Philadelphia, PA 19140; and ILa Jolla Cancer Research Foundation, 10901 Torrey.
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 3088-3093, April 1996
Biochemistry
Repression of a matrix metalloprotease gene by E1A correlates with its ability to bind to cell type-specific transcription factor AP-2
KUMARAVEL SOMASUNDARAM*t, GOPALSWAMY JAYARAMAN*, TREVOR WILLIAMSt, ELIZABETH MORAN§, STEVEN FRISCH¶, AND BAYAR THIMMAPAYA*II *Lurie Cancer Center and Department of Microbiology and Immunology, Northwestern University Medical School, 303 East Chicago Avenue, Chicago, IL 60611;
tDepartment of Biology, Yale University, Kline Biology Tower, P.O. Box 208103, New Haven, CT 06520; §Fels Institute for Cancer Research and Molecular
Biology, Temple University School of Medicine, 3307 North Broad Street, Philadelphia, PA 19140; and ILa Jolla Cancer Research Foundation, 10901 Torrey Pines Road, La Jolla, CA 92037
Communicated by Laszlo Lorand, Northwestern University Medical School, Chicago, IL, December 21, 1995 (received for review October 31, 1995)
ABSTRACT Adenovirus ElA 243-amino acid protein can repress a variety of enhancer-linked viral and cellular promoters. This repression is presumed to be mediated by its interaction with and sequestration of p300, a transcriptional coactivator. Type IV 72-kDa collagenase is one of the matrix metalloproteases that has been implicated in differentiation, development, angiogenesis, and tumor metastasis. We show here that the cell type-specific transcription factor AP-2 is an important transcription factor for the activation of the type IV 72-kDa collagenase promoter and that adenovirus E1A 243amino acid protein represses this promoter by targeting AP-2. Glutathione S-transferase-affinity chromatography studies show that the E1A protein interacts with the DNA binding/dimerization region of AP-2 and that the N-terminal amino acids of ElA protein are required for this interaction. Further, ElA deletion mutants which do not bind to p300 can repress this collagenase promoter as efficiently as the wildtype ElA protein. Because the AP-2 element is present in a variety of viral and cellular enhancers which are repressed by E1A, these studies suggest that EIA protein can repress cellular and viral promoter/enhancers by forming a complex with cellular transcription factors and that this repression mechanism may be independent of its interaction with p300.
studies using human tumor cells (12). Metastatic tumor cells express matrix-degrading metalloproteases at high levels. This high level of expression correlates with the metastatic potential of these cells (13-16). The transition from localized to invasive carcinoma is accompanied by a marked disorganization and localized loss of the basement membrane components type IV collagen and laminin (16). The supression of metastasis by E1A correlates with its ability to down-regulate the expression of matrix-degrading metalloproteases (12, 13). The matrixdegrading metalloproteases include interstitial collagenase, stromelysin, and two type IV collagenases, 92-kDa and 72-kDa collagenases (17). Because type IV collagen is a major component of basement membranes and is thought to provide structural integrity, overexpression of type IV 72-kDa collagenase by invasive tumor cells is believed to be crucial for the invasion and metastasis of these cells (16). In addition to their role in tumor metastasis, the metalloproteases have also been implicated in morphogenesis, differentiation, wound healing, and angiogenesis (17). We are studying the molecular mechanisms by which these metalloprotease genes are transcriptionally regulated and, in particular, the mechanism by which E1A represses the matrix metalloprotease genes and suppresses metastasis. In this paper we show that an AP-2 element located in the enhancer region of the type IV 72-kDa collagenase gene is critical for its activation and that the adenovirus E1A 243-aa protein represses the enhancer of type IV 72-kDa collagenase gene by targeting the cell type-specific transcription factor AP-2. We present evidence that this repression is mediated by an interaction of E1A protein with the DNA binding/ dimerization region of AP-2 and that the N-terminal region of E1A protein is required for this interaction. We also show that E1A deletion mutants which do not bind to p300 can repress this collagenase promoter as efficiently as the wild-type (WT) E1A protein. These studies suggest that the E1A protein can repress cellular and viral promoter/enhancers by binding to cellular transcription factors and that this repression mechanism may be independent of its interaction with p300.
An important and yet poorly understood aspect of eukaryotic gene expression is the negative regulation of gene expression. It is increasingly becoming clear that cells and viruses may use diverse strategies to repress transcription. Adenovirus E1A protein has proven to be a powerful tool to probe into cellular transcriptional regulatory mechanisms. In particular, the viral E1A 243-amino acid (aa) protein has been shown to repress a variety of enhancer-linked cellular and viral promoters (1, 2). This repression seems to be mediated by its interaction with a 300-kDa phosphoprotein designated p300 (1-5). The protein p300 is a member of the CBP protein family whose members
function as transcriptional coactivators (6-9). These proteins bridge DNA-bound, sequence-specific transcription factors and the basal transcription complex and thereby stimulate transcription initiation. p300 is likely to stimulate a number of cellular genes by recruiting multiple sequence-specific transcription factors. E1A protein presumably inhibits the functions of p300 by binding to it. This binding is presumed to be responsible for the ElA-mediated repression (6-9). Pozzatti et al. have reported that secondary rat embryo fibroblasts (REFs) transformed by the activated ras oncogene (T24 ras) and E1A 243-aa protein are substantially less metastatic when compared to REFs transformed by ras oncogene alone (10, 11). This observation was subsequently confirmed in
MATERIALS AND METHODS The type IV 72-kDa collagenase promoter-reporter plasmids used in this study were described by Frisch and Morisaki (18). Plasmids -1900 (pT4CAT5; names shown in parentheses are original names; ref. 18) and -400 (pT4CAT pro) are type IV Abbreviations: CAT, chloramphenicol acetyltransferase; GST, glutathione S-transferase; EMSA, electrophoretic mobility shift assay; WT, wild-type; HSV, herpes simplex virus; TK, thymidine kinase. tPresent address: Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, 415 Currie Boulevard, Philadelphia, PA 19104. llTo whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
3088
Proc. Natl. Acad. Sci. USA 93 (1996)
Biochemistry: Somasundaram et al.
er/enhancer upstream from the start site in the presence or absence of an AP-2 expression plasmid (pSG AP-2; ref. 19). As a control, a plasmid containing three copies of human metallothionein (hMTIIA) promoter AP-2 motifs cloned upstream of the HSV TK promoter was transfected into HepG2 cells with or without the AP-2 expression vector. The AP-2 expression vector stimulated the 72-kDa collagenase promoter/ enhancer about 4.5-fold, whereas the TK promoter containing authentic AP-2 motifs was stimulated by the AP-2 expression vector about 3-fold (data not shown), indicating that the type IV 72-kDa collagenase promoter/enhancer contains a functional AP-2 element. Examination of the first exon sequences of the 72-kDa gene also revealed another AP-2 motif located at +250 with a sequence, GCCCGGGGC (ref. 25; designated AP-2-II in this report), that perfectly matched the consensus sequence (see below). EMSAs were carried out to determine whether the AP-2 protein binds to the two AP-2 motifs of the 72-kDa promoter. Amino acids 165-437, which contain the DNA binding/ dimerization domain of the AP-2 protein, were expressed in E. coli as a GST-fusion protein and used in EMSA with either the AP-2-I or the AP-2-II oligonucleotides as the probe. Fig. 1 shows that the AP-2 sequence, located at -1685 (AP-2-I), complexed with E. coli-based AP-2 protein (lane 2) when the AP-2-I sequence was used as a probe. Unlabeled AP-2-I competed with the AP-2-I probe efficiently (lanes 3, 4, and 5, respectively), whereas AP-2-I, containing a mutation in the AP-2 recognition sequence, competed poorly (lanes 8 and 9). As expected, unlabeled human hMTIIA AP-2 sequence competed with the AP-2-I probe efficiently (lanes 6 and 7). Higher levels of AP-2 protein bound to the AP-2-II element, indicating that this is a stronger AP-2 site than the AP-2-I site (lane 11) and that unlabeled AP-2-II oligonucleotide competed with the probe efficiently (lanes 12 and 13). AP-2-II oligonucleotide containing a mutation in the binding site did not compete (lanes 14 and 15). Unlabeled hMTIIA oligonucleotide also competed efficiently with the AP-2-II probe (lanes 16 and 17). EMSAs in which the hMTIIA AP-2 site was used as a probe and unlabeled WT or mutant AP-2-II oligonucleotides were used for competition show similar results (lanes 18-24). Thus, several lines of evidence-namely, binding of the purified AP-2 protein to the AP-2-I element in DNase I footprinting assays (18), activation of the type IV collagenase promoter/ enhancer by an AP-2 expression vector in transient assays
72-kDa promoter constructs which contain 1900- and 400-bp DNA sequences upstream from the cap site, respectively, fused to the chloramphenicol acetyltransferase (CAT) reporter gene. pBLCAT/AP-2-I (pT4CAT r2M) contains the AP-2 element taken from 1650 bp upstream of the cap site of the type IV 72-kDa collagenase gene cloned upstream of the herpes simplex virus (HSV) thymidine kinase (TK) promoter and the CAT reporter gene. pSG AP-2 is a simian virus 40 (SV40) early promoter based AP-2 expression plasmid (19). WTE1A 12S, E1A d12-36, E1A d138-67, and RG2 were described earlier (3, 4). GST-E1A, GST-E1A d12-36, GST-E1A d138-67, and GST-E1A 928/961 were described by Taylor et al. (20). GST-dlAP-2 contains AP-2 coding sequences from aa 165 to 437 fused to glutathione S-transferase (GST) (21). Deletion derivatives of AP-2 (dlN30 to dlC390) were described previously (22, 23). GST-affinity chromatography of the E1A proteins was carried out as described by Taylor et al. (20). Electrophoretic mobility shift assays (EMSAs) were performed using GST-AP-2 protein synthesised in Escherichia coli (21) as described (18).
RESULTS The Enhancer Region of the 72-kDa Type IV Collagenase Gene Contains a Functional AP-2 Element. Previous studies have shown that the promoter of the human type IV 72-kDa collagenase gene contains an enhancer approximately -1600 bp from the cap site (18). This enhancer contains an AP-2 element with the sequence GCCTGAACT located at -1685 which is essential for high-level expression of the type IV 72-kDa collagenase gene (ref. 18; this AP-2 element is designated AP-2-I in this report). Purified HeLa cell AP-2 protein protected this sequence in DNase I footprinting assays (18). The transcription factor AP-2 is a 52-kDa (437 aa) protein that functions as a dimer and binds to a GC-rich recognition sequence with dyad symmetry (22-24). Because many AP-2 binding sequences, including that of the enhancer of the 72-kDa promoter, deviate from the consensus AP-2 binding sequence GCCNNNGGC, we determined whether the AP-2 element present in the enhancer of the 72-kDa promoter is a bona fide AP-2 element. These experiments were done in HepG2 cells, which contain no detectable amounts of AP-2 (22). The cells were transfected with a CAT reporter gene driven by 1900 bp of the type IV 72-kDa collagenase promotA
AP-21
COMP: X
123
s
X
hMTIIA AP-21(M) XX
4 5 6 7
B AP-211 AP-211(04 hMTIIA x xO
X
8 9
irlrr.cy
^
x)
10 11 12 13 14 15 16
6
.-
3089
.
400 4m
AP-2 11
x
x
AP-211(M) hMTIIA
x X
x
x O
17 18 19 20 21 22 23 24
dw
0
.A
a,
&AAAAA
PROBE: hMTIIA PROBE: AP-2II - *---PROBE: AP-21-I FIG. 1. E. coli-based AP-2 protein binds to the -1685 (AP-2-I) and +250 (AP-2-II) sites of the type IV 72-kDa collagenase promoter. EMSA was carried out with AP-2 protein expressed in E. coli as a GST-fusion protein (21). The probes used are shown at the bottom. Competitor oligonucleotides are shown on the top. P, sample incubated without protein. C, sample incubated with probe and without competitor. Nucleotide sequences of the probes and competitors: AP-2-I, GATCCACACCCACCAGACAAGCCTGAACTTGTCTGAAGCCCG [underlined bases are mutated in AP-2-I (M)]; AP-2-II, AGGCGCTAATGQCCCGGGGCGCGCTCACGGG [underlined bases are mutated in AP-2-II (M)]; and hMTIIa, AGGAACTGACCGCCCGCGGCCCGTGTGCAGAG. ----
-
3090
Proc. Natl. Acad. Sci. USA 93 (1996)
Biochemistry: Somasundaram et al.
(data not shown), binding of the E. coli-based AP-2 protein to AP-2-I in EMSA (Fig. 1) and substantial stimulation, in transient assays, of the minimal 400-bp type IV 72-kDa promoter by the AP-2-I element when cloned upstream of the minimal promoter (ref. 18; see below)-suggest that the 72-kDa promoter/enhancer contains a functional AP-2 site. Currently we do not know whether the AP-2 site located downstream of the cap site at +250 can also function in the transcriptional regulation of the type IV collagenase promoter. In transient assays, CAT activity did not increase when the CAT coding sequences were cloned downstream of the second AP-2 site (K.S. and B.T., unpublished results). Adenovirus E1A Protein Represses Transcription of the Type IV Collagenase Promoter by Targeting the AP-2 Site Located at -1685. To determine whether the AP-2 site located at 1685 is the target of E1A in vivo, this AP-2 site was cloned upstream of the type IV 72-kDa collagenase basal promoter fused to CAT reporter gene (-400/AP-2-1). Previous studies have defined these 400-bp sequences as the minimal promoter of the type IV 72-kDa collagenase gene containing all elements for basal activity (18). Plasmid -400/AP-2-I was then tested for repression by E1A in transient assays using the human fibrosarcoma cell line HT1080. E1A repressed this promoter construct as efficiently as the WT promoter construct (-1900), which contains 1900 bp upstream from the start site (Fig. 2; compare lanes 1 and 2 and lanes 6 and 7; levels of repression for the WT and -400/AP-2 constructs were 12and 10-fold, respectively), whereas the basal promoter without the AP-2 site (-400) was not repressed by E1A (compare lanes 4 and 5). In another experiment, the AP-2-I element was cloned upstream of the HSV TK promoter (pBLCAT2/AP2-I) and this plasmid was tested for repression by E1A. CAT expression from this construct was also repressed by E1A by about 10-fold (compare lanes 8 and 9). E1A did not affect the expression of the TK promoter alone in the absence of AP-2-1 (pBLCAT; lanes 10 and 11). These studies suggest that the AP-2 site at -1685 is a target of E1A in vivo. The N-Terminal Region of E1A Protein Binds to AP-2 In Vitro. One mechanism by which the E1A protein may repress the AP-2-mediated activation of promoters is by binding to
AP-2 and interfering in its functions. To test this possibility, we used GST-affinity chromatography to determine whether E1A interacts with AP-2. Radiolabeled AP-2 protein was synthesized in vitro using rabbit reticulocyte lysates and incubated with GST-E1A fusion protein synthesized in E. coli immobilized on GST beads and washed to remove the unbound material. The bound material was then eluted with SDS sample buffer and analyzed on SDS/PAGE. As shown in Fig. 3A, significant amounts of AP-2 bound to WT E1A. No binding occurred when a mutant of E1A in which aa 2-36 were deleted was used (Fig. 3A, lanes 3 and 4, respectively). Lanes 6-8 represent a positive control experiment in which a variant of RB, in which aa 1-378 had been deleted, was used. This mutant retains the ElA-binding region (a gift of P. Raychaudhari, University of Illinois). Lanes 9-14 show results of another experiment in which two additional E1A mutants were tested for binding to AP-2. A mutant in which aa 38-67 were deleted and a double-point mutant, E1A 928/961, in which Cys at 124 and Glu at 135 were changed to Gly and Lys, respectively (3, 4), bound to AP-2 as efficiently as WT E1A. Thus, we conclude that E1A can bind to AP-2 and that the N-terminal amino acids are required for this interaction. Because E1A binds to p300, and because AP-2 was synthesized in rabbit reticulocyte lysates in vitro, it seemed possible that E1A and AP-2 were held together by p300 present in reticulocyte lysates. Therefore, these experiments were repeated using AP-2 synthesized in wheat germ extracts. Significant amounts of WT E1A protein and a deletion derivative, d138-67, bound to AP-2 synthesized in wheat germ extracts, whereas E1A d12-36 did not (Fig. 3B, lanes 17-19). Lanes 21-24 show the results of a positive control experiment in which a mutant of RB in which the N-terminal 378-aa sequences were deleted was used as the ElA-binding protein. These results suggest the p300 may not be involved in the AP2-E1A interaction. However, we can not rule out the possibility that a plant protein with properties similar to that of p300 from wheat germ extracts may bridge the AP-2 and E1A protein in vitro. E1A Protein Binds to the DNA Binding/Dimerization Domain of AP-2. The DNA binding and dimerization domains of AP-2 overlap in a long stretch of about 230 aa in the C-terminal 04
I aL
0
0
0-4
0
0 0
I +
0
05
I-
04 0
0
o< 04 O-
6
I + 7
I +
3
2
4
4di Alt
e
Io
5
I-
C0
4
-J
J
9
10 10
Q.
8
4
J
